No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Evidence for intragenic recombination within a novel genetic marker that distinguishes mussels in the Mytilus edulis species complex
Abstract
We have used the polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) techniques to design two genetic markers for blue mussels in the Mytilus edulis species complex. Both of these markers target the gene encoding the mussel polyphenolic adhesive protein. The first marker, Glu-5', is highly differentiated among and can be used to identify the three blue mussel species, M. edulis, M. galloprovincialis and M. trossulus. The second marker, Glu-3', can identify M. edulis and M. galloprovincialis. Using these markers we have demonstrated that hybrid mussels from Whitsand Bay, UK carry alleles for this gene that are the products of intragenic recombination. The high frequency (10 per cent) of these recombinant alleles within the hybrid population suggests that recombination is fairly frequent within this gene or that hybridization between M. edulis and M. galloprovincialis is substantial and has been occurring over considerable evolutionary time. The two novel genetic markers, Glu-5' and Glu-3' will be invaluable in additional studies regarding the importance of hybridization among blue mussels.
... Larval and spat DNA was extracted according to Zhan et al. (2008) and Gilg and Hilbish (2000), respectively. Individuals were genotyped by PCR of the Glu-5ʹ gene, which differs diagnostically between the two parental species, using the protocol of Rawson et al. (1996) except using primers Me-15 and Me-16 developed by Inoue et al. (1995). Many species of bivalve larvae are morphologically similar, so prior to genotyping larvae at the Glu-5′ gene we determined which individuals were mussels in the genus Mytilus using PCR following the protocol of Larsen et al. (2005). ...
... In contrast the frequency of this allele among new recruits in the southwest England hybrid zone is typically 0.95 (Gilg & Hilbish, 2003a, 2003b. In this study, we used the genetic marker Glu-5′ (Rawson et al., 1996) to assess the genetic composition of hybrid mussel populations. Glu-5′ is highly differentiated between Mytilus edulis and M. galloprovincialis and is highly correlated with other genetic markers used to distinguish these two species (Rawson et al., 1996). ...
... In this study, we used the genetic marker Glu-5′ (Rawson et al., 1996) to assess the genetic composition of hybrid mussel populations. Glu-5′ is highly differentiated between Mytilus edulis and M. galloprovincialis and is highly correlated with other genetic markers used to distinguish these two species (Rawson et al., 1996). ...
Hybridization among related species is now recognized as common but it remains unclear how hybrid zones persist for prolonged periods. Here, we test the hypothesis that selection in different components of the life cycle may stabilize a hybrid zone. A hybrid zone occurs in southwest England between the marine mussels Mytilus edulis and M. galloprovincialis . Previous studies have found strong directional selection against alleles from M. edulis occurs among hybrids in the adult stage. Traditional hybrid zone models argue that alleles that are selected within the hybrid zone are replaced by migration from neighboring parental population into the hybrid zone. In this system, however, migration occurs out of this hybrid zone into neighboring parental populations. This hybrid zone should therefore be unstable and dissipate, yet this zone has persisted for more than 30 years. We tested and rejected the hypothesis that differences in fecundity may select for M. edulis alleles within this hybrid zone and thus counter the selection observed against these alleles among adults. We also tested the hypothesis that selection during the larval stage may counter selection against M. edulis alleles in the adult stage. We found that selection favors M. edulis alleles during the veliger stage of larval development. The direction and strength of selection during the larval stage are sufficient to counter strong selection during the adult portion of the life cycle. This hybrid zone is stabilized by opposing forms of directional selection operating in different portions of the life cycle.
... Specimens with ambiguous Glu-5 0 alleles were PCR amplified with an alternative primer set (JH-5/JH-54; Rawson et al. 1996b). PCR products were Sanger sequenced after enzymatic clean-up with ExoSAP-IT (USB Europe GmbH, Staufen, Germany), cycle sequencing using the PCR primers, the BIGDYE TERMINATOR v3.1 Cycle Sequencing Kit (Applied Biosystems) and an ABI 3130xl Genetic Analyser (Applied Biosystems, Foster City, CA, USA). ...
... PCR products were Sanger sequenced after enzymatic clean-up with ExoSAP-IT (USB Europe GmbH, Staufen, Germany), cycle sequencing using the PCR primers, the BIGDYE TERMINATOR v3.1 Cycle Sequencing Kit (Applied Biosystems) and an ABI 3130xl Genetic Analyser (Applied Biosystems, Foster City, CA, USA). In addition, these specimens were also analysed using the Glu-3 0 marker (3 0 part of the giant exon encoding the polyphenolic adhesive foot protein and adjacent intron; primers PR-8/JH4; Rawson et al. 1996b). The Glu-3 0 marker becomes species diagnostic upon restriction digest (DdeI; NEB, Frankfurt Main, Germany) of PCR products. ...
... The Glu-3 0 marker becomes species diagnostic upon restriction digest (DdeI; NEB, Frankfurt Main, Germany) of PCR products. As the Glu5 0 and Glu3 0 marker loci are species diagnostic and genetically linked, they are in combination indicative for interspecific recombinants in secondary contact zones (Rawson et al. 1996b). ...
While secondary contact between Mytilus edulis and M. trossulus in North America results in mosaic hybrid zone formation, both species form a hybrid swarm in the Baltic. Despite pervasive gene flow, Baltic Mytilus species maintain substantial genetic and phenotypic differentiation. Exploring mechanisms underlying the contrasting genetic composition in Baltic Mytilus species will allow insights into processes such as speciation or adaptation to extremely low salinity. Previous studies in the Baltic indicated that only weak interspecific reproductive barriers exist and discussed the putative role of adaptation to environmental conditions. Using a combination of hydrodynamic modelling and multilocus genotyping we investigate how oceanographic conditions influence passive larval dispersal and hybrid swarm formation in the Baltic. By combining our analyses with previous knowledge we show a genetic transition of Baltic Mytilus species along longitude 12°-13°E, i.e. a virtual line between Malmö (Sweden) and Stralsund (Germany). Although larval transport only occurs over short distances (10-30 km), limited larval dispersal could not explain the position of this genetic transition zone. Instead, the genetic transition zone is located at the area of maximum salinity change (15 to 10 psu). Thus, we argue that selection results in weak reproductive barriers and local adaptation. This scenario could maintain genetic and phenotypic differences between Baltic Mytilus species despite pervasive introgressive hybridization. This article is protected by copyright. All rights reserved.
... PCR products were digested with HhaI (New England Biolabs). Glu-3′ and Glu-5′ markers amplify different segments of the polyphenolic adhesive byssal thread protein and can identify all three Mytilus species (Rawson et al., 1996). Glu-3′ was amplified using primers JH-4 and PR-8 (Rawson et al., 1996), but modified so that JH-4 was labelled with a HEX tag and PR-8 with a poly-A tail, using the following thermal cycling conditions: initial denaturation of 95°C for 15 min, followed by 30 cycles of 94°C for 30 s (denaturation), 52°C for 30 s (annealing), 72°C for 30 s (extension), with a final elongation step of 70°C for 5 min. ...
... Glu-3′ and Glu-5′ markers amplify different segments of the polyphenolic adhesive byssal thread protein and can identify all three Mytilus species (Rawson et al., 1996). Glu-3′ was amplified using primers JH-4 and PR-8 (Rawson et al., 1996), but modified so that JH-4 was labelled with a HEX tag and PR-8 with a poly-A tail, using the following thermal cycling conditions: initial denaturation of 95°C for 15 min, followed by 30 cycles of 94°C for 30 s (denaturation), 52°C for 30 s (annealing), 72°C for 30 s (extension), with a final elongation step of 70°C for 5 min. The same cycling conditions were used to amplify Glu-5′ using primers JH-5 and JH-54 (Rawson et al., 1996), modified by the attachment of a 6-FAM fluorescent tag to the 5′ end of JH-5 and the addition of a poly-A tail to the 5′ end of JH-54. ...
... Glu-3′ was amplified using primers JH-4 and PR-8 (Rawson et al., 1996), but modified so that JH-4 was labelled with a HEX tag and PR-8 with a poly-A tail, using the following thermal cycling conditions: initial denaturation of 95°C for 15 min, followed by 30 cycles of 94°C for 30 s (denaturation), 52°C for 30 s (annealing), 72°C for 30 s (extension), with a final elongation step of 70°C for 5 min. The same cycling conditions were used to amplify Glu-5′ using primers JH-5 and JH-54 (Rawson et al., 1996), modified by the attachment of a 6-FAM fluorescent tag to the 5′ end of JH-5 and the addition of a poly-A tail to the 5′ end of JH-54. The fourth marker, Mytilus Anonymous Locus-1 (Mal-1) can discriminate M. trossulus from M. edulis/M. ...
The common blue mussel (Mytilus edulis) was introduced to British Columbia, Canada, in the 1980′s as an aquaculture alternative to native mussel species. Since then, the mussel industry in Pacific Canada has expanded and includes operations utilizing traditional methods of broodstock selection based on visual qualitative and quantitative traits. The impacts of hatchery propagation on genetic diversity and implications for animal fitness have been previously studied for other aquatic species, and this study further examines the effect of hatchery production on three M. edulis aquaculture populations in relation to a wild originator population. Prior to microsatellite genetic analysis, animals were identified to species using nuclear markers and were found to contain varying proportions of pure M. edulis as well as other pure species and hybrids from the ‘Mytilus edulis complex’. Subsequently seven microsatellite markers were used to genotype 166 pure adult M. edulis individuals, all of which exhibited high levels of polymorphism. Allele frequencies at multiple loci did not conform to Hardy–Weinberg expectations and substantially less genetic diversity and very low effective population size estimates (Ne, calculated from linkage disequilibrium) were observed in farmed populations compared to the wild reference population. All populations were found to be genetically distinct based on FST estimates. Mean allelic richness was approximately three times higher in the wild reference population than the three farmed populations (21 compared to 7.51, 7.91 in the two populations selecting for size and 8.24 in the population selecting for a colour morph). Observed heterozygosity was not significantly decreased in the cultured colour morph population, but was significantly different in the two other culture populations in comparison to the wild group. Reduced genetic diversity of the aquaculture populations is likely due to hatchery propagation methods creating genetic drift and probable small effective breeding groups over successive populations. Any influence of broodstock selection practices is tentative and should be addressed in further temporal studies. These results indicate the need for the effective management of hatchery operations, the importance of rigorous site inventory, genetic broodstock characterization, and that ideally pedigree programs should be developed to help maintain healthy and productive shellfish culture populations with adaptive fitness capacity.
... We sampled a total of 353 mussels from the two barges' hulls for both genetic and length analyses. In order to genetically support the morphological species attribution, we used PCR amplification and amplicon length polymorphism analysis following Rawson et al. (1996a). A total of 38 Mytilus speci-mens, 21 from the Pioneer and 17 from the M30, were collected, stored in Ethanol 100° and subjected to Glu-5' PCR assays (Rawson et al., 1996a). ...
... In order to genetically support the morphological species attribution, we used PCR amplification and amplicon length polymorphism analysis following Rawson et al. (1996a). A total of 38 Mytilus speci-mens, 21 from the Pioneer and 17 from the M30, were collected, stored in Ethanol 100° and subjected to Glu-5' PCR assays (Rawson et al., 1996a). DNA extraction was performed using the standard phenol-chloroform method (Oliverio & Mariottini, 2001) on a tissue fragment obtained from the foot of the mussels. ...
... DNA extraction was performed using the standard phenol-chloroform method (Oliverio & Mariottini, 2001) on a tissue fragment obtained from the foot of the mussels. We used the primer pair JH-5 and JH-54 (Rawson et al., 1996a) to amplify the 5' region of the Glu gene, using the original PCR protocol with slight modifications (35 amplification cycles of 94°C for 30'', 54°C for 30'' and 72°C for 1'). Amplified fragments were visualized by running 10 µl of the PCR product on a 1.5% agarose gel stained with ethidium bromide. ...
The Costa Concordia cruise-ship disaster occurred just off the coast of Italy on January 13 th , 2012, and entailed the largest marine salvage operation in history. The salvage employed vessels from different European harbours, providing an unexpected means for transporting alien species into the Mediterranean. In this work we identified mussel species using fragments length polymorphism of a nuclear locus and report the first evidence of the transport of the blue mussel, Mytilus edulis Linnaeus, 1758 (Bivalvia: Mollusca), into the Mediterranean Sea, as a part of the fouling community of the hull of an accommodation barge arrived from a NE Atlantic location in October 2012. Furthermore, we describe the rapid growth of this species, under the ASV Pioneer, until its almost total extinction during the summer of 2013, which left a covering of mussel shells on the underlying Posi-donia oceanica (Linnaeus) Delile, 1813 meadow. This high mortality rate indicated that M. edulis had been exposed to high stress conditions, probably due to different salinity, temperature, and oligotrophic conditions from its place of origin, and there was no spawning event or known settlement on the nearest infralittoral natural habitats. This event reminds us of how the Mediterranean Sea is constantly under alien species pressure, due to human activities.
... Mussels belonging to the 'Mytilus edulis species complex' have been the focus of numerous studies exploring the systematics, hybridisation and taxonomic status of this group (Koehn 1991;McDonald et al. 1991;Väinölä and Hvilsom 1991;Gosling 1992;Skurikhina et al. 2001;Beaumont et al. 2008;Elliott et al. 2008). The species complex is composed of the closely related M. edulis Linnaeus, 1758, Mytilus galloprovincialis Lamarck, 1819, and Mytilus trossulus Gould, 1850 (McDonald andKoehn 1988;Koehn 1991;McDonald et al. 1991;Gosling 1992;Rawson et al. 1996;Toro et al. 2005;Beaumont et al. 2008;Gardner and Thompson 2009). M. edulis and M. galloprovincialis have an 'anti tropical' or 'bipolar' distribution (Hilbish et al. 2000;Gérard et al. 2008) with a pole-ward range contraction due to a preference for inhabiting the more temperate waters of the northern and southern hemisphere (Jones et al. 2010), whereas the distribution of M. trossulus is limited to the northern hemisphere region (Hilbish et al. 2000;Riginos and Cunningham 2005;Beaumont et al. 2008). ...
... Although morphological characteristics can be used to distinguish between species in the M. edulis complex at a local scale, high levels of environmentally induced plasticity in shell shape, height, length and colour mean that morphology is not a reliable species indicator (Toro 1998;Matsumasa et al. 1999). Molecular markers have been used extensively to identify and characterise the taxonomic status and population structure of the three species and their hybrids (McDonald et al. 1991;Gosling 1992;Rawson et al. 1996;Hilbish et al. 2000;Riginos et al. 2004;Riginos and Cunningham 2005;Borsa et al. 2007;Gérard et al. 2008;Larraín et al. 2014). Allozyme markers were initially used to provide the first support for genetic characterisation of the three species of the M. edulis complex. ...
... Nuclear DNA and mitochondrial markers have more recently been used to distinguish between the species within the M. edulis species complex. The nuclear coding Glu-5 0 and Glu-3 0 markers have been used to distinguish northern hemisphere M. edulis and M. galloprovincialis and M. trossulus (Rawson et al. 1996;Borsa et al. 2007) but unable to distinguish different M. galloprovincialis lineages. The Me15/16 nuclear marker (Inoue et al. 1995) has been shown to be useful in distinguishing between the three species in most instances, whereas a 16s rRNA restriction fragment length polymorphism (RFLP) has recently been developed that putatively distinguished between northern and southern hemisphere M. galloprovincialis lineages . ...
Mussels belonging to the Mytilus edulis species complex have been the focus of numerous studies exploring the systematics and origin of this commercially and ecologically important genus. Species have wide geographical ranges and hybridise where their distributions overlap, making identification difficult. Several molecular markers have been used to distinguish between the species within the M. edulis species complex; however, no single marker system has been found to be completely diagnostic, and a combination of markers are used. Here, we used a combination of three nuclear genes and a mitochondrial gene region to assess the species composition of Mytilus mussels collected across its geographical range in Australia. Our results show that the majority (98.5%) of individuals sampled from Australian populations are Mytilus galloprovincialis, with 56.2% of them displaying a southern hemisphere haplotype, 10.3% displaying a putatively northern hemisphere haplotype, and 32% having M. galloprovincialis genotypes consistent with either northern or southern hemisphere M. galloprovincialis lineages. The taxonomic origin of the remaining 1.5% of samples (n ¼ 3) could not be conclusively determined. Our results suggest that there have been significant introductions of non-native M. galloprovincialis lineages into both southern and northern hemisphere populations.
... The objective of this study was to examine the genomewide patterns of introgression between invasive M. galloprovincialis and native M. trossulus across their zone of hybridization in central California. As its introduction to southern California in the early 1900s, M. galloprovincialis has expanded northward and displaced M. trossulus from the southern part of its native range (Rawson et al. 1996(Rawson et al. , 1999Geller 1999;Braby & Somero 2005;Lockwood & Somero 2011). Theory predicts that the rapid northward population expansion of M. galloprovincialis into coastal regions containing native M. trossulus should produce asymmetric introgression of genes into the invading species (Buggs 2007;Currat et al. 2008). ...
... In contrast, there was an abundance of hybrid scores around 0.5 (F 1 hybrids) and close to 0 (pure M. trossulus) or 1 (pure M. galloprovincialis) (Fig. 3). We observed substantial heterogeneity in the genetic composition between different sites and at the same site across years, which is consistent with earlier studies that used small numbers of markers (Sarver & Foltz 1993;Rawson et al. 1996Rawson et al. , 1999Suchanek et al. 1997;Braby & Somero 2005). For example, the percentage of M. galloprovincialis in samples from Berkeley was~25% in the 1990s,~60% in the 2000s and~80% in the present study. ...
... However, most hybrid zones studied to date are well established and thus provide little insight into the genetic consequences that occur during the initial phase of secondary contact. Our study investigated the genetic impact of an invasion by M. galloprovincialis into southern and central California that has displaced the native M. trossulus and resulted in the formation of a mosaic hybrid zone in the San Francisco Bay area (Rawson et al. 1996(Rawson et al. , 1999Geller 1999;Braby & Somero 2005). We observed complex patterns of weak introgression across the hybrid zone suggesting strong selection against hybrids and the erratic population expansion of M. galloprovincialis have played important roles in shaping the genetic composition of mussel populations across this region. ...
The ecological and genetic factors determining the extent of introgression between species in secondary contact zones remain poorly understood. Here, we investigate the relative importance of isolating barriersand the demographic expansion of invasive Mytilus galloprovincialison the magnitude and the direction of introgression with the native M. trossulus in a hybrid zone incentral California. We use double-digest restriction-site associated DNA sequencing (ddRADseq) to genotype 1,337 randomly-selected single nucleotide polymorphismsand accurately distinguish early and advanced generation hybrids for the first time in the central California Mytilus spp. hybrid zone. Weaklevels of introgression were observed in both directions but wereslightly more prevalent from the native M. trossulus into the invasive M. galloprovincialis. Few early and advanced backcrossed individuals were observed across the hybrid zone confirming the presence of strong barriers to interbreeding.Heterogeneous patterns of admixture across the zone of contact were consistent with the colonization history of M. galloprovincialis with more extensive introgression in northern localities furthest away from the putative site of introduction in southern California. These observations reinforce the importance of dynamic spatial and demographic expansionsin determining patterns of introgression between close congeners, even in those with high dispersal potential and well-developed reproductive barriers. Our results suggest that the threat posed by invasive M. galloprovincialis is more ecological than genetic as it has, and continues to, displace the native M. trossulus from much of central and southern California. This article is protected by copyright. All rights reserved.
This article is protected by copyright. All rights reserved.
... The three mussel species forming the "blue mussel complex" (i.e., Mytilus edulis, M. trossulus, and M. galloprovincialis) form hybrid zones wherever their distributions overlap (Rawson et al 1999). Hybridizations between M. edulis and M. galloprovincialis currently occur in the eastern Atlantic and between M. edulis and M. trossulus in the western Atlantic and Baltic Sea (Seed 1992;Gardner 1994;Rawson et al 1996;Comesaña and Sanjuan 1997;Wilhelm and Hilbish 1998;Comesaña et al 1999). With the recent human introduction of M. galloprovincialis, hybridization between it and M. trossulus has recently been established in Japan (Inoue et al 1995(Inoue et al , 1997, central California (Suchanek et al 1997), and Puget Sound (Heath et al 1995). ...
... indicates some low frequency introgression since colonization of Mg ~100 years ago (maximum of ~50 generations). Results indicate a high degree of heterogeneity in genotypes across time and space, which generally agrees with earlier findings (i.e., Sarver and Foltz 1993;Rawson et al 1996Rawson et al , 1999Suchanek et al 1997;Braby et al 2005). For example, a samples from Berkeley were made up of ~25% Mg in the 1990's, ~60% Mg in the 2000's, and ~80% in this study, and samples from San Rafael 26 were made up of ~25% in the 1990s, ~40% in the 2000's, and only 2% in this study (Supplemental Figure 1.S4). ...
... Delta genotype frequency was calculated as the difference in genotype frequency in scored SNPs between Mt from Newport Harbor, Oregon (n=15) and Mg from Sète, France (n=6). Sarver and Foltz (1993), Rawson et al (1996Rawson et al ( , 1999 and Suchanek et al (1997), which includes 25-85 individuals per site and 1-3 genetic markers. (B) Results from the "2000's" produced by Braby et al (2005), which includes an average of 61 individuals per sample, and 2 genetic markers. ...
My dissertation addressed questions of the origin and maintenance of biodiversity, and the genomic response to environmental change in blue mussels (genus Mytilus). In chapters One and Two I explored the nature of species barriers and the consequence of hybridization. The ecological and genetic factors determining the extent of introgression between species in secondary contact zones remain poorly understood. I investigated the relative importance of natural selection and the demographic expansion of invasive Mytilus galloprovincialis on the magnitude and the direction of introgression with the native M. trossulus in a hybrid zone in central California. I used double-digest restriction-site associated DNA sequencing (ddRADseq) to genotype 1,751 randomly-selected single nucleotide polymorphisms and accurately distinguish early and advanced generation hybrids for the first time in Mytilus. I found that ecologically based selection plays only a small direct role in maintaining reproductive isolation in the California hybrid zone, and that colonization history is an important control on the movement of genetic elements (i.e. introgression) during hybridization. Despite only low rates of hybridization between invasive Mediterranean blue mussel (M. galloprovincialis) and native blue mussel M. trossulus, introgression is occurring, and the geographic spread of M. galloprovincialis appears to drive the majority of introgression into the invasive species. My work reinforces the idea that demographic processes mediate the role played by natural selection in maintaining species barriers.
Chapter Three focused on the genetic consequences of large-scale environmental change. I developed new techniques using mRNA sequencing and ancestral state reconstruction to estimate rates of structurally stabilizing substitutions in blue mussels. I found that warm-adapted Mytilus galloprovincialis have higher rates of stabilizing substitutions than cold-adapted M. trossulus, which suggests that natural selection can efficiently modify structural properties of proteins to fine-tune thermal tolerance based on small changes in temperature of just several ̊C. As a whole, my dissertation reiterates the importance of demographic processes in controlling the movement of genetic material during hybridization, indicates introgression may contribute to invasive success, and documents subtle natural selection for changes in protein properties of warm adapted M. galloprovincialis.
... To determine whether the genetic polymorphism of the blue mussel population of Kerguelen is driven by neutral and/or adaptive forces, we (i) investigated the influence of the water circulation around Kerguelen, first on the total genetic structure and second within differentiated groups and (ii) tested the influence of the habitat type at a smaller scale. To fill in these objectives, we used two nuclear markers polymorphic in Kerguelen blue mussels: Glu-5 0 (Inoue et al. 1995;Rawson et al. 1996) and mac-1 (Ohresser et al. 1997), and we also considered the sequence polymorphism at the mitochondrial DNA locus COI (G erard et al. 2008). We tested the polymorphism at EFbis (Bierne et al. 2002a) and EFprem's (this study), two introns of the elongation factor 1 alpha gene, which are physically linked. ...
... The locus Glu-5 0 (Inoue et al. 1995;Rawson et al. 1996) is located at the 5 0 extremity of exon Glu coding for an adhesive foot protein (Waite 1992). This locus contains an insertion/deletion (indel) zone, whose amplification reveals three alleles: (T, E and G) that, respectively distinguish M. trossulus, M. edulis, and M. galloprovincialis in the Northern Hemisphere (Borsa et al. 1999). ...
... The locus Glu-5 0 has traditionally been considered as diagnostic between smooth-shell Mytilus species in the Northern Hemisphere (Inoue et al. 1995;Rawson et al. 1996;Borsa et al. 1999;Daguin and Borsa 2000;Daguin (Weir and Cockerham 1984), F CT (AMOVA) calculated between samples of Kerguelen blue mussels grouped by categories for each environmental variable at the three loci considering either the whole archipelago or the Gulf of Morbihan. Bold values are significant after FDR correction for multiple tests per column. ...
The Kerguelen archipelago, isolated in the Southern Ocean, shelters a blue mussel Mytilus metapopulation far from any influence of continental populations or any known hybrid zone. The finely carved coast leads to a highly heterogeneous habitat. We investigated the impact of the environment on the genetic structure in those Kerguelen blue mussels by relating allele frequencies to habitat descriptors. A total sample comprising up to 2248 individuals from 35 locations was characterized using two nuclear markers, mac-1 and Glu-5’, and a mitochondrial marker (COI). The frequency data from 9 allozyme loci in 9 of these locations were also reanalysed. Two other nuclear markers (EFbis and EFprem’s) were monomorphic. Compared to Northern-Hemisphere populations, polymorphism in Kerguelen blue mussels was lower for all markers except for the exon Glu-5’. At Glu-5’, genetic differences were observed between samples from distinct regions (FCT=0.077), as well as within two regions, including between samples separated by less than 500 meters. No significant differentiation was observed in the AMOVA analyses at the two other markers (mac-1 and COI). Like mac-1, all allozyme loci genotyped in a previous publication, displayed lower differentiation (Jost's D) and FST values than Glu-5'. Power simulations and confidence intervals support that Glu-5’ displays significantly higher differentiation than the other loci (except a single allozyme for which confidence intervals overlap). AMOVA analyses revealed significant effects of the giant kelp Macrocystis and wave exposure on this marker. We discuss the influence of hydrological conditions on the genetic differentiation among regions. In marine organisms with high fecundity and high dispersal potential, gene flow tends to erase differentiation, but this study showed significant differentiation at very small distance. This may be explained by the particular hydrology and the carved coastline of the Kerguelen archipelago, together with spatially variable selection at Glu-5’.
... ITS (Heath, Rawson, & Hilbish, 1995) and Glu-5' (Rawson, Joyner, Meetze, & Hilbish, 1996). Glu-5' primers target the protein coding region for a polyphenolic adhesive protein which is used by mussels to attach byssal threads, whereas ITS (internal transcribed spacer) primers amplify the ITS-1, 5.8S, and ITS-2 regions of rDNA. ...
... The restriction digests were incubated at 37°C for 6 hr followed by a 20-min incubation at 65°C. The Glu-5′ PCRs were set up in 10 µl volumes containing 25 ng of genomic DNA and 1X PCR buffer ((NH 4 ) 2 SO 4 buffer (MBI Fermentas), 1.5 mM MgCl 2 (Fermentas), 0.2 mM dNTPs, 0.2 μM each primer, and 0.05 U Taq polymerase (Fermentas)); the PCR cycles were as described by Rawson, Joyner, et al. (1996). The PCR products (Glu-5′) and RFLP products (ITS) were size fractionated on 2% agarose gels using Tris-acetate-EDTA (TAE) buffer. ...
Blue mussels of the genus Mytilus form extensive hybrid zones in the North Atlantic and elsewhere where the distributions of different species overlap. Mytilus species transmit both maternal and paternal mtDNA through egg and sperm, respectively, a process known as doubly uniparental inheritance (DUI), and some females produce
offspring with extremely biased sex ratios. These two traits have been shown to be linked and maternally controlled, with sex determination involving nuclear–cytoplasmic interactions. Hybridization has been shown to disrupt DUI mitochondrial inheritance and sex ratio bias; however, the effect of hybridization on reproductive fitness
has not previously been examined. We investigated this effect in M. edulis × M. trossulus crosses through histological examination of mature F1 progeny, and spawning of F1 hybrids to monitor survival of their progeny through to the D stage of larval development. For progeny produced from mothers with a strong bias toward female offspring (often 100%) in pure‐bred crosses, there was a clear breakdown in female dominance of progeny and significantly more hermaphrodites in the hybrid crosses produced from sperm with the M‐tr1 mitotype. We also found significant sex‐specific differences among hybrid progeny, with females producing normal eggs while males and hermaphrodites evidenced impaired gonadal development with significantly greater numbers of Sertoli cells, phagocytic hemocytes, and degenerating germ cells, all associated with gonad resorption. Males from crosses where DUI was disrupted and where
male progeny were homoplasmic for the female mtDNA were the most severely compromised. Allelic incongruity between maternal and paternal mitotypes in hybrid crosses was associated with significant disruption of male gonadal development.
... Less than 20 milligrams of wet mantle tissue was taken from each mussel and DNA was extracted using a modified-Chelex method [26]. The DNA samples were amplified by PCR using M. edulis specific primers (forward-GTAGGAACAAAGCATGAACCA and reverse GGGGGGATAAGTTTTCTTAGG) [27]. The PCR reaction mix utilized SSO advanced universal SYBR green supermix (Biorad) and standard conditions (94˚C for 3 minutes, followed by 30 cycles of 94˚C for 30 seconds, 54˚C for 30 seconds and 72˚C for 1 minute and a final elongation step of 72˚C for 1 minute). ...
... Previous work characterized 95% of the mussels in the sampling area to be M. edulis [32]. Present data verified that all experimental animals were M. edulis [27]. It is possible that M. edulis is accustomed to a larger range in pH than M. coruscus, making it difficult to generalize the findings on M. edulis to this species. ...
Blue mussel (Mytilus edulis) produce byssal threads to anchor themselves to the substrate. These threads are always exposed to the surrounding environmental conditions. Understanding how environmental pH affects these threads is crucial in understanding how climate change can affect mussels. This work examines three factors (load at failure, thread extensibility, and total thread counts) that indicate the performance of byssal threads as well as condition index to assess impacts on the physiological condition of mussels held in artificial seawater acidified by the addition of CO2. There was no significant variation between the control (~786 μatm CO2 / ~7.98 pH/ ~2805 μmol kg⁻¹ total alkalinity) and acidified (~2555 μatm CO2 / ~7.47 pH/ ~2650 μmol kg⁻¹ total alkalinity) treatment groups in any of these factors. The results of this study suggest that ocean acidification by CO2 addition has no significant effect on the quality and performance of threads produced by M. edulis.
... Together with M. edulis (Atlantic mussel) and M. trossulus (Baltic mussel), it is included in the taxonomic complex of "blue mussels." Application of genetic approaches allowed researchers to fix the status of independent species after M. galloprovincialis, M. edulis, and M. trossulus [12][13][14]. However, biological studies are complicated by possibility of interspecies hybridization that leads to the formation of hybrid zones on the borders of their ranges [15,16]. ...
... This allows us to reliably assign these studied specimens to the "blue mussel" complex. Study of genetic relationships of the COI genes of M. galloprovincialis, M. edulis, and M. trossulus is significantly complicated because of the possibility of introgression [23,24] and mtDNA recombination [14,32] followed by the formation of common haplotypes [29]. However, on the basis of published data, the identification of the specimens as belonging to the M. galloprovincialis species is possible. ...
The variability of the nucleotide sequences of the fragment of the COI gene of the female genome was studied in four phenotypic groups of the Black Sea mollusk Mytilus galloprovincialis. It was shown that the parameters of genomic diversity (the number of haplotypes, haplotypic and nucleotide diversity, and the number of nucleotide substitutions, including pairwise ones) in mussels with dark shell color are significantly higher than in individuals with light color phenotypes. The revealed differences are related to the peculiarities of ecological preferences of mussels with dark and light shells.
... The locus Glu 5 ′ encodes the polyphenolic adhesive protein in Mytilus spp. (Rawson et al. 1996) and provides species-specific products after PCR: one or two fragments 350/380 base pairs (bp) long correspond to M. edulis, one 240 bp long fragment to M. trossulus, and one or two fragments of 200/300/ 500 bp to M. galloprovincialis. Amplification was performed with the primers JH-5 and JH-54 described by Rawson et al. (1996) and the conditions described therein. ...
... (Rawson et al. 1996) and provides species-specific products after PCR: one or two fragments 350/380 base pairs (bp) long correspond to M. edulis, one 240 bp long fragment to M. trossulus, and one or two fragments of 200/300/ 500 bp to M. galloprovincialis. Amplification was performed with the primers JH-5 and JH-54 described by Rawson et al. (1996) and the conditions described therein. Amplified products were directly resolved in a 3% agarose gel stained with ethidium bromide and compared with a GeneRuler 100 bp DNA Ladder (Thermo Scientific). ...
Ports are gateways for aquatic invasions. New arrivals from maritime traffic and disturbed environmental conditions can promote the settlement of exotic species. Molluscs fall into the most prevalent group of invasive species and can have a tremendous impact on aquatic ecosystems. Here we have investigated exotic molluscs in three ports with different intensities of maritime traffic in the Cantabrian Sea. DNA Barcodes were employed to identify the species using BLASTn and BOLD IDS assignment. Deep morphological analysis using diagnostic criteria confirmed BLAST species assignation based on COI and 16S rRNA genes. Results confirmed the usefulness of DNA barcoding for detecting exotic species that are visually similar to native species. Three exotic bivalves were identified: Ostrea stentina (dwarf oyster), the highly invasive Crassostrea gigas (Pacific oyster) and Xenostrobus securis (pygmy mussel). This is the first record of O. stentina in the Bay of Biscay and the second of X. securis in the Cantabrian Sea. Furthermore, we report on the presence of the cryptogenic mussel Mytilaster minimus in the central Cantabrian Sea. These exotic species might have been overlooked due to their phenotypic similarity with co-occurring oyster and mussel species. This study illustrates how combining morphological and DNA taxonomic analysis can help in port and marina biosecurity surveys.
... They are however genetically different and can be distinguished employing different molecular markers, such as allozymes (McDonald et al. 1991), nuclear 18S rDNA (Kenchington et al. 1995, genes coding for adhesive foot proteins (e.g. Inoue et al. 1995;Rawson et al. 1996), intronspanning primers (Bierne et al. 2002), microsatellites (e.g. Lallias et al. 2009), and SNP (e.g. ...
... Two PCR reactions employing different primer pairs that anneal within that gene were done to double-check the heterozygote or homozygote status of the samples. For the primers JH-5 and JH-54 (Rawson et al. 1996), the expected amplification products are one or two fragments 350/380 base pairs (bp) long for M. edulis, one 240 bp long fragment for M. trossulus, and one or two fragments of 300/500 bp for M. galloprovincialis. The primers Me-15 and Me-16 (Inoue et al. 1995) yield amplification fragments 180 bp long for M. edulis, 168 bp long for M. trossulus and 126 bp long for M. galloprovincialis. ...
Aquaculture can promote the introduction of non-indigenous species (NIS) into wild marine environments. In addition, NIS aquaculture escapees may hybridize with closely-related native species introducing foreign alleles to their gene pool. To quantify the influence of mussel aquaculture on the native community in British Columbia we sampled mussels from fourteen locations on Vancouver Island. There are two native species in this region, M. trossulus and M. californianus, and two farmed NIS, Mytilus edulis and M. galloprovincialis, both originally from Europe. DNA was extracted from mussel tissue and the mitochondrial cytochrome c oxydase subunit 1 (COI) gene was sequenced. One nuclear locus that exhibits different alleles for M. edulis, M. galloprovincialis and M. trossulus (Glu-5′) was also characterized, using PCR, in order to identify heterozygotes. We found the proportion of NIS introgression depended primarily on farm density. Other habitat traits such as the degree of exposure to the open sea and, to a minor extent, salinity, contributed significantly to explain the distribution of introgressed individuals. Different habitat preference of NIS and native species, and marine currents, provide additional explanations for the distribution of alien and native species along Vancouver Island coasts. As a whole, our results suggest that native M. trossulus populations are more introgressed by M. galloprovincialis genes in open habitats.
... Recently, two PCR-based DNA markers have been developed that claim to distinguish adult mussels of all three species in the M. edulis species complex (Inoue, Waite, Matsuoka, Odo & Harayama, 1995;Rawson, Joyner, Meetze & Hilbish, 1996). Both markers are located within the nuclear gene encoding a polyphenolic adhesive protein, important in attachment of mussels to the substrate. ...
... Both markers are located within the nuclear gene encoding a polyphenolic adhesive protein, important in attachment of mussels to the substrate. The marker reported by Rawson et al. (1996), Glu-5Ј, produced species-specific bands, but additional bands were also detected. For Me 15/16, the marker of Inoue et al. (1995), single diagnostic bands were produced from each species. ...
The advent of polymerase chain reaction (PCR)-based DNA markers, which claim to identify species diagnostically in the Mytilus edulis complex (M. edulis, M. galloprovincialis and M. trossulus) presents a possible method for simple, rapid species identification of Mytilus larvae. This study examines the inheritance of the Me 15/16 nuclear-DNA locus, which has previously been shown to produce three alleles diagnostic for M. edulis, M. galloprovincialis and M. trossulus. The Me 15/16 genotype was determined for pure species and hybrid larvae from 13 laboratory crosses between these three species and for adult mussels from five natural populations from which the parents of the crosses were selected. Genotype frequencies in the parent populations were generally as expected for M. edulis and M. galloprovincialis, but M. trossulus populations from eastern Canada and the Baltic Sea gave unexpected results. The marker was readily detected in individual larvae sampled 72 h and 2 weeks after fertilization, but amplification from 3 h old larvae was less reliable. Each cross produced larvae of all the expected genotypes and the results demonstrate that each of the three alleles can be inherited from either sex. The marker appears to be inherited in a Mendelian manner and should be of potential use in the future study of larvae in the M. edulis complex.
... trossulus from Newport, OR, USA; M. galloprovincialis from Santa Barbara, CA, USA) using the polymorphic molecular markers Glu-5′ and ITS-1. These marker regions were amplified with established primers (Heath et al., 1995;Rawson et al., 1996). Only one putative M. trossulus was mis-identified; its molecular markers were consistent with M. galloprovincialis. ...
The physiological mechanisms that limit thermal tolerance are broadly relevant to comparative biology and global change. Species differences in macromolecular stability play important roles in evolved patterns of heat tolerance, but other mechanisms such as oxidative stress have also been hypothesized to contribute. For example, mussels in the genus Mytilus exhibit evolved physiological differences at several levels of organization that have been linked with interspecific differences in whole-organism heat tolerance. Both omics and behavioral studies suggested that variation in resistance to oxidative stress plays a role in these differences. Functional data are needed to test this hypothesis. Here, we compared three Mytilus congeners to examine whether susceptibility to oxidative stress contributes to acute heat tolerance. We assayed activities of two antioxidant enzymes (catalase, superoxide dismutase), as well as levels of oxidative damage to lipids, DNA, and individual proteins (using gel-based proteomics methods). In addition, we assessed these oxidative stress responses after repeated episodes of heat stress experienced in air or while immersed in seawater, given that survival and competitive outcomes between Mytilus congeners differ in these two contexts. The results are generally inconsistent with patterns that would be expected if oxidative stress contributes to thermal sensitivity. Rather, the more heat-tolerant congeners suffer comparable or even elevated levels of oxidative damage. As predicted, different treatment contexts led to distinct changes in proteome-wide abundance patterns and, to a lesser extent, protein carbonylation profiles. Overall, the results question the relevance of oxidative damage as a mediator of heat tolerance in this genus.
... For Mytilus SI in either fresh or processed products, different molecular markers and techniques have been developed [21][22][23][24]. However, the most common DNA marker used for this purpose targets the polyphenolic adhesive protein gene, highly conserved within, but polymorphic among species [22,[24][25][26][27][28]. Targeting this region, Jilberto et al. [29] developed a high-resolution melting (HRM) assay that allowed them to identify M. chilensis, M. edulis and M. galloprovincialis and their hybrids. ...
DNA-based methods using informative markers such as single nucleotide polymorphism (SNPs) are suitable for reliable species identification (SI) needed to enforce compliance with seafood labelling regulations (EU No.1379/2013). We developed a panel of 10 highly informative SNPs to be genotyped by PCR-High resolution melting (HRM) for SI in the Mytilus genus through in silico and in vitro stages. Its fitness for purpose and concordance were assessed by an internal validation process and by the transference to a second laboratory. The method was applicable to identify M. chilensis, M. edulis, M. galloprovincialis and M. trossulus mussels, fresh, frozen and canned with brine, oil and scallop sauce, but not in preserves containing acetic acid (wine vinegar) and tomato sauce. False-positive and negative rates were zero. Sensitivity, expressed as limit of detection (LOD), ranged between 5 and 8 ng/μL. The method was robust against small variations in DNA quality, annealing time and temperature, primer concentration, reaction volume and HRM kit. Reference materials and 220 samples were tested in an inter-laboratory assay obtaining an “almost perfect agreement” (κ = 0.925, p < 0.001). In conclusion, the method was suitable for the intended use and to be applied in the seafood industry.
... Me-17 (5 ′ -CTGGTGGA-TAATTTGTCTTTGC-3 ′ ). This locus is located at the 5 ′ extremity of exon Glu coding for an adhesive foot protein (Inoue et al., 1995;Rawson et al., 1996). This locus contains an insertion/deletion (indel) zone, whose amplification reveals three alleles: (T, E and G) that, respectively distinguish M. trossulus, M. edulis, and M. galloprovincialis in the Northern Hemisphere (Borsa et al., 1999). ...
The Kerguelen Islands (49°26’S, 69°50’E) represent a unique environment due to their geographical isolation, which protects them from anthropogenic pollution. The ability of the endemic mussel, part of the Mytilus complex, to cope with moderate heat stress was explored using omic tools. Transcripts involved in six major metabolic functions were selected and the qRT-PCR data indicated mainly changes in aerobic and anaerobic energy metabolism and stress response. Proteomic comparisons revealed a typical stress response pattern with cytoskeleton modifications and elements suggesting increased energy metabolism. Results also suggest conservation of protein homeostasis by the long-lasting presence of HSP while a general decrease in transcription is observed. The overall findings are consistent with an adaptive response to moderate stresses in mussels in good physiological condition, i.e. living in a low-impact site, and with the literature concerning this model species. Therefore, local blue mussels could be advantageously integrated into biomonitoring strategies, especially in the context of Global Change.
... Mytilus species(Innoue et al., 1995). Thus, it serves as a highly diagnostic locus used to distinguish between the species M. galloprovincialis, M. edulis and M. trossulus(Innoue et al.,1995;Rawson et al., 1996;Wood et al., 2003; Riginos & Cunningham, 2005;Kijewski et al., 2006;Kijewski et al., 2011). Mussels M. edulis, M. trossulus and M. galloprovincialis can be differentiated based on natural PCR product length variation of 180, 168 and 126 base ...
... Exploiting previously published data and experimentally validated haplotypes, we inspected whether Lola, Pura, and the resequenced mussel genomes displayed genetic signatures consistent with their identification as part of a "pure" M. galloprovincialis lineage, or any evidence of hybridization with congeneric species M. edulis and M. trossulus existed. For this purpose, we recovered in each individual the two alleles for three target nuclear loci Glu-5′ [105,106], mac-1 [107][108][109], and EFbis [110,111], and the sequence of the mitochondrial markers 16S rRNA and COI [60,112,113]. As detailed in Additional file 1: Data Note 7, amplicon size was predicted by in silico PCR, and the nucleotide sequences, aligned with MUSCLE [114] with sequences of known taxonomic origin retrieved from GenBank, were used to build neighbor joining (NJ) phylogenetic trees [115]. ...
Background
The Mediterranean mussel Mytilus galloprovincialis is an ecologically and economically relevant edible marine bivalve, highly invasive and resilient to biotic and abiotic stressors causing recurrent massive mortalities in other bivalves. Although these traits have been recently linked with the maintenance of a high genetic variation within natural populations, the factors underlying the evolutionary success of this species remain unclear.
Results
Here, after the assembly of a 1.28-Gb reference genome and the resequencing of 14 individuals from two independent populations, we reveal a complex pan-genomic architecture in M. galloprovincialis, with a core set of 45,000 genes plus a strikingly high number of dispensable genes (20,000) subject to presence-absence variation, which may be entirely missing in several individuals. We show that dispensable genes are associated with hemizygous genomic regions affected by structural variants, which overall account for nearly 580 Mb of DNA sequence not included in the reference genome assembly. As such, this is the first study to report the widespread occurrence of gene presence-absence variation at a whole-genome scale in the animal kingdom.
Conclusions
Dispensable genes usually belong to young and recently expanded gene families enriched in survival functions, which might be the key to explain the resilience and invasiveness of this species. This unique pan-genome architecture is characterized by dispensable genes in accessory genomic regions that exceed by orders of magnitude those observed in other metazoans, including humans, and closely mirror the open pan-genomes found in prokaryotes and in a few non-metazoan eukaryotes.
... Also, the presence of multiple alleles sometimes hinders interpretation. Another problem with the mono-locus approach is that some markers cannot identify all of the species analyzed here when used alone, and when two or more are used simultaneously, they produce contradictory results 32,35,61 . Moreover, mitochondrial markers (COI and 16S rRNA) must be used simultaneously with a nuclear marker to detect introgression in hybrid zones. ...
Mytilus mussels have been the object of much research given their sentinel role in coastal ecosystems and significant value as an aquaculture resource appreciated for both, its flavour and nutritional content. Some of the most-studied Mytilus species are M. edulis, M. galloprovincialis, M. chilensis and M. trossulus. As species identification based on morphological characteristics of Mytilus specimens is difficult, molecular markers are often used. Single-locus markers can give conflicting results when used independently; not all markers differentiate among all species, and the markers target genomic regions with different evolutionary histories. We evaluated the concordance between the PCR-RFLP markers most commonly-used for species identification in mussels within the Mytilus genus (Me15-16, ITS, mac-1, 16S rRNA and COi) when used alone (mono-locus approach) or together (multi-locus approach). in this study, multi-locus strategy outperformed the mono-locus methods, clearly identifying all four species and also showed similar specimen identification performance than a 49 SNPs panel. We hope that these findings will contribute to a better understanding of DNA marker-based analysis of Mytilus taxa. These results support the use of a multi-locus approach when studying this important marine resource, including research on food quality and safety, sustainable production and conservation.
... trossulus and M. edulis/M. galloprovicialis) has been traditionally reported (McDonald et al., 1991;Rawson et al., 1996). ...
Connectivity between populations shapes the genetic structure of species being crucial for an effective management of environmental resources. Genetic approaches can provide indirect measures of connectivity, allowing the identification of genetically differentiated – unconnected – populations. In this study, we applied a 2b-RAD approach based on hundreds of polymorphic loci to provide the first detailed insight into the population genomics of the Mediterranean mussel Mytilus galloprovincialis in part of its native geographical range. We sampled 19 localities within the Mediterranean and Black Seas, and analyzed a total of 478 samples. We detected strong differences between the two seas, whereas no differences were found between samples from the Western and Central Mediterranean and within Western Mediterranean samples. In the Central Mediterranean a significant differentiation emerged comparing Central Adriatic samples with those from South Adriatic and Ionian Seas. Furthermore, an East-to-West genetic structuring was found in the Central Adriatic Sea, which was not present in the Southern Adriatic and Ionian Seas. These results possibly reflect the local oceanography, with a Middle Adriatic gyre unable to prevent genetic differentiation in this species, and a Southern Adriatic gyre that effectively mixes propagules in Southern areas. In the Black Sea, no signal of genetic structure was found, although samples were spaced at similar distances as in the Adriatic-Ionian area. Genetic connectivity patterns of M. galloprovincialis reveal peculiar species-specific features respect to other species with similar larval duration, suggesting caution in using genetic connectivity data of single species in defining conservation units. We recommend of using genetic connectivity data of many species representing a variety of life history traits, and we call for new investigations using high resolution population genomics, particularly in the Black Sea, to understand if areas separated by hundreds of kilometers can be considered genetically connected as mussels’ data suggest. This information will be critical to ensure “a well-connected system of protected areas” according to Aichi Target 11 of the Convention on Biological Diversity.
... We additionally included samples from Tasmania (n = 5), where high frequencies of the divergent southern mitochondrial haplotypes have been reported (Colgan & Middlefart, 2011). Individuals were genotyped for the species diagnostic marker Glu-5' (Rawson, Joyner, Meetze, & Hilbish, 1996) to obtain a first clue about species identity. Preliminary assignment of Australian samples (total samples = 23; Table 1) as M. planulatus was based on the Ftype (female) mitochondrial marker COIII using primers from Riginos, Hickerson, Henzler, and Cunningham (2004) and phylogenetic analyses using neighbour-joining statistics implemented in Geneious 8.1. ...
Introduced species can impose profound impacts on the evolution of receiving communities with which they interact. If native and introduced taxa remain reproductively semi‐isolated, human‐mediated secondary contact may promote genetic exchange across newly created hybrid zones, potentially impacting native genetic diversity and invasive species spread. Here, we investigate the contributions of recent divergence histories and ongoing (post‐introduction) gene flow between the invasive marine mussel, Mytilus galloprovincialis and a morphologically indistinguishable and taxonomically contentious native Australian taxon, Mytilus planulatus. Using transcriptome‐wide markers, we demonstrate that two contemporary M. galloprovincialis introductions into southeastern Australia originate from genetically divergent lineages from its native range in the Mediterranean Sea and Atlantic Europe, where both introductions have led to repeated instances of admixture between introduced and endemic populations. Through increased genome‐wide resolution of species relationships, combined with demographic modelling, we validate that mussels sampled in Tasmania are representative of the endemic Australian taxon (M. planulatus), but share strong genetic affinities to M. galloprovincialis. Demographic inferences indicate late‐Pleistocene divergence times and historical gene flow between the Tasmanian endemic lineage and northern M. galloprovincialis, suggesting that native and introduced taxa have experienced a period of historical isolation of at least 100,000 years. Our results demonstrate that many genomic loci and sufficient sampling of closely related lineages in both sympatric (e.g., Australian populations) and allopatric (e.g., northern‐hemisphere Mytilus taxa) ranges are necessary to accurately (i) interpret patterns of intraspecific differentiation and to (ii) distinguish contemporary invasive introgression from signatures left by recent divergence histories in high dispersal marine species. More broadly, our study fills a significant gap in systematic knowledge of native Australian biodiversity and sheds light on the intrinsic challenges for invasive species research when native and introduced species boundaries are not well‐defined. This article is protected by copyright. All rights reserved.
... These two species, together with the Baltic mussel (Mytilus trossulus, Gould, 1850), belong to the "Mytilus species complex". Hybridisation between these species has been observed across the world; e.g., in the Pacific Ocean [3][4][5][6], in the Irish Sea [7][8][9] and Scotland where all combinations of species hybrids have been identified [10][11][12][13]. M. trossulus has been often associated with lower meat yield, thinner shell and reduced shelf life compared with M. edulis [10,14] and it is therefore considered undesirable within the European aquaculture context. ...
The development of diagnostic markers has been a long-standing interest of population geneticists as it allows clarification of taxonomic uncertainties. Historically, there has been much debate on the taxonomic status of species belonging to the Mytilus species complex (M. edulis, M. galloprovincialis and M. trossulus), and whether they are discrete species. We analysed reference pure specimens of M. edulis, M. galloprovincialis and M. trossulus, using Restriction site associated DNA (RAD) sequencing and identified over 6,000 SNP markers separating the three species unambiguously. We developed a panel of diagnostic SNP markers for the genotyping of Mytilus species complex as well as the identification of hybrids and interspecies introgression events in Mytilus species. We validated a panel of twelve diagnostic SNP markers which can be used for species genotyping. Being able to accurately identify species and hybrids within the Mytilus species complex is important for the selective mussel stock management, the exclusion of invasive species, basic physiology and bio-diversity studies.
... Accurate labeling and assessment was an important base on conservation of mussel germplasm resources, therefore, a fast and dependable method of mussel variety identification based on gene lever is quite necessary (Rego et al. 2002). DNA molecular marker technique such as restrictionfragment length polymorphism (RFLP) analysis based on adhesive foot protein gene, mitochondrial cytochrome oxidase subunit I (COI) gene and internal transcribed spacer (ITS) (Inoue and Harayama 1995;Health et al. 1995;Joyner 1996;Blair et al. 2006;Fernάndeztajes et al. 2011) have been established for the identification of mussel species and facilitated the studies of mussel classification. Recently, a more efficient method of high resolution melting curve (HRM) has been widely applied to the identification of shellfish species based on the single nucleotide polymorphisms (SNPs) for its advantages of fast, simple operation, high sensitivity and cost-effective Xu et al. 2014;Jin et al. 2015). ...
We described here the successful identification of three economic aquaculture mussel species in China and their hybrids by high resolution melting curve analysis (HRM) of single nucleotide polymorphisms (SNPs). The nuclear 18S ribosomal RNA gene sequences from Mytilus edulis, Mytilus coruscus, and Perna viridis were aligned and amplified. In total, 8 SNP sites were detected from the 79-bp amplicon. A total of 90 samples from the three mussel species were clearly separated, hybrids from M. edulis and M. coruscus could also be clearly identified. The melting profiles from HRM analysis were found to be distinct across the species tested. This new identification method will be a useful tool for discrimination of the three commercially important mussel species and their hybrids.
... Because Glu-5' and candidate allozymes are ancestry-informative in the Northern Hemisphere (i.e. they are strongly differentiated between Northern taxa, Skibinski et al. 1983, Rawson et al. 1996), we might suspect that adaptation in Kerguelen populations may have been enhanced by gene exchange with Northern Hemisphere lineages. A recent study argues that local introgression is widespread in Mytilus mussels, and it is the primary cause of outlying levels of genetic differentiation between conspecific populations ( Fraïsse et al. 2016). ...
Reticulated evolution-i.e. secondary introgression/admixture between sister taxa-is increasingly recognized as a key evolutionary process that may play a role in promoting adaptation. Mytilus spp. is an ideal system to assess its importance, because these marine mussels form semi-isolated species that remain reproductively compatible over large timescales. They have an antitropical distribution, which includes three hybridizing taxa in the Northern Hemisphere (M. edulis, M. galloprovincialis and M. trossulus) and two taxa of uncertain ancestry in the Southern Hemisphere (M. platensis: South America and the Kerguelen Islands; and M. planulatus: Australasia) that originated following transequatorial migrations during the Pleistocene. The Kerguelen mussels are of particular interest to investigate the potential role of admixture in micro-geographic adaptation, as they inhabit a small and isolated island in the Southern Ocean characterized by a highly heterogeneous environment, and genomic reticulation between Northern and Southern lineages have been suspected. Here, we extended a previous analysis by using targeted-sequencing data (1269 contigs; 51,878 SNPs) across the three Northern species and the Kerguelen, coupled with a panel of 33 SNPs genotyped on 695 mussels across 35 sites in the Kerguelen. The panel was enriched with ancestry-informative SNPs, i.e. SNPs that were more differentiated than the genomic average between Northern lineages, to evaluate whether reticulated evolution contributed to micro-geographic adaptation. We first showed that the Kerguelen is a divergent Southern lineage that most probably derived from a proto-edulis population and subsequently experienced admixture with non-indigenous M. galloprovincialis and M. trossulus mussels. We then demonstrated that the Kerguelen mussels were significantly differentiated over small spatial distance and that the genetic structure was associated with environmental variation.
... It has been shown that paternal leakage of mtDNA occurs in interspecies hybrids in fruit fly and in mice (Matsuura et al. 1991;Shitara et al. 1998). In the context of DUI, the disruption of the model, defined as the occurrence of males lacking the M genome and females carrying the M genome has been shown both in laboratory crosses of M. edulis × M. trossulus (Zouros et al. 1994b;Wood et al. 2003) and in naturally hybridizing populations of these species (Rawson et al. 1996) as well as hybridizing populations of M. galloprovincialis and M. trossulus (Brannock et al. 2013). The extreme case of Baltic M. trossulus heavily introgressed with M. edulis alleles is perhaps the best example of atypical DUI, with complete loss of native M. trossulus mtDNA and relatively recent masculinization of F-like mitogenomes of M. edulis origin (Wenne and Skibinski 1995;Kijewski et al. 2006). ...
Doubly uniparental inheritance of mitochondria (DUI) is best known in the blue mussel Mytilus. Under this model, two types of mitochondrial DNA exist: female type (F), transmitted from females to offspring of both genders, and male type (M), transmitted exclusively from males to sons. The mitogenomes are usually highly divergent, but an occasional replacement of a typical M genome by a particular F genome has been postulated to explain reduction of this divergence. Disruption of the DUI model has been reported in hybridization areas. Here, we present a new case of DUI disruption in a hybrid M. trossulus/M. edulis population from the North Sea (Norway). No M haplotypes derived from M. trossulus were identified in this population. Typical M haplotypes derived from M. edulis (ME) were rare. Two F-type haplogroups were found: one derived from M. edulis (FE) and the second derived from M. trossulus (FT). Many haplotypes from the FT group were recombinants, with the male CR sequence coming from the M. trossulus genome (FT1 haplogroup) in contrast to M. edulis CR as in the Baltic. FT1 haplotypes were abundant in the studied population, including homoplasmic females. However, males significantly more often carried these haplotypes; therefore, male heteroplasmy involved the original FE and recombinant FT, indicating that the FT genome undergoes masculinization. Structural similarity of FT1 CR with previously reported, masculinized Baltic haplotypes, which were derived from FE/ME recombination, provides further evidence that CR M–F recombination is a prerequisite for masculinization, also in the context of native M. trossulus mtDNA.
Electronic supplementary material
The online version of this article (doi:10.1007/s00227-017-3235-5) contains supplementary material, which is available to authorized users.
... In these mixed (i.e. genetic inhomogeneous) populations, the use of genetic markers is considered the only certain way for species identification (Rawson et al., 1996;Daguin et al., 2001;Brannock et al., 2009;Fraisse et al., 2016). For example, M. edulis, M. galloprovincialis and their hybrids can be identified using the Glu-5 0 gene and the ME15 and ME16 primer sets that distinguish alleles specific to M. edulis (180 bp), M. galloprovincialis (126 bp) and hybrids (180 bp/126 bp) (Bignell et al., 2008). ...
The blue mussel (Mytilus spp.) is widely used as a bioindicator for monitoring of coastal water pollution (mussel watch programs). Herein we provide a review of this study field with emphasis on: the suitability of Mytilus spp. as environmental sentinels; uptake and bioaccumulation patterns of key pollutant classes; the use of Mytilus spp. in mussel watch programs; recent trends in Norwegian mussel monitoring; environmental quality standards and background concentrations of key contaminants; pollutant effect biomarkers; confounding factors; particulate contaminants (microplastics, engineered nanomaterials); climate change; harmonization of monitoring procedures; and the use of deployed mussels (transplant caging) in pollution monitoring. Lastly, the overall state of the art of blue mussel pollution monitoring is discussed and some important issues for future research and development are highlighted.
... Néanmoins, sur les 10 dernières années, les concentrations mesurées dans les moules du Cap de la Hève sont à la baisse. Elles restent tout de même élevées pour le DDT vis à vis de la médiane nationale (3,4 fois (Blot et al., 1988 (Rawson et al., 1996 ;Inoue et al., 1997 ;Bierne et al., 2003). (Inoue et al., 1995) repose sur un polymorphisme dans la partie nonrépétitive du gène codant pour la protéine d'adhésion du pied. ...
Intertidal organisms live in a fluctuating environment. The blue mussel Mytilus edulis is a key species of those ecosystems and are largely use as sentinel species. Global warming associated with anthropization will expose mussels to contaminations together with increased temperatures. In addition, more frequent heatwaves are expected. In this work, mussels were collected at two sites depicting contrasted levels of contamination and thermal exposure in microcosm were conducted. Two acclimation scenarios were set up prior to exposure to an identical acute thermal stress. In order to decipher joint effects of acclimation and contamination on protein homeostasis, gill proteome comparisons were performed. High mortality was observed only for mussels collected at the contaminated site and acclimated to current temperatures. Concerning gill proteome analysis, organisms from the pristine site exhibit high abundance of thermal stress proteins. Proteoforms involved in anaerobic metabolism were also up-regulated. Interestingly, mussels acclimated to the higher temperatures show an enhanced response compare to the one acclimated to current temperatures. Concerning mussels from the contaminated site, the response appears more confusing, excepted for heat stress protein response. This may indicate deleterious effects of combined contamination and heat stress. Therefore, organisms acclimated to higher temperature display improved responses. In conclusion, mussels with a clean life history show better physiological abilities than individuals with contaminated life history. Moreover, organisms prepared to heat stress by higher acclimation temperatures also develop a more effective response.
... On the other hand, the allele-frequency difference between the hybrid zone and the M. galloprovincialis population makes immigration relatively easy to detect (Gilg & Hilbish, 2003a, b;Gilg et al., 2007). Glu-5 0 was amplified using the protocol described by Rawson et al. (1996), except that primers Me-15 and Me-16 were used, as described by Inoue et al. (1995). The fifth exon of M7 lysin contains a RFLP that can be used to distinguish between G D and G alleles (Riginos, Wang & Abrams, 2006). ...
Loci that encode proteins involved in gamete recognition often show patterns of rapid adaptive evolution and recent studies have shown that different alleles at gamete-recognition loci can be favoured under different sperm concentrations, leading to density-dependent selection during fertilization. While these density-dependent fertilization processes are likely to vary across time and space, it is possible that they are not typically observed at the larger scale of larval recruitment since most larval cohorts likely consist of multiple pools of larvae produced under a variety of sperm concentrations, which tends to homogenize the allele frequencies across time and space. We tested the hypothesis that allele frequency of the gamete-recognition locus M7 lysin in Mytilus galloprovincialis would show significant temporal variation among cohorts of spat and adult age classes. Adult and juvenile mussels and multiple cohorts of newly settled spat were collected from four locations within a predominantly pure population of M. galloprovincialis in southwestern England. Each mussel was then genotyped at the species-specific locus Glu-5′ and the gamete-recognition locus M7 lysin. Allele frequencies at Glu-5′ did not differ among any age classes or cohorts, suggesting that the samples did not contain migrants from adjacent hybrid populations with M. edulis. Similarly, there was little evidence of variation in allele frequencies at M7 lysin among cohorts of spat or among juvenile and adult age classes. The lack of significant temporal variation in allele frequency at M7 lysin suggests that the results of local and small-scale density-dependent selection may not typically be observed during recruitment of marine organisms with pelagic larval stages.
... The isolated DNA was used as template in three nuclear DNA PCR-based markers that are diagnostic for M. edulis and M. trossulus. Application of these markers, Glu-5', ITS, and Mal-I, followed the methods of Rawson et al. (1996), Heath et al. (1995) and Rawson et al. (2001), respectively. All 32 individuals were identified as M. edulis at all three markers. ...
Understanding regional patterns of interannual to decadal-scale climate variability over the past 1000 years is critical for evaluating recently observed trends in atmosphere/ocean conditions, particularly in highly-productive ecosystems such as the Gulf of Maine (GOM) that are sensitive to minor changes in climate and/or changes in slope water input. To develop quantitative relationships between bivalve shell chemistry (d18Oc) and growing conditions, aquaculture-based experiments were developed using Mytilus edulis collected in the GOM and Greenland. These experiments yielded a highly accurate and precise paleothermometer [e.g., T °C = 16.28 (± 0.10) - 4.57 (± 0.15) {d18Oc VPBD – d18Ow VSMOW} + 0.06 (± 0.06) {d18Oc VPBD – d 18Ow VSMOW}2; r2 = 0.99; N= 323; p < 0.0001] for M. edulis, and the techniques were applied to the long-lived bivalve species Arctica islandica. To examine ocean variability in the Western GOM during the last millennium, a 142-year-old living A. islandica and three fossil A. islandica shells (corrected 14CAMS = 1030 ± 78 AD; 1320 ± 45 AD; 1357 ± 40 AD) were collected for d18O and growth increment analysis. The standardized annual growth index (SGI) of the modern shell is significantly correlated with continuous GOM plankton recorder data (1961 – 2003; Calanus finmarchicus; r2 = 0.55; p < 0.0001), and SGIs during the late Holocene contain significant periods of 2-6 years, suggesting that slope water variability coupled with North Atlantic Oscillation (NAO) dynamics is primarily responsible for productivity variability. Mean shell-derived isotopic changes were + 0.47 ‰ from 1000 AD to present, and likely reflect a 2 °C cooling caused by an increase in Labrador Current (LC) transport of ~ 0.7 Sv (1 Sv = 106 m3 s-1) and a corresponding decrease in Gulf Stream influence on GOM water temperatures during the past millennium. This hypothesis is consistent with modern observational relationships among the LC, GOM water temperatures, NAO, and Atlantic Multi-Decadal Oscillation (AMO). These results corroborate recent evidence of a large-scale cooling of slope waters and/or dynamical oceanographic changes outside the GOM during the Holocene, and suggest that a direct link exists between the GOM and Northwestern Atlantic.
... Genome surveys of other molluscs with scarce sequencing depth [22] were not included in these comparisons. We confirmed the identification of the studied mussel as M. galloprovincialis by scanning the assembled sequences with two Mytilus genetic markers, Glu-5' [29] and EFbis [30], using BLASTN [31] and Geneious version 6.1.8 [32]. ...
Mussels belong to the phylum Mollusca, one of the largest and most diverse taxa in the animal kingdom. Despite their importance in aquaculture and in biology in general, genomic resources from mussels are still scarce. To broaden and increase the genomic knowledge in this family, we carried out a whole-genome sequencing study of the cosmopolitan Mediterranean mussel (Mytilus galloprovincialis). We sequenced its genome (32X depth of coverage) on the Illumina platform using three pair-end libraries with different insert sizes. The large number of contigs obtained pointed out a highly complex genome of 1.6 Gb where repeated elements seem to be widespread (~30% of the genome), a feature that is also shared with other marine molluscs. Notwithstanding the limitations of our genome sequencing, we were able to reconstruct two mitochondrial genomes and predict 10,891 putative genes. A comparative analysis with other molluscs revealed a gene enrichment of gene ontology categories related to multixenobiotic resistance, glutamate biosynthetic process, and the maintenance of ciliary structures.
... The protocol for the two RFLP markers, Mal-1 treated with restriction enzyme SpeI and ITS followed by restriction with HhaI, is outlined in Rawson et al. (2001) and Heath et al. (1995), respectively. The applications of Glu-5 and Me 15/16 markers are outlined in Rawson et al. (1996a) and Inoue et al. (1995), respectively (Table 2). For three of the PCR-based markers, products were visualized on 2 % agarose gels, while Me15/16 was analysed using an automated sequencer (ABI 3130 Genetic Analyser; Applied Biosystems, Foster City, CA, USA) due to relatively small differences in allele sizes (Inoue et al., 1995;Kijewski et al., 2009). ...
Melting of the Greenland Ice Sheet (GrIS) is accelerating and will contribute significantly to global sea level rise during the 21st century. Instrumental data on GrIS melting only cover the last few decades, and proxy data extending our knowledge into the past are vital for validating models predicting the influence of ongoing climate change. We investigated a potential meltwater proxy in Godthåbsfjord (West Greenland), where glacier meltwater causes seasonal excursions with lower oxygen isotope water (δ18Ow) values and salinity. The blue mussel (Mytilus edulis) potentially records these variations, because it precipitates its shell calcite in oxygen isotopic equilibrium with ambient seawater. As M. edulis shells are known to occur in raised shorelines and archaeological shell middens from previous Holocene warm periods, this species may be ideal in reconstructing past meltwater dynamics. We investigate its potential as a palaeo-meltwater proxy. First, we confirmed that M. edulis shell calcite oxygen isotope (δ18Oc) values are in equilibrium with ambient water and generally reflect meltwater conditions. Subsequently we investigated if this species recorded the full range of δ18Ow values occurring during the years 2007 to 2010. Results show that δ18Ow values were not recorded at very low salinities (< ~ 19), because the mussels appear to cease growing. This implies that Mytilus edulis δ18Oc values are suitable in reconstructing past meltwater amounts in most cases, but care has to be taken that shells are collected not too close to a glacier, but rather in the mid-region or mouth of the fjord. The focus of future research will expand on the geographical and temporal range of the shell measurements by sampling mussels in other fjords in Greenland along a south–north gradient, and by sampling shells from raised shorelines and archaeological shell middens from prehistoric settlements in Greenland.
... From the early 1990s genetic studies have tended to focus either the hybrid zones between species (9, 10, 11), or the unusual mode of mitochondrial DNA inheritance (Doubly Uniparental Inheritance) discovered in 1994 (12,13). Although some nuclear DNA markers have been developed for species identification (5,14,15) it is only very recently that any microsatellite loci have been isolated for mussels and these have yet to be employed in any extensive population study (16). The main conclusion from population genetic studies using allozymes was that M. edulis was genetically homogeneous throughout its range. ...
... Each column represents all individuals sampled at that time range and site, with percentage composition by genotype indicated by shading. (A) Results from the "1990's" adapted from Braby et al's (2005) synthesis of Sarver and Foltz (1993), Rawson et al (1996Rawson et al ( , 1999 and Suchanek et al (1997), which includes 25-85 individuals per site and 1-3 genetic markers. (B) Results from the "2000's" produced by Braby et al (2005), which include an average of 61 individuals per sample, and 2 genetic markers. ...
... nine bi-locus genotypes are produced in the F 2 , while only four are produced in a backcross). Three length-polymorphic DNA loci were used, Glu-5 0 (Rawson et al. 1996), mac-1 (Ohresser et al. 1997) and EFbis (Bierne et al. 2002a), using the primer sequences and the fluorescent dye 5 0 end-labelled-primer technique described in Bierne et al. (2003c). Overall we screened 1230 single-locus genotypes. ...
We studied the genetic basis of post-zygotic isolation in the marine mussels Mytilus edulis and Mytilus galloprovincialis. Evidence was obtained for a high number of recessive Dobzhansky–Muller substitutions in the genome of these two mussel taxa. We analysed the segregation of unlinked diagnostic markers in the progeny of two backcrosses and an F 2 cross, 36 h and 200 days after fertilization. Directional selection favouring M. galloprovincialis genotypes was observed in both kinds of cross. In the F 2 , epistatic interactions between each pair of chromosome fragments mapped by the markers were identified in addition. Our results imply that homozygous–homozygous interactions are required for breakdown of coadaptation, in accordance with the dominance theory of post-zygotic isolation. Endogenous post-zygotic selection distributed over many loci throughout the genome provides the missing factor explaining the astonishing persistence and strength of barriers to neutral introgression in such a dispersive taxon as Mytilus.
... Transfer permits of Fisheries and Oceans Canada have been obtained for breeders and the studies did not involve endangered or protected species. Species identification was assessed after genomic analysis of the foot DNA with Glu-5′ (polyphenolic adhesion protein) as molecular marker (not shown) (Rawson et al., 1996), and only M. edulis species was present in sampled specimens. A series of three independent cultures constituting biological replicates were each stocked with fertilized eggs produced from gametes derived from 20 males and 20 females at a ratio of 10 sperms/oocyte and were carried out at the Aquicole Station of Pointe-aux-Peres for the University of Quebec at Rimouski (UQAR), Quebec. ...
... The different haplotypes found were submitted to the GenBank (www.ncbi.nlm.nih.gov) and are publicly available under the accession numbers JF912338–JF912374. The nuclear species-specific gene Glu-5′, which encodes for a mussel polyphenolic adhesive protein, was amplified with the primers and protocol described by Rawson et al. (1996). The alleles obtained for M. galloprovincialis and M. edulis differ in size being 200/300 and 380 bp, respectively. ...
The ecological catastrophe produced by the Prestige oil spill (November 2002) caused severe damage in both North Spanish and French coastal communities. Wild mussel populations of Mytilus galloprovincialis in a zone with marginal introgression of Mytilus edulis were affected at all levels, from high DNA damage to increased polycyclic aromatic hydrocarbon content in tissues. In this article, we describe cytological and population genetic changes of wild mussel populations from the northwestern Iberian coast following the catastrophe. The micronucleus test was employed as an indicator of cytological damage, and the Barcoding mitochondrial cytochrome oxidase I (COI) and the nuclear Glu-5′ genes were analyzed for determining the species and assessing population genetic diversity. Immediate increase of micronuclei counts after the oil spill was found, with a further decrease in consecutive months although the counts did not recover pre-Prestige levels. Reduced variation at mitochondrial sequences in the most exposed areas and reduction of M. edulis traces in the regional genetic pool also suggest long-term impact that may result in evolutionary changes. These results highlight the need of adopting more strict measures in order to prevent this type of accidents and avoid long-term effects on wild populations.
... Amplification of all 3 of these markers was performed by PCR as previously described by Brannock et al. (2009); additionally, both ITS and MAL-I PCR products were subjected to a restriction enzyme digest (Brannock et al. 2009). All 3 of these markers completely differentiate between pure populations of Mytilus trossulus and M. galloprovincialis (Heath et al. 1995, Inoue et al. 1995, Rawson et al. 1996a, Rawson et al. 1996b, Rawson et al. 1999. Individuals were scored and genotyped at all 3 nuclear loci separately, and those that successfully amplified at all 3 nuclear markers were assigned to one of 4 genealogical classifications (M. ...
Species within the marine mussel Mytilus edulis complex (M. edulis, M. galloprovincialis, and M. trossulus) have an unusual form of mitochondrial DNA (mtDNA) inheritance commonly referred to as doubly uniparental inheritance (DUI). With DUI, all progeny inherit mtDNA maternally (F), while male progeny also inherit mtDNA paternally (M) through their father's sperm. Therefore, females are normally homoplasmic for the F mtDNA, and males are heteroplasmic for the F and M mtDNA. In this study, we show that the regulation of DUI in populations of blue mussels in northern Japan is severely disrupted; consequently, the majority of individuals (89%) are heteroplasmic for M and F mtDNA. Disruption of DUI is primarily due to the failure of female embryos to exclude the father's M mtDNA from their somatic and germinal tissues. High proportions of heteroplasmic females have only been reported in Japanese mussel populations thus far. We show that this disruption occurs in both parental species (M. trossulus and M. galloprovincialis) as well as hybrids and is independent of geographic location around Hokkaido, Japan. This finding differs from many previous studies, which have shown that disruption in DUI is confined to hybrid zones. In addition, some individuals were heteroplasmic for M or F mtDNA, indicating that DUI disruption is multigenerational. Triplasmic individuals were 3 times more often female and were mostly confined within the hybrid zones; however, a few individuals were found within M. galloprovincialis parental populations.
Introduction. Today, it is relevant to identify and study the genes of adhesive proteins that contribute to the adhesion of marine mussels under water and play an important role in the industry for the commercialization of waterproof adhesives. The purpose of our research is based on bioinformatic analysis, because modeling is currently one of the advanced methods. Aim. The purpose of this work was to compare the nucleotide sequences of representatives of the genus Mytilus, which are flanked by primers Me 15 / Me 16, designed for the non-repetitive region of the mussel adhesive protein gene, as well as bioinformatic analysis of the complete amino acid sequence of the foot adhesive protein Mefp-1 coded by Fp1 gene for M. galloprovincialis. Methods. Nucleotide sequences were analyzed using BLAST (NCBI [https://www.ncbi.nlm.nih.gov]) and aligned by MAFFT [Madeira et al., 2019] methods. The phylogenetic tree was built in the MEGA program [Kumar et al., 2018] using the UPGMA method [Sneath, Sokal, 1973]. The physicochemical parameters of the adhesive protein for the amino acid sequence of M. galloprovincialis were calculated using the ProtParam software tool (ExPASy [https://web.expasy.org/protparam/]). Models of the three-dimensional structure of the M. galloprovincialis adhesive protein were built on the I-TASSER online platform [Yang, Zhang, 2015; Zhang et al., 2017] and with application of the AlphaFold program [https://alphafold.ebi.ac.uk/entry/Q27409]. The main results. The analysis of the nucleotide sequences of six representatives of the genus Mytilus within the «variable region» flanked by primers Me 15 / Me 16 showed the presence of deletions and a number of SNPs. The constructed dendrogram reflected the phylogenetic relationships of mussel species in the genus Mytilus, when comparing the nucleotide sequences of the genes of the adhesive protein of the mussel foot. An analysis of the primary and secondary structure of the adhesive protein of the mussel species M. galloprovincialis characteristic of the Black Sea region was carried out, and models of the three-dimensional structure of the adhesive protein for the specified species were built. Conclusions. The detected mutations in the studied «variable region» of the nucleotide sequences of the adhesive protein genes allow the molecular marker Me 15-16 to distinguish between four types of mussels: M. galloprovincialis, M. chilensis, M. edulis, M. trossulus. The obtained distribution of representatives of the genus Mytilus by means of cluster analysis is consistent with the literature data on the territorial distribution of these species. The molecular weight was calculated and models of the spatial structure of the gene of the foot adhesive protein of the mussel species M. galloprovincialis were constructed.
This datasheet on Mytilus galloprovincialis covers Identity, Overview, Associated Diseases, Pests or Pathogens, Distribution, Dispersal, Biology & Ecology, Environmental Requirements, Natural Enemies, Impacts, Uses, Management, Genetics and Breeding, Economics, Further Information.
This chapter deals with protein and DNA molecular markers and their use in quantifying inter‐ and intraspecific genetic variability in populations; invasive species, quantitative genetics and the various types of breeding schemes used in selective breeding of mussels; and functional genomics: transcriptomics, proteomics and metabolomics. A range of molecular markers have been used to quantify genetic variability: allozymes, mtDNA, random amplified polymorphic DNA (RAPD), restriction fragment‐length polymorphism (RFLP), amplified fragment‐length polymorphism (AFLP), microsatellites and single‐nucleotide polymorphisms (SNPs).
Non‐native species experience novel selection pressures in introduced environments and may interbreed with native lineages. Species introductions therefore provide opportunities to investigate repeated patterns of adaptation and introgression across replicated contact zones. Here, we investigate genetic parallelism between multiple introduced populations of the invasive marine mussel, Mytilus galloprovincialis, in the absence (South Africa and California) and presence of hybridization with a native congener (Mytilus planulatus in Batemans Bay and Sydney Harbour, Australia). Repeatability in post‐introduction differentiation from native‐range populations varied between genetically distinct Atlantic and Mediterranean lineages, with Atlantic‐derived introductions displaying high differentiation (maxFST > 0.4) and parallelism at outlier loci. Identification of long noncoding RNA transcripts (lncRNA) additionally allowed us to clarify that parallel responses are largely limited to protein‐coding loci, with lncRNAs likely evolving under evolutionary constraints. Comparisons of independent hybrid zones revealed differential introgression most strongly in Batemans Bay, with an excess of M. galloprovincialis ancestry and resistance to introgression at loci differentiating parental lineages (M. planulatus and Atlantic M. galloprovincialis). Additionally, contigs putatively introgressed with divergent alleles from a closely related species, Mytilus edulis, showed stronger introgression asymmetries compared with genome‐wide trends and also diverged in parallel in both Atlantic‐derived introductions. These results suggest that divergent demographic histories experienced by introduced lineages, including pre‐introduction introgression, influence contemporary admixture dynamics. Our findings build on previous investigations reporting contributions of historical introgression to intrinsic reproductive architectures shared between marine lineages and illustrate that interspecific introgression history can shape differentiation between colonizing populations and their hybridization with native congeners.
Investigating the history of natural selection among closely related species can elucidate how genomes diverge in response to disparate environmental pressures. Molecular evolutionary approaches can be integrated with knowledge of gene functions to examine how evolutionary divergence may affect ecologically‐relevant traits such as temperature tolerance and species distribution limits. Here, we integrate transcriptome‐wide analyses of molecular evolution with knowledge from physiological studies to develop hypotheses regarding the functional classes of genes under positive selection in one of the world’s most widespread invasive species, the warm‐tolerant marine mussel Mytilus galloprovincialis. Based on existing physiological information, we test the hypothesis that genomic functions previously linked to divergent temperature adaptation at the whole‐organism level show accelerated molecular divergence between warm‐adapted M. galloprovincialis and cold‐adapted congeners. Combined results from codon model tests and analyses of polymorphism and divergence reveal that divergent selection has affected genomic functions previously associated with species‐specific expression responses to heat stress, namely oxidative stress defense and cytoskeletal stabilisation. Examining specific loci implicated in thermal tolerance among Mytilus species (based on interspecific biochemical or expression patterns), we find close functional similarities between known thermotolerance candidate genes under positive selection and positively selected loci under predicted genomic functions (those associated with divergent expression responses). Taken together, our findings suggest a contribution of temperature‐dependent selection in the molecular divergence between warm‐ and cold‐adapted Mytilus species that is largely consistent with results from physiological studies. More broadly, this study provides an example of how independent experimental evidence from ecophysiological investigations can inform evolutionary hypotheses about molecular adaptation in closely related non‐model species.
Intraspecific genetic variation is widely recognized to affect how bivalve larvae respond to variation in environmental conditions, but has been largely ignored in comparisons of larval performance between closely related sibling species. Replicates of five different full-sib families of larval blue mussels (Mytilus edulis and its more northerly congener, M. trossulus) were reared under different temperature (10, 13, and 17 °C) and food conditions in a full factorial design. Growth and survival were strongly affected by temperature, family, the interaction of family and temperature, and the three-way interaction of family, temperature, and food. Family means for days to 20 % survival ranged from 10.2 to 20.0 and did not cluster by species. The two M. trossulus families were intermediate in survival and ranked first and third for growth. The temperature by family interaction effect for survival was very strong, and the two M. trossulus families responded very differently to temperature manipulations. One M. trossulus family exhibited highest survival at 13 °C, while the other M. trossulus family and all three M. edulis families exhibited highest survival at 10 °C. By contrast, greatest growth consistently occurred at 17 °C, indicating that higher mortality in warmer water may be at least partially offset (at a population level) by more rapid growth in body size. The results illustrate the importance of assaying both growth and survival when evaluating environmental effects on larvae and the need to ensure a high level of genetic diversity when pools of larvae are used to study genetically similar species.
PCR amplification of two nuclear DNA fragments (ITS and GLU-5) and subsequent restriction fragment polymorphism (RFLP) were applied to mantle tissue samples from four species of Chilean mussels, Mytilus edulis chilensis, Choromytilus chorus, Aulacomya ater, and Perumytilus purpuratus, and to individual D-shape larvae of Mytilus edulis and M. trossulus from Newfoundland, in order to look for specific banding patterns for each of the Chilean species. Both nuclear DNA-based markers produced species-specific banding patterns and may therefore be able to differentiate larvae from the four Chilean mussels during studies that rely on plankton surveys.
Experiments were performed to determine whether hybrid larvae of Mytilus trossulus (Baltic mussel) and Mytilus galloprovincialis (Mediterranean mussel) could be produced in a shellfish hatchery environment and whether early development, survival, or growth differences existed between the two species and their reciprocal hybrids at full and reduced salinity. Hybrids of these two species are uncommon in Puget Sound, Washington and on the northern west coast of North America. Broodstock were screened morphologically and positively identified at two nuclear DNA loci using polymerase chain reaction and restriction fragment length polymorphism techniques. Hybrid larvae were produced in both reciprocal combinations, and were successfully reared through metamorphosis. There was no apparent hybrid vigor because hybrids did not grow consistently larger (or survive better) than the parental crosses, nor did one reciprocal cross grow consistently larger than the other. Both reciprocal hybrid crosses and the parental cross, M. trossulus, grew faster than the other parental cross, M. galloprovincialis, at low salinity (20 ppt). These results concur with the two species' physiologic and ecological characteristics. Mytilus trossulus grows well in areas of low and variable salinity (much of Puget Sound) and M. galloprovincialis grows well in areas of stable, full salinity, and recruits poorly in Puget Sound. Hybrids showed generally lower fertili/.ution rates and slower early development than parental crosses, although they were sufficient to produce larval cultures and postlarvae. The successful fertilization, growth, and survival of these hybrids suggests that some factor other than genetic incompatibility is likely responsible for the rarity of these hybrids in Puget Sound. One such factor could be the limited overlap of the spawning periods of the two species in this region. A differential species growth-response to salinity was observed in this study.
The ecological and genetic factors determining the extent of introgression between species in secondary contact zones remain poorly understood. Here, we investigate the relative importance of isolating barriersand the demographic expansion of invasive Mytilus galloprovincialison the magnitude and the direction of introgression with the native M. trossulus in a hybrid zone incentral California. We use double-digest restriction-site associated DNA sequencing (ddRADseq) to genotype 1,337 randomly-selected single nucleotide polymorphismsand accurately distinguish early and advanced generation hybrids for the first time in the central California Mytilus spp. hybrid zone. Weaklevels of introgression were observed in both directions but wereslightly more prevalent from the native M. trossulus into the invasive M. galloprovincialis. Few early and advanced backcrossed individuals were observed across the hybrid zone confirming the presence of strong barriers to interbreeding.Heterogeneous patterns of admixture across the zone of contact were consistent with the colonization history of M. galloprovincialis with more extensive introgression in northern localities furthest away from the putative site of introduction in southern California. These observations reinforce the importance of dynamic spatial and demographic expansionsin determining patterns of introgression between close congeners, even in those with high dispersal potential and well-developed reproductive barriers. Our results suggest that the threat posed by invasive M. galloprovincialis is more ecological than genetic as it has, and continues to, displace the native M. trossulus from much of central and southern California. This article is protected by copyright. All rights reserved.
To analyze the genetic diversity and genetic structure of cultured populations of Mytilus galloprovincialis, 44 individuals were sampled from three localities, Yantai, Rushan of Shandong province and Dongji of Zhejiang province. Sequence analysis of ribosomal (18S rRNA gene) and mitochondrial DNA (COIII gene) revealed 23 haplotypes of 18S rRNA and 30 haplotypes of COIII. Haplotype diversities (Hd), nucleotide diversities (Pi) and average nucleotide differences (K) were 0.712 (18S rRNA) and 0.946 (COIII), 0.0044 (18S rRNA) and 0.0207 (COIII), and 0.703 (18S rRNA) and 15.316 (COIII), respectively. Fixation indices (ΦST) of the three cultured populations showed no genetic divergence between Yantai and Rushan populations but significant genetic divergence between Dongji and the other two populations. In the present study, we found no evidence for decline in genetic polymorphism of cultural M. galloprovincialis populations. The findings of the present study will be useful in the management and conservation of M. galloprovincialis resources.
High gene flow, particularly as mediated by larval dispersal, has usually been viewed as sufficient to limit geographic isolation as a major source of population differentiation among marine species. Despite the general observation of relatively little geographic variation among populations of high dispersal marine species many cases of divergence have been observed and natural selection has usually been invoked to explain geographic divergence. Detailed study of several allozyme polymorphisms provided additional evidence that selection may be the predominant force that determines genetic divergence in marine systems. There is, however, growing evidence that marine species with high dispersal are more subdivided than originally thought. The use of multi-locus approaches and the application of molecular techniques have provided new insight into the nature of population divergence in marine species. I argue that (1) many species, which were formerly thought to be unstructured, are in fact subdivided into genetically discrete groups, (2) it is often the case that genetically subdivided populations have distinct evolutionary histories, (3) in many cases, natural selection is the consequence of introgression between these groups, and (4) the combination of molecular assays of both nuclear and mitochondrial DNA and allozyme loci provides the best approach to understanding the evolutionary dynamics of these interacting populations.
We examined the species composition of eleven blue mussel populations in eastern and central Maine, USA using a set of PCR-based genetic markers. Previous reports suggested that mussel populations in the Gulf of Maine were composed of only a single species, Mytilus edulis. In contrast, our results clearly indicate that the range of a congener, M. trossulus, extends well into the Gulf. The two blue mussels are sympatric in eastern Maine populations, including all of those we sampled within Cobscook Bay, ME. The frequency of M. trossulus, however, declines dramatically in the vicinity of Little Machias Bay, ME, so that populations along the coast of central Maine are composed predominantly of M. edulis mussels. Among populations containing a mixture of M. edulis and M. trossulus-specific alleles we observed a low but significant frequency of mussels with hybrid genotypes including putative backcross genotypes, indicating the potential for introgression between these two species. We suggest that larval supply and recruitment, thermal tolerance and perhaps the interplay of these factors likely delimit the southern extent of the range of M. trossulus and influence the species composition of blue mussel populations in the northwest Atlantic.
Biological (predation) and physical (wave action) factors influencing mortality of Mytilus edulis and M. galloprovincialis mussel types within hybrid and pure populations were investigated with the aim of identifying possible selective factors responsible for observed length- and age-dependent genotypic variation. In laboratory tests, shore crabs Carcinus maenas did not significantly prefer any type when choosing between mussels from a hybrid population. When presented with edulis and galloprovincialis from allopatric populations the crabs expressed no significant preference for either mussel type. Neither crab sex nor crab size significantly affected mussel type chosen. Dogwhelks also did not express a significant preference for mussel type when feeding upon mussels of a hybrid population, but did exhibit significant preference for edulis over galloprovincialis from pure populations. Mussel strength of attachment (SOA) to the substrate was tested in 2 hybrid mussel populations, Croyde and Whitsand in SW England. Shell length and genotype, but not population, explained significant variation in SOA. At all lengths, edulis-like mussels had a significantly lower SOA than galloprovincialis-like mussels. Overall, these results suggest that neither predator is likely to be responsible for the higher frequency of galloprovincialis in larger and older mussels of mixed populations. However, the SOA data indicate that this physical factor, which is related to site-specific wave action, is correlated with genotype-dependent mortality. It is concluded that the strong negative correlation between edulis frequency and length (and also age) in many hybrid populations results partly from a slight galloprovincialis growth advantage (measured by in situ growth experiments), but mainly from selective mortality of edulis individuals.
Samples from the high and low shore were taken from mussel populations at two localities. Croyde Bay and Whitsand Bay in southwest England, within the zone of hybridisation of Mytilus edulis and Mytilus galloprovincialis, and analysed at five polymorphic allozyme loci.Strong correlations were observed between shell length and allele frequencies at both localities, with a higher frequency of alleles characterising M. galloprovincialis being found in larger mussels. Three hypotheses were considered as explanation of these results (1) differential mortality, (2) differential growth and (3) historical change within the hybrid zone. The last hypothesis was rejected because the pattern of length dependent allozyme variation was similar in samples taken in 1980–81 and 1986–87. The observation of small growth differences between M. edulis and M. galloprovincialis provided evidence against the second hypothesis. Thus, higher mortality of younger M. edulis was favoured as the cause of the length-dependent variation. Wave exposure and sand abrasion experienced by the mussels were thought to be the most likely selective factors.Strong correlations were also observed in these populations between shell length and allozyme heterozygosity. Analysis of genotype frequencies in small and large size classes of mussels provide evidence of a small added effect of heterozygosity, but no evidence of overdominance.
The occurrence of rare or novel alleles has been documented in at least 23 different hybrid zones spanning vertebrate and invertebrate taxa. As most novel alleles either occur at high frequencies in hybrid populations or are exclusively restricted to hybrids, it has seemed probable that hybridization has a role in their origin; however, the molecular nature of these novel alleles and the mechanisms responsible for their origin remain obscure. We examined the complete coding sequences of six alleles of alcohol dehydrogenase in a mammalian hybrid zone between two species of pocket gophers (Geomys). One of these sequences encodes a novel electromorph that had been identified in earlier allozyme studies; this novel allele differs from one of the parental alleles by a single base substitution. This substitution generates an amino acid replacement that affects the net charge of the translated protein. This resultant charge change is congruent with the observed allozyme mobility patterns. Our data thus provide evidence for simple DNA substitution as a mechanism for the origin of this novel hybrid-zone allele.
Two divergent taxa in the marine mussel genus Mytilus are largely isolated geographically and are routinely exposed to distinctly different thermal environments. We tested the hypothesis that the two taxa are physiologically differentiated with respect to temperature and examined the evolved adaptations allowing one of the taxa to exploit habitats where warm-temperate conditions prevail for prolonged periods. We first analyzed the physiological response to high temperature of mussels collected from a hybrid population containing members of both pure taxa, F, hybrids, and a variety of introgressed genotypes. The experimental temperature of 23°C was chosen to be permissive to the taxon that occurs in warm-temperate regions (Mytilus galloprovincialis) and restrictive to the cold-water taxon (Mytilus edulis). The results show that the two taxa are physiologically differentiated. Under the experimental conditions, M. galloprovincialis exhibited a threefold higher feeding rate and a slightly elevated metabolic rate compared with M. edulis. These differences did not result in a significant difference in net energy balance between the two taxa, probably because of an interaction between physiological response and food availability. However, M. galloprovincialis grew significantly faster in the field, indicating that the physiological differences observed in the laboratory also occur in nature. Numerous introgressed genotypes provided the opportunity to test for cosegregation between the physiological differences and four highly differentiated genetic markers. Two of the markers (esterase and octopine dehydrogenase) cosegregate with variation in feeding rate and shell growth and explained most of the physiological differences observed between taxa. A strong concordance existed between these two loci, suggesting that they may be linked and may mark segregation of the same linkage group. The results suggest that the physiological differentiation between these taxa may be controlled by a few genes (perhaps only one) each with large effect.
Preface. Part I: Background: 1. Introduction. Why Employ Molecular Genetic Markers? Why Not Employ Molecular Genetic Markers? 2. History of Molecular Phylogenetics. Debates and Diversions from Molecular Systematics. Molecular Phylogenetics. 3. Molecular Tools. Protein Assays. DNA Assays. References to Laboratory Protocols. 4. Interpretative Tools. Categorical Subdivisions of Molecular Genetic Data. Molecular Clocks. Procedures for Phylogeny Reconstruction. Gene Trees versus Species Trees. Part II: Applications: 5. Individuality and Parentage. Genetic Identity versus Non-Identity. Parentage. 6. Kinship and Intraspecific Phylogeny. Close Kinship and Family Structure. Geographic Population Structure and Gene Flow. Phylogeography. Microtemporal Phylogeny. 7. Speciation and Hybridization. The Speciation Process. Hybridization and Introgression. 8. Species Phylogenies and Macroevolution. Rationales for Phylogeny Estimation. Special Approaches to Phylogeny Estimation. Prospectus for a Global Phylogeny. Special Topics in Molecular Phylogenetics. 9. Conservation Genetics. Issues of Heterozygosity. Issues of Phylogeny. Literature Cited. Index to Taxonomic Genera. General Index.
PCR (polymerase chain reaction) amplification of non-coding introns in phylogenetically widespread genes, using DNA primers based on the conserved exon sequences, provides a widely applicable strategy for finding DNA polymorphisms in eukaryotic genomes. Polymorphisms in introns provide a new source of potentially neurtral genetic markers for use in population biology. Here we use this approach to design PCR primers for an intron of calmodulin genes. We show that there are at least two calmodulin genes in mussels of theMytilus edulis species complex, and using gene- and species-specific primers we resolve two alleles at a calmodulin intron locus. Population surveys using PcR of adult mussel DNA reveal that genotype frequencies at most sites surveyed in England, Scotland and Italy, conform to Hardy-Weinberg equilibrium, suggesting that this is a novel neutral genetic marker. The data also provide preliminary evidence for restricted gene flow between mussel populations on the west and northeast coasts of Britain, and for local effects around the Thames estuary.
Two divergent taxa in the marine mussel genus Mytilus are largely isolated geographically and are routinely exposed to distinctly different thermal environments. We tested the hypothesis that the two taxa are physiologically differentiated with respect to temperature and examined the evolved adaptations allowing one of the taxa to exploit habitats where warm-temperate conditions prevail for prolonged periods. We first analyzed the physiological response to high temperature of mussels collected from a hybrid population containing members of both pure taxa, F1 hybrids, and a variety of introgressed genotypes. The experimental temperature of 23⚬C was chosen to be permissive to the taxon that occurs in warm-temperate regions (Mytilus galloprovincialis) and restrictive to the cold-water taxon (Mytilus edulis). The results show that the two taxa are physiologically differentiated. Under the experimental conditions, M. galloprovincialis exhibited a three-fold higher feeding rate and a slightly elevated metabolic rate compared with M. edulis. These differences did not result in a significant difference in net energy balance between the two taxa, probably because of an interaction between physiological response and food availability. However, M. galloprovincialis grew significantly faster in the field, indicating that the physiological differences observed in the laboratory also occur in nature. Numerous introgressed genotypes provided the opportunity to test for cosegregation between the physiological differences and four highly differentiated genetic markers. Two of the markers (esterase and octopine dehydrogenase) cosegregate with variation in feeding rate and shell growth and explained most of the physiological differences observed between taxa. A strong concordance existed between these two loci, suggesting that they may be linked and may mark segregation of the same linkage group. The results suggest that the physiological differentiation between these taxa may be controlled by a few genes (perhaps only one) each with large effect.
Many relevant concepts of population genetics and speciation are inherent in primitive molecular evolution and may be useful in explaining divergent evolution from the earliest life forms. When divergent genomes meet they may hybridize and, in many cases, form a hybrid zone. Work on insect hybrid zones is used to exemplify the factors and processes involved. Many such zones are the result of postglacial secondary contact and involve some form of hybrid unfitness. They usually comprise multigenic differences and each gene may have different properties. Two grasshoppers, Podisma pedestris and Chorthippus parallelus, are used as case studies. In the case of P. pedestris, the zone is not environmentally determined but rather the result of heterozygous diadvantage at many loci. In the other species, in which 2 divergent mate recognition systems meet, there is no evidence of their reinforcement toward speciation. A scenario for the postglacial contact and hybridization is proferred in an attempt to explain differences between disjunct sections of the zone. It is argued that gene flow occurs over only very small distances in hybrid zones and that the zones themselves will not move far because they fall in low density traps. Compound hybrid zones may be formed by cycles of range contraction and expansion and the substructure of a species will be determined by its life style. Hybrid zones provide a demonstration that divergence occurs in various characters at different rates and divergence brings with it hybrid disadvantage and frequency dependence. Speciation is seen as some way down this path, but occasional transfers of genetic material may still occur. -from Author
Hybrid zones are narrow regions in which genetically distinct populations meet, mate and produce hybrids; they are often only a few hundred meters wide yet may be several hundred kilometers long. After a clarification of terminology, the authors summarise relevant theory (maintenance of clines, movement of hybrid zones, barriers to gene flow, and modification of hybrid zones). They then describe ways in which this can be used to draw inferences from field data, with consideration of whether dispersal maintains hybrid populations; the strength and model of selection in the balance between dispersal and selection; the nature and implications of primary and secondary contact; the significance of reproductive isolation and introgressions; the increase of rare alleles in hybrid zones; the number and types of genes involved in hybrid zones; and evidence for modification of hybrid zones. The characteristic spatial configuration of most hybrid zones and the wide range of genotypes found within them suggest that the great majority are maintained in a stable balance between dispersal and selection. -P.J.Jarvis
Electrophoretic data at 10 allozyme loci from the offspring of six single pair matings of Mytilus edulis were analysed for linkage. Significant deviations from expected octopine dehydrogenase (Odh)/phosphoglycerate kinase (Pgk) and leucine aminopeptidase (Lap)/esterase D (EsD) di-locus genotype frequencies were evident in two families. In the former case, the recombination frequency was 0.463 suggesting epistasis but in the latter case a recombination frequency of 0.022 indicated almost complete linkage between the Lap and EsD loci. Other loci showing significant linkage were Odh/Lap and Odh/glucose phosphate isomerase (Gpi). Based on these data and other known linked loci in Mytilus a linkage group comprising Lap, EsD, Odh, mannose phosphate isomerase (Mpi) and possibly also Gpi is proposed. It is noted with interest that the closely related taxa M. edulis, M. galloprovincialis and M. trossulus are distinguished by significant allele frequency variations almost exclusively at loci in this linkage group.Keywords: allozymes, epistasis, linkage, Mytilus edulis
Natural hybrid zones involving the West Indian pulmonate land snail Cerion are characterized by the occurrence, in low to moderate frequencies, of allozymes that are unique to interspecific hybrid zones. As such electrophoretically detected genetic anomalies have also been reported in hybrid zones involving mammals, birds, reptiles, amphibians, and insects this appears to be a general phenomenon. These unexpected allozymes are inappropriately called ‘rare alleles’ and the term hybrizyme is introduced. The origins of hybrizymes are discussed in terms of suppressor-mutation systems, transposon-induced hybrid dysgenesis and intragenic recombination, but available evidence will not resolve this issue. Similarly, it is not clear whether the relatively high frequencies of particular hybrizymes are due to selection or genetic drift or some combination of these agents. Finally, the evolutionary significance of hybrizymes and the possible role of hybridization in introducing new genetic variation into populations are discussed.
Many authors have considered the common mussels in temperate waters of the Northern and Southern Hemispheres to be a single cosmopolitan species,Mytilus edulis Linnaeus, 1758. Others have divided these mussels into several subspecies or species. Samples of mussels were collected from 36 locations in the Northern Hemisphere and nine locations in the Southern Hemisphere. Electrophoretic evidence from eight loci indicates that the Northern Hemisphere samples consist of three electrophoretically distinguishable species:M. edulis from eastern North America and western Europe;M. galloprovincialis Lamarck, 1819 from the Mediterranean Sea, western Europe, California, and eastern Asia; andM. trossulus Gould, 1850 from the Baltic Sea, eastern Canada, western North America and the Pacific coast of Siberia. Mussels from Chile, Argentina, the Falkland Islands and the Kerguelen Islands contain alleles characteristic of all three Northern Hemisphere species, but because they are most similar toM. edulis from the Northern Hemisphere, we suggest that they tentatively be included inM. edulis. These South American samples are morphologically intermediate between Northern HemisphereM. edulis andM. trossulus. Mussels from Australia and New Zealand are similar in allele frequency and morphometric characters toM. galloprovincialis from the Northern Hemisphere. FossilMytilus sp. are present in Australia, New Zealand and South America, which suggests that the Southern Hemisphere populations may be native, rather than introduced by humans. Morphometric characters were measured on samples which the allozyme data indicated contained a single species. Canonical variates analysis of the morphometric characters yields functions which distinguish among our samples of the species in the Northern Hemisphere.
We examined the inheritance of theMytilus edulis CaM-1 Intron 3 locus, a non-coding DNA locus with two potentially neutral length-variants. The polymerase chain reaction (PCR) was used to determine theCaM-1 genotype for 799 larvae obtained from 11 laboratory crosses. Larvae were typed singly only 8 to 24 h after fertilization. We find evidence that each allele can be inherited from either sex, that there are no barriers to fertilization between gametes of different genotypes, and that most larvae have genotypes compatible with Mendelian inheritance of the locus. Deviations from expected genotype frequencies were found in some crosses; we suggest that a contributing factor is aneuploidy in early larvae, but a major cause is more likely to be selection at a locus linked toCaM-1, occurring under the artificial laboratory culture conditions. This study demonstrates the feasibility of applying molecular genetic techniques to early larval stages of marine bivalves, and presents a new non-destructive biopsy method for DNA analysis from living adult mussels.
It has been nearly 15 years since the genetics of Mytilus was the subject of a comprehensive review. In this period, our understanding of the nature of genetic variation in this group has been substantially altered. Studies on the extent of individual variation have demonstrated that genotype (i.e., multiple locus heterozygosity) has a significant effect on energy metabolism, producing significant statistical correlations between genotype and measures of both metabolic energy demand and productivity, particularly growth rate. These correlations can be mitigated by a number of factors, including age, reproductive state, the specific genes under study and ecological conditions.Studies of within-population variation have repeatedly noted marked deficiencies of heterozygotes, but no satisfactory explanation for this observation has yet been identified. Deficiencies are locus-specific and multilocus disequilibria have been described, suggesting a combination of larval mixing with additional forces such as selection, aneuploidy or molecular imprinting.Early work suggested substantial genetic differentiation between spatially proximate populations. Populations are now known to be relatively homogeneous, even over vast geographical distances. Genetic differences between proximate populations generally represent taxonomic differentiation among mytiliid species, not population differences.Studies of allozymes, morphology and (to some degree) mitochondrial genotype among world-wide samples have demonstrated the existence and geographic distributions of four species in the genus: Mytilus californianus, M. edulis, M. trossulus and M. galloprovincialis. Data for the three latter species are presented along with the geographic distribution of each.
The byssus is an extraorganismic polymeric structure in marine mussels and generally employed as a holdfast or tethering device. Like man-made plastics, the byssus is robust, tough, devoid of living cells, and disposable. Unlike plastics, however, it is ultimately biodegradable. Structural and mechanical analysis of the byssus reveals an exquisitely complex design at every level from the microcellular solid in the plaques to the fiber gradients in the thread core to the interpenetrating polymer networks of the byssal varnish. Such fine tuning of materials properties deserves closer scrutiny and, perhaps, imitation. In this vein, the formation of byssus can be caricatured as a series of manufacturing processes including injection and extrusion molding, calendering, and sizing. The biological relevance of each of these caricatures is explored in this chapter.
The DOPA-rich polyphenolic protein secreted by the marine mussel Mytilus edulis establishes key chemical linkages in a water-resistant adhesive. Molecular cloning of the gene for this remarkable protein reveals its primary structure as one of the most repetitive proteins identified in the animal kingdom. Expression and purification of polyphenolic proteins from recombinant yeast have provided sufficient material to demonstrate adhesivity of these polypeptides in the laboratory. Adhesive tests reveal a water-resistant bonding capacity of the protein that is dependent on in vitro modification of tyrosine residues to DOPA and the subsequent oxidation to quinone.
A mussel is attached to hard surfaces by its byssus, which consists of a bundle of threads, each with a fibrous collagenous core coated with adhesive proteins. We constructed a cDNA library from RNA isolated from the foot of the mussel Mytilus galloprovincialis sampled in Japan. The library was probed with a nucleotide sequence corresponding to a part of the decapeptide repeat motif in the major adhesive protein of the closely related species M. edulis, and a clone including the whole coding region of the same adhesive protein of M. galloprovincialis was isolated. The sequences of the signal and nonrepetitive regions of the protein of M. galloprovincialis were homologous to those of M. edulis, despite several substitutions and a deletion of 18 amino acids. The repetitive region included a tetradecapeptide sequence and 62 repeats of the same decapeptide motif as in M. edulis, but hexapeptide sequences present in M. edulis were absent in the protein of M. galloprovincialis. In the decapeptide motif, two tyrosine residues, two lysine residues, and one of the two proline residues were highly conserved, but other residues were frequently substituted. In some residues in the decapeptide motif, specific codon usages were observed, suggesting that the nucleotide sequence itself has a function.
The genetics and taxonomy of species in the genus Mytilus Allo-zymes and morphometric characters of three species of Mytilus in the Northern and Southern Hemispheres Natural selection in hybrid mussel populations
- R K Koehn
- —
- J H Mcdonald
- R Seed
- R K And Koehn
KOEHN, R. K. 1991. The genetics and taxonomy of species in the genus Mytilus. Aquaculture, 94, 125—145. McDONALD, J. H., SEED, R. AND KOEHN, R. K. 1991. Allo-zymes and morphometric characters of three species of Mytilus in the Northern and Southern Hemispheres. Mar. BioL, 111, 323—333. SKIBINSKI, D. o. F. 1983. Natural selection in hybrid mussel populations. In: Oxford, G. S. and Rollinson, D. (eds) Protein Polymotphism: Adaptive and Taxonomic Signifi-cance, pp. 283—298. Academic Press, London. SKIBINSKI, D.
Electrophoretic investigation of systematic relationships in the marine mussels Modiolus modiolus L., Mytilus edulis L. and Mytilus galloprovincialis Lmk. (Mytilidae: Mollusca) The formation of mussel byssus: anatomy of a natural manufacturing process
- F Cross
- T F And Ahmad
- M 65—
- J H Waite
F., CROSS, T. F. AND AHMAD, M. 1980. Electrophoretic investigation of systematic relationships in the marine mussels Modiolus modiolus L., Mytilus edulis L. and Mytilus galloprovincialis Lmk. (Mytilidae: Mollusca). Biol. I Linn. Soc., 13, 65—73. WAITE, J. H. 1992. The formation of mussel byssus: anatomy of a natural manufacturing process. In: Case, S. T. (ed.) Structure, Cellular Synthesis and Assembly of Biopolymers. Results and Problems in Cell Differentiation, vol. 19, pp. 55—74. Springer, Berlin.
Biological and physical factors influencing genotype-dependent mortality in hybrid mussel populations Systematics and geographic distribu-tion of Mytilus
- F 235—
- E M Gosling
F. 1991. Biological and physical factors influencing genotype-dependent mortality in hybrid mussel populations. Mar Ecol. Prog. Ser., 71, 235—244. GOSLING, E. M. 1992a. Systematics and geographic distribu-tion of Mytilus. In: Gosling, E. M. (ed.) The Mussel Mytilus: Ecology, Physiology, Genetics and Culture, pp. 1—20. Elsevier, Amsterdam. GOSLING, E. M. 1992b. Genetics of Mytilus. In: Gosling, E. M. (ed.) The Mussel Mytilus: Ecology, Physiology, Genet-ics and Culture, pp. 309—382. Elsevier, Amsterdam.
Genetics of physiological differentiation within the marine mussel genus Mytilus The adhesive protein cDNA of Mytilus galloprovincialis encodes decapeptide repeats but no hexapeptide motif
- Zool
- —
- T J Hilbish
- B L Bayne
- A And Day
- —
- K Inoue
- And
- Odo
Zool., 68, 1701—1715. HILBISH, T. J., BAYNE, B. L. AND DAY, A. 1994. Genetics of physiological differentiation within the marine mussel genus Mytilus. Evolution, 48, 267—286. INOUE, K. AND ODO, s. 1994. The adhesive protein cDNA of Mytilus galloprovincialis encodes decapeptide repeats but no hexapeptide motif. Biol. Bull., 186, 349—355. The Genetical Society of Great Britain, Heredity, 77, 599—607.
Genotype-Specific Selection within a Hybrid Population of the Mussel Genus Mytilus
- R Wilhelm
WILHELM, R. 1993. Genotype-Specific Selection within a
Hybrid Population of the Mussel Genus Mytilus. Masters
thesis, University of South Carolina, Columbia, SC.
Electrophoretic investigation of systematic relationships in the marine mussels Modiolus modiolus L., Mytilus edulis L and Mytilus galloprovincialis Lmk. (Mytilidae: Mollusca)
- D O F Skibinski
- T F Cross
- DOF Skibinski
Analysis of hybrid zones
- N H Barton
- NH Barton
Mosaic hybrid zones and the nature of species boundaries
- R G Harrison
- RG Harrison
Observations on two Mytilid species from a Nova Scotian mussel farm
- K R Freeman
- K L Perry
- T G Dibacco
- D J Scar-Ratt
- KR Freeman