Science topics: Vectorization
Science topic
Vectorization - Science topic
Explore the latest questions and answers in Vectorization, and find Vectorization experts.
Questions related to Vectorization
For the Gibson cloning into pH-ePPE vector (19kb), I use NEB Hifi builder mix with 400ng of vector backbone (18kb) and 10ng of 250bp insert and NEB chemically competent 10beta cells for transformation. I know my Gibson assembly is working as I have confirmed by PCR. I have used 1ul to 10 ul of Gibson product as well as 1ul of 1:3 diluted product, but I am not getting a single colony post transformation.
- The competent cells are functional, verified by transforming the vector pH-ePPE.
- The vector doesn't have any toxic genes like ccdB and I also confirmed that the gibson mix is not toxic to cells by using positive control.
- I also used NEB 5 alpha cells, but no no colonies with that also
Can anybody suggest how to troubleshoot this problem.
I have a insert of 400 bp cloned in vector pbluescript II KS (+) of size 3.0kb at RE sites XbaI and XhoI. But when I try to double digest the plasmid it is not happening. I am sharing picture of result showing the same. Please can anyone provide me the reason and solution for this.
Fig: Lane1: 100 bp plus ladder; lane 2: plasmid double digested; lane 3: plasmid single digested; lane 4: uncut plasmid
Dear all,
I'm using lentiviruses to knock down p53, and have had remarkable success so far with un-concentrated harvested media.
I have noticed that the transduction efficiency declines over the period of a few weeks storage at -80, and I was wondering if anyone has a suggested protocol for cryopreservation of lentiviruses.
I'm considering adding 0.5M sucrose and 0.6mg/ml BSA to the media as per Bandeira et. al.
Also, is there a freezing method which works best? Flash-freezing in liquid nitrogen, or ethanol/dry ice?
Thanks!
Sam
Bandeira V, Peixoto C, Rodrigues AF, Cruz PE, Alves PM, Coroadinha AS, Carrondo MJ. Downstream processing of lentiviral vectors: releasing bottlenecks. Hum Gene Ther Methods. 2012 Aug;23(4):255-63. doi: 10.1089/hgtb.2012.059. Epub 2012 Aug 30. PMID: 22934827.
I am currently making bacmid and consequent baculovirus using pDEST8, pFastBac and 438a vectors and recently switched to DH10EmBacY cells instead of DH10Bac due to the added YFP signal to monitor transfection, etc.
I was wondering if there is any reason for me to not use either of the two competent cells interchangeably to make bacmid DNA?
I am using a three vectors system to package lentivirus in 293T cell lines. I have inserted GFP into my transfection vector. And I transfected all three vectors into 293T cell line with PEI and waited for supernatant collection. I want to know if I can check the transfection effect of PEI by detecting the GFP from 293T? Will the gene on the transfection vector also express during the lentivirus package?
Dear Researchers.
I did phonon calculations and I am interested in plotting phonon displacement vectors, Does anyone have any idea about this plotting?
Is there any online tool available to check, if designed primers are suitable to get overexpression of the histidine-tagged protein, cloned in pET28a vector?
How to confirm the suitability of primers for the same.
Error [65]: Error, extent of vector too large or attribute table error." I uninstalled and reinstalled QGIS 3.26.2 but I still get the error. Any idea what is causing this?
I am using Escherichia coli MC1064 as competent cells to insert an empty vector. I use CD 3-434 Vector(https://www.arabidopsis.org/servlets/TairObject?type=stock&id=313445) . i used kanamycin as antibiotic and then i realized this is for screening in plant . i haven't any map of it. does anyone know what antibiotic should i use?
Hello.
We did golden gate assembly where in part vectors we chose kanamycin resistance gene and in destination vector we chose ampicillin resistance.
Why is that?
I’m trying to reproduce the library transformation efficiencies seen in this 2010 paper:
in which they claim 1.5 x 10^8 cf/ug DNA. My intact circular vector is the same size as their pcr product + linearized vector, but I’m getting 10^5 ish transformants/ug, similar to chemical transformation with the zymo kit.
Has anyone successfully done this? so far we’ve tried different electroporators, voltages, recovery media, etc but nothing seems to be working.
Any other ideas or troubleshooting would be much appreciated, thanks in advance
In the field of solid mechanics, Navier’s partial differential equation of linear elasticity for material in vector form is:
(λ+G)∇(∇⋅f) + G∇2f = 0, where f = (u, v, w)
The corresponding component form can be evaluated by expanding the ∇ operator and organizing it as follows:
For x-component (u):
(λ+2G)*∂2u/∂x2 + G*(∂2u/∂y2 + ∂2u/∂z2) + (λ+G)*(∂2v/(∂x∂y) + ∂2v/(∂x∂z)) = 0
However, I find it difficult to convert from the component form back to its compact vector form using the combination of divergence, gradient, and Laplacian operators, especially when there are coefficients involved.
Does anyone have any experience with this? Any advice would be appreciated.
I have a satellite dataset from GOES-10 and I want to convert the vector magnetic field data into the mean-field aligned coordinate system. Thanks in advance.
Dear professors and colleagues
Situation:
I am currently preparing a recombinant DNA consisting of a 1000bp insert and a 6000bp vector.
- Insert: The 1000bp insert is prepared by amplification using PCR and then double-digested to create sticky ends.
- Vector: The 7500bp vector has been double digested using the same restriction enzymes and then extracted and purified 6000bp part from 0.6% agarose gel.
Trouble:
1- After extraction and purification the final concentration is 12-20ng/ul and the desired concentration to perform successful ligation is 100ng/ul or more. What is your advice to get a high concentration from the gel?
2- After proceeding to ligation using different protocols and companies,
insert to vector ratio is 3:1 using 270ng/ul of insert and 12ng/ul of vector; the end result in gel electrophoreses is way longer than the desired length by approximately 10000bp.
Do you have any suggestions?
I will appreciate your opinion and advice....
Hello everyone; I am new to CRISPR.
Owning to our strategy to screen positive cells, we yearn to involve two selection markers (GFP and puromycin) in the LentiCRISPRv2 vector. However, we figure out that the viral titer is low in this way, and the possible explanation is the large size of the vector. Also, we noticed that there are several non-functional sequences (?) in this vector. The main question is: Is it ok to remove the highlighted sequence (including EM7 promoter, BleoR, SV40polyA signal, lac promoter, and CAP binding site) in the file?
We think this strategy might be practical since the selection strategy in prokaryotic system in based on Ampicillin, and Zeocin (BleoR) should be the a trademarker, which is actually non-functional?
Thanks a lot
This is a survey relating to the famous Lyapunov convexity theorem (about the range of the non-atomic vector measure).
how can we insert a gene into a vector without restriction enzymes to cut the vector we need restriction enzymes.how can we insert the gene of interest without them?
For example, in the case of compactification in R\times S^{3}, what can be said about the vector field on this manifold? Since the flow of the linear tangent to the three-dimensional sphere of the vector field is closed, in this case we can talk about the proper rotation of such a vector field, and the revolutions of the proper rotation can be identified with the phase action of the quantum particle S/h. It is also remarkable that the algebra of tangent vector fields of a three-dimensional sphere is isomorphic to su(2). Moreover, if we consider the random walk of this rotating spherical flow over the manifold R\times S^{3}, we obtain the Schrodinger equation for a free quantum particle.
Hello everyone, I am currently doing transient transfection. I want to transfect the overexpressed plasmid into HCC cells, and this plasmid has 10000+ base pairs. The transfection reagent I used was lipo3000. After transfection, the empty vector group had green fluorescence, but the overexpression group had no green fluorescence, and the plasmid was increased from 2.5 μg to 5 μg, but the result was still ineffective. I wonder what aspects I should consider?
The specific operation is as follows:
the first day of six-hole plate laying plate;
Two hours before transfection, double antibody-free serum-free medium was replaced. Tube A (opti-mem 125 microliter, plasmid 5 microliter, p3000 10 microliter) was left for 5min, tube B (opti-mem 125 microliter, lipo3000 10 microliter) was left for 5min. Tube A was added to tube B and left for 20min. Pour the mixture drop by drop into the 6-well plate;
After 6 hours, the medium was replaced with complete medium.
Thank you in advance!
Is this vector have only two restriction sites e.g., EcoRI and XhoI only?
Thanks
Nature is linear, binary and symmetrical.
We assume that any statistical transition matrix M that satisfies the above conditions would generate the solution of PPDE with Dirichlet boundary conditions simply as,
W(x,y,z,t)= M(N).b
where b is the boundary vector working as the solution-generating agent and N is the number of time steps.
The boundary conditions b are no longer problematic but rather a source of simplified solutions.
Clone the sequence of a protein in two different vectors, one is pET21a+ which gives a His sequence at the C-terminus and the other vector is pET41A+ which gives His at the C-terminus as well as at the N-terminus, but in addition this last vector gives a GST at the N-terminus.
The cloned sequence in both vectors is already verified by PCR and restriction enzyme digestion.
These vectors with the protein sequences were transformed into E.Coli BL21 bacteria (this step is also verified) which were grown to an OD of 0.6 and then induced by IPTG at 20ºC overnight.
After induction I centrifuge the bacteria and mix the pellet with a solubilization buffer to perform a sonication of 6 pulses of 20 seconds (the whole process was performed on ice).
The problem I have is that when I perform the purification either by Ni-NTA resin or Glutathione resin, the protein is not observed in the SDS-PAGE. I am performing the protocol provided by the supplier which I have already performed with other proteins of the same type and which have been purified correctly.
So I really do not know where the problem could be, the protein sequence is correct, the protocol works for other proteins of the same type, however with the protein that I am currently working with I have not been able to purify it.
The protocols and buffers I have used to purify are as follows:
1) https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0011804_HisPurTM_NiNTA_SupfLw_Agarose_UG.pdf
2) https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0011719_Pierce_Glutathione_Agarose_UG.pdf
Can lentivirus vectors be directly transfected without packaging the virus?
Does anyone know of any vector backbones that can co-express two gene of interest from divergent promoters (or a single bidirectional promoter that has comparable activity in both directions)?
Hi All,
Sorry to bother you guys.
If there anyone can provide some advice on lentiviral packaging issue in my experiments?
Recently, I tried to packaging pMRX-IP-GFP-LC3-RFP-LC3DeltaG (Transfer vector) with psPAX2 (Packaging vector) along with pMD2.G (Envelope vector) in 293 T cells, but I cannot get lentiviral particles. I used the ratio of three plasmids of 4 : 3 :1, total plasmids of 1.25ug or 2.5ug on 1 x 10^5 cells/ml/well in 24-well plate, I got great transfection efficiency with Lipofectamine 3000 reagent, but could not see any infection (GFP) when I use lentiviral particles I collected (48 hpt & 72 hpt) to infect my target cells (BeWo). Anyone out there could give some suggestions on the optimization of the transfection to improve packaging efficiency? Your help will be much appreciated.
Best Regards
Baojun Yang
110822
Antibiotic resistance , enzyme production are types of screening method . Both have advantages and disadvantages so , in these two which method is more preferred to insert in vector and provides maximum results . Are there any considerations of these methods while performing gene cloning?
Hi there,
I would like to understand numerical hessian calculation in molecular modelling better.
If I estimate the (semi)numerical hessian, so either using the gradient or only the energies for the displaced molecule, I get the hessian matrix. After mass weighting, diagonalisation, taking the root and some unit conversion, I end up with frequencies. In case of imaginary ones, I have a not fully optimsed structure or transition state.
After implementing all this in own code, I ended up with sometimes having imaginary frequencies for structure being in a geometrical equilibrium.
--
Eigen::SelfAdjointEigenSolver<Geometry> diag;
diag.compute(hessian);
vector = diag.eigenvalues().cwiseSqrt();
--
For smaller molecules, the results fit to the results obtained with another program (some differences due to numerical noise). For larger molecules, there are imaginary frequencies I don't understand.
I found an illustrating whitepaper at
. Why would the force constants be different if the molecule is centered and reorientated, if at all. Is there something else I have overlooked?
The WIP code is located at:
Thanks and best regards,
Conrad
The optimization step proceeds successfully. However, for the frequency calculation, it stops with no clear error message. It always stops by the following:
AX will form 156 AO Fock derivatives at one time.
156 vectors were produced by pass 1.
156 vectors were produced by pass 2.
156 vectors were produced by pass 3.
156 vectors were produced by pass 4.
149 vectors were produced by pass 5.
writwa
I've attached the output file
my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG
reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC
I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol, digest vector run gel and get two band ,the small one is about 2kb,Gel purify the large one at a concentration 39.4ng/ul total 30ul of 5ug vector,260/280=1.92,260/230=1.42,phosphorylate anneal my oligos ,dilute annealed oligos 1:200, ligation reaction as the protocol indicated, transform 5ul of ligation production into 50ul stbl3 cell, grow in 30℃ for 20hours,each plate have about 15 colonies , then pick 8 of them for sanger sequence, none of them are correct,have anybody meet the same situation , which steps maybe wrong? any suggestion for me ,thankyou ! files are my sequence result ,lenticrispr v2 are the same as addgene show
Gene cloning is a process to make an multiple copies of our GOI.so what are consequences that we face in selection of vectors and GOI
I am working on a vector for gene integration but the information on that vector is given in bits and pieces. I want to construct the complete vector. Can anyone suggest me some software where I can put all of the sequences given in pieces and create a circular model for the vector?
I am using a gateway cloning vector to overexpress a gene, but I want a control vector as well (without my insert). I want to cut out the ccdb gene so it wont self destruct but I dont have a vector to insert. compatible cut sites were not immediatley obvious looking at the map and looking at each restriction site is not very efficient. Is there an easy way to do this or another way to make a control vector?
Hello everyone,
I have a recombinant plasmid always getting overlapped peaks when sequencing. The sequencing primer is located on the backbone of the vector, tens of nts ahead the cloning site, and the primer works perfectly for other plasmid using the same vector.
I have tried purifying the plasmid by plate streaking which turned out no help.
What's weired is that the plasmid expresses the correct proteins.
So, I wonder if it is possible that the E.coli contains 2 different sequences that I can't get it purified by plate streaking? However, this is contrary to the plasmid incompatibility theory.
Do you have any suggestions? Thank you!
Hello,
I want to silence my gene of interest using ptdT-RNAi vector, so what I need to know is either if the amplicon must include the 5’UTR region, the ATG or both. I know that the length has to be around 200 bp.
Thanks, I hope an early answer.
Dear researchers,
I have performed a cloning study for a gene 3550 bp but it didn't work. Firstly I gel-extracted the gene after digesting the vector with two restriction enzymes. I have also digested the recipient vector with the same enzymes and gel extracted respected band. I have checked insert and vector purity and band size in agarose gel and they were looking at expected size single bands. I have tried 1:1, 2:1, 3:1 ratios for ligation with NEB T4 DNA Ligase with the manufacturer's instruction. I have transformed the ligation product into E. coli XL10 but there are no colonies. I guess I am stuck in the ligation ratio. Which ratio I must use? Or is there a different ligase option that you newly know about?
Hello,
for my master's thesis, I have been working with phage display. One of my experiments involved electroporating a pUC19 vector containing the M13 full length gene 3, and a helper phage plasmid containing a super short version of this gene into TG1 E.coli cells. The pUC vector has no packaging signal whatsoever, yet when phage particles from this helper phage plasmid were allowed to infect empty TG1 cells, the antibiotic resistance of this pUC vector remained, suggesting that the plasmid, or part of it, is still present in the phage particle. Does anybody know what might have happened?
when I am expressing my cloned gene, i am getting the desired band in clone induced but the vector induced is also having a band on the same position but faint.
Hello Everyone,
I am planing to conduct a Yeast One-Hybrid screen using the Takara Matchmaker Y1H Gold screening kit.
Reading trough the manual I did not really find information on how this strategy would ensure, that the cDNA library clones are translated in frame with the fused Gal4 activation domain. There is only one section elaborating on this problem saying, that yeast can tolerate frame shifts and as I understand still expresses the right protein.
As I remember in the past there used to be vector systems, where you could insert your cDNA clones in different frames (e.g. +1, +2, +3) and therefore one of the three vectors resulted an in-frame protein fusion. (for clarity: in such case you had to prepare 3 libraries one with each vector)
Maybe there is a trick during the SMART cDNA synthesis. I mean that the adaptors which are fused to the cDNA library clones for recombination cloning are ensuring that every third of the cloned transcripts are cloned in a different frame.
I would appreciate if anyone can clarify this question for me.
I need to select an appropriate plasmid to transform several different plant species. Ideally, I would like to use the same vector for all the species to limit variable differences and time. What is the best way to go about finding existing vectors that will work across multiple plant species while also filtering for specific elements I would like to use (e.g. nptII resistance and GFP/GUS markers)?
I would appreciate advice on common mistakes and important aspects to consider while I search, but I am mainly interested in efficient and reliable steps to follow.
Thanks in advance!
What volume of vector and insert should be taken (in microliters) for ligation, if both the insert and vector amount is same in nanograms after gel extraction (say both are 12ng/μl)?
I am starting with 1.15 ug of both vector and insert for double digestion. But after gel elution I am only able to get around 3.7 ng/ul; and 10 ng/ul for vector and insert respectively in 15ul of elution buffer. I am using HiPura Himedia quick gel purification kit. The kit is around 2-3 years old. Is the inefficiency of the kit reason for very low recovery of my plasmid and insert?
I have been working with A. tumefaciens for several months. I have generated different vectors (with Kanamycin resistance as bacterial selection maker) that I would like to test in A. rhizogenes (strain K599). I transformed my cells by electroporation following this strain's suggested settings, but I am not getting any resistant colony. I think that the origin of replication in my vectors that works in tumefaciens might not be compatible with rhizogenes. I am using the pVS1 origin of replication. I have considered testing RK2 or pRIA4 instead. I wonder if someone from the community has worked with K599 and has any suggestions.
Has any got experience packaging MSCV vectors with large cargo? Im in the final stages of plasmid design and so far the size is ~8.8kb.. I'm concerned the virus will fail packaging.
I am looking to amplify a gene from a separate plasmid and insert into a plasmid. the plasmid i will cut with a restriction enzyme that gives sticky ends! Do I need to use T4 polymerase to blunt these ends before the gibson assembly reaction?
Exemple:
# TPCS version: 6
# key positions
key contours 1 at 3
key contours 2 at 1
key contours 3 at 6
key electrical at 6
key vectors at 6
key overlay at 2
key regions at 4
# various properties
log label 0
select 1
# plot flags, special
show mesh off
show edges on
show materials off
show contours on
show light off
show vectors off
show junctions on
show electrodes on
show threed off
draw 1
Previously, I used Frank formula D=b/2sinA to determine. For example, D=a*(z1*z1+z2*z2+z3*z3)/sqrt(z1*z1+z2*z2+z3*z3), where z1-z3 is the crystal orientation along GB normal z. This is successful for [001], but does not work for [011] and [111]. Now I have to use the box size to rigid body translation, please help.
My vector is PET 28a with no insert.
I want digest it with EcoRl and XhoI.
After single and double digestion I get 2 band instead of 1 band.
Gel picture: marker, digestion with xhol, digestion with EcoRl and plasmid uncuted (no insert)
Anyone can help me to solving this problem?
I produce lentivirus but the titer is very low, can anyone guide to me how to increase the titration and my transfer vector is high weight I think the low titer of the virus is due to the high weight of the transfer vector
Stokes’ theorem says we can calculate the flux of curl F across surface S by knowing information only about the values of F along the boundary of S. Conversely, we can calculate the line integral of vector field F along the boundary of surface S by translating to a double integral of the curl of F over S.
Let S be an oriented smooth surface with unit normal vector N. Furthermore, suppose the boundary of S is a simple closed curve C. The orientation of S induces the positive orientation of C if, as you walk in the positive direction around C with your head pointing in the direction of N, the surface is always on your left. With this definition in place, we can state Stokes’ theorem.
source: 6.7 Stokes’ Theorem - Calculus Volume 3 | OpenStax
I have a collection of sentences that is in an incorrect order. The system should output the correct order of the sentences. What would be the appropriate approach to this problem? Is it a good approach to embed each sentence into a vector and classify the sentence using multiclass classification (assuming the length of the collection is fixed)?
Please let me know if there can be other approaches.
My Aim is to make THP-1 cell line GFP+. Which methods are the best to get fused expressable GFP or maybe just GFP. I have three options
1. Used lentivrus but i am not sure about its efficiency in THP-1 and which lentirus plasmid maybe the best option.
2. I should use piggyBac but then again i don't have plamsid for transposes and its very expensive if bought from company.
3. I should directly do the transfection with expressable vectors
Hi, I would like to approach Professors/ researchers from my field i.e. mammalian cell line development and vector optimization/ molecular biology to guide me in my project. I have around 4 years of experience in similar area working with Chinese Hamster Ovarian (CHO) cell line for the production of recombinant antibodies/ biotherapeutics and would appreciate an opportunity to collaborate and learn. Could anyone please suggest me how to request the experts to guide me through?
Dear RG community.
I want to estimate the edge dislocation density of AlN so I need to know magnitude of burgers vector.
0.3112 or 1/3*0.3112
Hi all,
I am looking for an open source software/tool (for Linux) to compute the quadratic equations coming from the Jacobi identity, for a vector space equipped with a bilinear, skew-symmetric bracket.
May I use Octave, Maxima or SageMath for this task?
I'm wanting to express 2 proteins (A,B) into a vector and transform cells with this.
In the distributed construct strategy, each insert is cloned into a different, compatible vectors that can be transformed into a cell. Rather than 2 DNA inserts (AB) in the same vector, and then cloned together in a parallel step, What is the advantage of such a strategy? Won't there be an uneven amount of A and B that has been uptaken by the cell as they are located in different plasmids/vectors?
Refer to the diagram below.
Hello, good evening. I have a question that arose when running an agarose gel for DNA. Some time ago, we transfected CHO cells with a plasmid and wanted to see if it could transcribe with that plasmid, we used that RNA to make some cDNA. Lane 1 indicates the marker, the second indicates the control of the PCR reaction for the plasmid, the third indicates CHO cells without the plasmid, the fourth lane indicates the circular plasmid, the fifth indicates the linearized plasmid, and the sixth indicates the pure vector. So far, so good. The problem is with the Beta-actin controls. When running them in the same order (except for using another cell line as a control), the lane corresponding to the circular plasmid (ninth lane) shows an extra band. At first, I thought it was some kind of primer non-specificity for Beta-actin, but the problem is that they did not amplify the same corresponding band for the same linearized plasmid (tenth lane). It couldn't be contamination in the reaction because negative controls and controls without the plasmid did not amplify. It also couldn't be contamination of the master mix because if so, all the lanes would have amplified. The DNA quantities vary by 1-4 nanograms and have similar degrees of purity. I don't know what could be happening since the same linear plasmid did not amplify, but it did for the circular one for Beta-actin. I have carried out the experiment twice and will do it again, but I have not found the reason why that band could have appeared.
I placed some arrows so you can identify the band that correspond the cdna of the plasmid transcript (red ones) and the unknown band (green one), and yes, they have similar sizes but not the same.
i also add another gel for only the B-actin PCRs of that same cDNA (the third lane correspond to the same double band pattern)
Does anyone have experience with using Amaxa nuclefactor or Neon for electroporating CRISPR plasmids or any other vectors in primery cells?
Hi,
I am trying to order membrane protein synthesysed gene [about 1200 bp long] to do Gibson assembly by myself because it looks like the cost for ready to express clone in using my vector is about 1000$ (Twist, Biobasic, transomic) which is a bit pricy if I need 5 clones. To order clone in their vectors (e.g. PUCvector) for subcloning also seems to be an option. I am also concerned that Twist does not verify gene fragments.
What company do you or your lab routinley use to order gene fragnment synthesys in terms of price and quality?
Thanks in advance for reply.
I want to check how important some variables are when they make a cointegration. But I did not know if we can know what the cointegration vector exactly is. And can we get more information from the vector?
Hi, I have a vector that has AvrII (at 5' end) and XhoI(at 3' end) RE sites at the cloning site for my insert. I wish to know if these two enzymes give rise to overhangs that are complementary or would self-ligate instead of ligating to the insert, thereby producing vector self-ligated colonies.
AvrII: 5'-CCTAGG-3'
XhoI: 5'-CTCGAG-3'
Hi there, I have read that some (but not all) lentiviral transfer plasmids can be used in transient transfections to achieve transgene expression and those that can are primarily third-generation constructs. I would like to know if the pLVX vector is considered a third-generation construct and can be transiently transfected in cells.
In tensor calculations, in a four dimensional space-time, can we make a vector using the diagonal components of a second rank tensor 📷 and say 📷 is a vector ?
Hello who interested with my question,
Firstly, I want to thanks you for spending your time to read this topic!
So I have 3 questions that need some advice in Unscented Kalman Filter about the 3 DoFs Mass-Damping-Stiffness System. Right now, i'm modifying my UKF code in MATLAB for a new project but some problems seem to occur again. Below there are 2 Code files - one was the UKF test and one was an UKF function that I've writen in my graduated thesis and here are the problems I incurred:
1/ The Cholesky Decomposition: I used the chol() function from library of MATLAB. However in my test, from the loop k=3, the covariance matrix was starting to fail in excuting chol() because it was not completely positive definited!
My solution: First, I used a function name "nearestSPD" of Mr. John D'Errico and this function have helped my covariance matrix pass the chol() but the output (state vector) I received was full of 0 from the loop k=3. Second approach was plusing (1e-6)*eye() into the covariance matrix but MATLAB code stopped from the loop 3 and said that matrix wasn't positive definited!
2/ Kalman Gain: since the equation of Kalman Gain has the inverse matrix, some value of Kalman Gain of my code in some loop can't be calculate because the covariance matrix is singularity and it doesn't have the inverse version!
My solution: in MATLAB, I've used pinv() (Moore-Penrose Inverse matrix) instead of the regular inverse inv()
3/ Choosing the workable Initial Covariance Matrix (P): How can we choose the suitable Initial Covariance Matrix for UKF?
My solution: Usually, I always choose the values of P corresponding to the error between the initial state vector and true parameter. For example, true k1 = 10000 N/m and in my initial state, I choose k1 = 8000 N/m -> value error of k1 in P will be chosen equal to 1e6.
If you have any suggestions, please feel free to repsonse! I would love to hear your idea!
My code is free and as long as you seem interested, you can use it freely! However, my code seems to fail due to 3 reasons above!
Thanks you!
Dear colleagues,
I am trying to figure out the principle of manually designing gRNA in order to clone it into plasmid. I know, that I have to add sticky ends to my oligos to make cloning them into the vector possible. My plasmid after cut would have stick ends like this:
5 'G A A A .................... G T T T T A 3'
3' C T T T G T G G .....................A T 5'
So as I understand my oligo should look like this:
5' C A C C XXXXXXXXXXXXX 3'
..............3' XXXXXXXXXXXXX C A A A 5'
But since now I have been using Benchling to simulate cloning gRNA into the vector, and this tool were adding proper overhangs to my oligos by itself. Now I looked closer at it and I saw, that in some cases it adds additional complementary base pair and I can't figure out why. I attach picture, where you can see two sites of BsmBI cut and how two different gRNA were "cloned" by Benchling. I have marked this base bair which I am talking about by red arrows. So my question is, if there is any pattern that I should follow while designing my oligos manually? In my case part that is cut out by BsmBI doesn't encode anything, its just a space to inserting a filler.
I have a vector based on a signal in which I need to calculate the log-likelihood and need to maximize it using maximum likelihood estimation. Is there any way to do this in MATLAB using the in-build function mle().
It is well-know that for a Hermitian matrix the diagonal elements are majorized by the eigenvalues. Let M be a Hermitian matrix with eigenvalues \lambda_1, ..., \lambda_n and x a real eigenvector of M associated with the eigenvalue \lambda_k. Let y be any row vector in real field. It is not difficult to prove that M+xy has eigenvalues \lambda_1,... \lambda_{k-1}, \lambda_k+yx, \lambda_{k+1},... ,\lambda_n.
Simlar to Hermitian matrix, whether the majorization betweeen diagonal lements and eigenvalues of M+xy still holds.
I am trying to clone with a pMAL-C2X vector carrying BamHI and SalI sites. I performed several times the ligation with the PCR insert and found several colonies. But seems all are empty vectors. To avoid confusion about the presence of an undigested plasmid, I made a ligation with digested vector without PCR plasmid and a digested plasmid without ligation then transferred to DH5alpha. Here I got colonies in the first case but no colonies in the latter approach. Apparently, I feel like there might be an occurrence of auto-ligation. is it possible to happen auto-ligation even if they have 2 different sites? Does anyone have experience with pMAL-C2X?
As till now after the matched filter or correlator we get a projection of vector and now with with Maxmimum liklehood AND with MAP criteria how we arrive to decission ?
Hello!
I have performed umbrella sampling to study the covalent bond formation between a ligand and a Cysteine residue. Where Histidine is a proton-donating residue to complete a reaction. I have successfully created PMF and have the correct overlapping windows.
I now want to display the imaginary frequencies and displacement vectors but cannot understand these. Do I need to find the Radius of Gyration or RMSD vs. PMF? Where do I find the imaginary frequencies? and How do I draw the displacement vectors?
Your guidance will be appreciated.
Regards,
I need to insert a 9kb fragment into a 11 kb vector. I planed to use gibson assembly and the enzyme I used was from clonesmarter(Seamless Assembly cloning kit) and Yeasen(Universal One Step Cloning Kit). I seperated my 9kb fragment into three 3k fragments and cut my vector with KpnI-HF. According to snapgene, the primers designed for these three fragments could work well and gave me my 20kb vector. I followed the manual from the company(50 ℃,15 min) and transformed the reaction liquid into Mach1. I got seven transformants and got plasmids. However, the size of all 7 plasmids were wrong(show in the picture and the right lane was my 11 kb vector without cut, and the brightest band of marker was 5k). I don't know what happened, could anyone help me? Thank you very much!
How efficient can in vitro recombination in a gateway cloning system between the vector pDONR221 as the entry vector, with a promoter fragment subcloned of 5kb and the pBGWFS7 (12.4 kb) as the destination vector?
Our aim is to transfer gene from bacterial plasmid(pET22b) into mammalian expression vector pACGFP1-N1, i have decided restriction sites available in pACGFP1-N1 vector MCS but while doing restriction digestion followed by ligation i always got colonies in vector transformants and in vector plus gene transformation we do not got any insertion.
I have tried to ligate my vector+insert in ratios of 1:3 and 1:5, along with keeping a vector only control. Although, I got colonies post transformation the no. of colonies is more or less same in vector+insert and vector only control plates.
since I have got colonies, I believe transformation isn't the problem here. Could someone help me troubleshoot?
I tried with the vector of positive integer [intcon] but it doesn't work . and what do you think if I impose it in the constraint part? It may take a lot of time to run because the probability of running a random positive integer vector from x number of runs is so weak.
Thank you and waiting for your answers .
Hello
I hope you are doing well. I wanted to print the fractures in red in the figure below. But when I try to do it as eps for translucent, it never shows that translucent in illustrator but shows as an opaque solid element.
I added two figures first hst_incl.png which I want as a vector file after saving it as eps and second hst_incl_illustrator.png which I am getting in illustrator. Why it never captures the translucency? Can anyone who has faced the problem please enlighten me? How to save xfem fractures as an eps file for publication etc. I will be very happy and greatful to know.
regards
Bhanu
Can anyone please help me how to do convergence test for K-points, meshcutoff, lattice parameters in SIESTA and also if you are comfortable please share some infput files related to it.
Thanks & Regards
Shanmuk
Hello researchers,
I am currently trying to clone the toxic ccdB gene under tac promoter into a pBAD vector, using classic restriction-ligation method. The ccdB gene was amplified from a Gateway pDONR vector, and tac promoter added by PCR via floating ends. I then transformed JM109 competent cells with my ligation product to obtain the clones, as this strain still contains the F plasmid and the ccdA gene expressing the antitoxin counteracting ccdB.
However, as a negative control, I also transformed a strain from the Keio collection (BW25113). I thought this strain would be sensitive to ccdB toxicity, but I had several colonies on the plate the next day. Here is the genotype of the strain :
F- DE(araD-araB)567 lacZ4787(del)::rrnB-3 LAM- rph-1 DE(rhaD-rhaB)568 hsdR514
The "F-" means the bacteria do not contain the F plasmid (nor the ccdA gene), and should therefore die in case of ccdB expression...
Do you have any idea why this BW25113 strain is growing despite ccdB presence?
Thanks !
Dear colleagues,
I made some mRNA product of 910 bp, from a restriction-enzyme-linearised pUC-derived vector. Standard NEB IVT T7 cleancap synthesis kit protocol was followed (E2080 NEB) as 2x20uL reactions with substitution of UTP to 100% N1-methylpseudouridine. Reactions were incubated at 37'C for 3 hours, held at 4'C in thermocycler overnight. mRNA samples were then topped up with nuclease-free water to 50 uL and 2-uL DNAse1 was added and incubated for 15 minutes at 37C. Standard NEB T2040 50-ug purification protocol was followed and mRNA was eluted into 50 uL of nuclease-free water. Concentrations were checked on Implen. Instead of getting a usual yield of around 2000-3000 ng/uL, I only got ~25 ng/uL which is not typical. None of the protocols were changed. The only thing that was changed is the insert product in the vector. I cannot think of any reason, apart of RNAse contamination, either in reagents or during the procedure. mRNA was synthesised in biosafety hood with RNAse-free items and the workspace and pipettes were decontaminated with RNAseZap and UVed for 20 minutes before worrking with RNA.
Running the sample on Agilent tapestation gave strange result and I am not sure how to interpret it. Instead of 910 bp band, I got ~250 bp bands and it does not look like an RNAse contamination, but there is a lot of strange, low-weight product. Any suggestions?
Thanks,
Kind regards,
Maria
I need pET30a-LIC-GFP vector to continue a study I had started on Epsilon 34 phage receptor binding protein, any help will be greatly appreciated. Thank you for your help in advance.
I need a diagnostic key that describes all the ticks that carry diseases between humans and animals.
This is our first time reprogramming iPSCs. We reprogrammed fibroblasts using episomal vectors. Attached is a picture of reprogrammed fibroblasts at 4x on Day 19 (15 days of N2B27 +FGF and 4 days on E8). The protocol we are following mentions picking ipsc colonies at Day21+ but are these ready to be picked?
I am cloning a mouse gene under a tissue specific promoter. The vector has polyA tail. In this case is a full length cDNA of the gene necessary of just the CDS would suffice. I am working on PCR for full length cDNA for months now unsuccessfully.
In teaching, or as a student in physics, oftentimes a difficulty becomes a motivation for new understanding. In this context, what difficulty do you see in using Lagrangian or Hamiltonian methods in physics, also thinking of avoiding difficulties ahead, for example, in teaching or learning Quantum Mechanics?
As a reference, please read the following. "Consider the system of a mass on the end of a spring. We can analyze this, of course, by using F=ma to write down mx'' = −kx. The solutions to this equation are sinusoidal functions, as we well know. We can, however, figure things out by using another method, which doesn’t explicitly use F=ma. In many (in fact, probably most) physical situations, this new [150 years old] method is far superior to using F=ma. You will soon discover this for yourself when you tackle the problems and exercises for this chapter [see instructions below, or search in Google]. We will present our new [150 years old] method by rst stating its rules (without any justi cation) and showing that they somehow end up magically giving the correct answer. We will then give the method proper justification.", in Chapter 6, The Lagrangian Method, Copyright 2007 by David Morin, Harvard University.
Morin continues, "At this point it seems to be personal preference, and all academic, whether you use the Lagrangian method or the F = ma method. The two methods produce the same equations.However, in problems involving more than one variable, it usually turns out to be much easier to write down T and V , as opposed to writing down all the forces. This is because T and V are nice and simple scalars. The forces, on the other hand, are vectors, and it is easy to get confused if they point in various directions. The Lagrangian method has the advantage that once you’ve written down L ≡ T − V , you don’t have to think anymore."
instructions: search in Google, or please write requesting the link.
I am trying to clone h 533 bp fragment in a 21000bp vector. What should be appropriate ratio of vector to insert to use for successful cloning.
Hello,
I search a signal processing method that can extract a signal of interest form a set of severals raws signals (vectors). We know the repartion of density of the signal of interest for each vectors (ex: vector 1 contain 10% of interest signal, vector 2 contain 12%, etc.).
Any tool like an assisted ICA that can be used for that?
Hello, I have a vector for expressing a protein tagged with EGFP in the c-terminal and I want to remove the eGFP by adding a stop codon, how can I do that?
Thank you
I am currently doing an undergrad dissertation where I am measuring habitat fragmentation in Borneo from oil palm plantations (1973-2014). So far I have made my two landcover maps using Landsat imagery (1973 - MSS and 2014 - 8) which was then classified using an ISODATA algorithm. The result is two raster classified raster images with varying class sizes in both e.g. the amount of pixels for the forest class in 2014 is less than in 2014 due to landcover change.
Essentially to quantify fragmentation I need to measure certain metrics and so far I have been able to work out 'Class size area (ha)' and 'Percentage of landscape (%)'. I still need to work out:
- Number of patches (although I don't think this will work unless it is converted to vector)
- Patch size area (ha) (again I think it needs to be converted to vector)
- Total edge (m) (I know in vector format this would be by measuring the circumference I think?)
- Euclidean nearest neighbour (m) - this measures degree of adjacency of cells
I am by no means an expert so these are the metrics I thought would be most appropriate. If there are others I would like to know! Also just to add I have tried using FRAGSTATS but whenever I go to generate the statistics the software crashes and closes down unexpectedly.
I have also tried to download PatchAnalyst for ArcGIS but again had limited success.... Any help would be greatly appreciated.
Kind regards,
Connor.
Dear all,
What I'm describing here is the weirdest gene cloning I have met. We were planning to insert a gene fragment about 4kb into the pFastBac1 vector for insect cell expression. We used Gibson Assembly method to generate recombinant plasmid and the vector was linearized by BamHI and XhoI digestion. The gene fragment was amplified by PCR with overlapping primers, everything looks normal. Next, we did the assembly followed the standard protocol and then transformed the TOP10 competent cells. There are dozens of clones grown and the negative control (transformed linearized vector alone) just has few clones. We picked ten clones and checked by colony-PCR but no positive signals. Then we just sequence two of them to see what happened. The sequencing results show that the vector is self-ligated, with a very strange pattern. Here is my PCR primer,
F(5'-3'): CCACCATCGGGCGCGGATCCCGGTCCGTTCGAACCAGAAC
R(5'-3'): CTTGGTACCGCATGCCTCGAGCTATTATTATCTATTAAC
and following is the sequencing results:
GGGGGGGCATCGTTTTGTTCGCCCAGGACTCTAGCTATAGTTCTAGTGGTTGGCTACGTATACTCCGGAATATTAATAGATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCATCGGGCGCGGATCCCGGTCCGTTCGAACCCACCATCGGGCGCGGATCCCGTCCGTTCGAACCAGAACCATCGGGCGCGGATCCCGGTCCGTTCGAACCAGAACCACCATCGGGCGCGGATCCCGGTCCGTTCGAACCAGCCACCATCGGGCGCGGATCCCGGTCCGTTCGAGAAGTAATAGTTAATAGATAATAATAGCTCGAGGCAGCGGTACCAAGGTTAATAGATAATAATAGCTCGAGGCATGCGGTACCAAGTTAATAGATAATAATAGCTCGAGGCATGCGGTACCAAGTTAATAGATAATAATAGCTCGAGGCATGCGGTACCAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTGATCACTGCTTGAGCCTAGGAGATCCGAACCAGATAAGTGAAATCTAGTTCCAAACTATTTTGTCATTTTTAATTTTCGTATTAGCTTACGACGCTACACCCAGTTCCCATCTATTTTGTCACTCTTCCCTAAATAATCCTTAAAAACTCCATTTCCACCCCTCCCAGTTCCCAACTATTTTGTCCGCCCACAGCGGGGCATTTTTCTTCCTGTTATGTTTTTAATCAAACATCCTGCCAACTCCATGTGACAAACCGTCATCTTCGCTACTTTTTCCTCTGTCACAGGATGAAAATTTTTCTGTCATCTCTCGTATAATGTTGTATGACTGAATATCACGCTTATTTGCAGCCTGATGGCGATGGACGCCGCCCTGTAGCGGGCGCCATAACCCCGCCGG
You can see the forward and reverse primer sequences appear repeatedly (underlined). We can make sure the linearized vector and PCR primers are correct. And we tried this couple of times but nothing changed. We also tried T4 ligase but can only get the self-ligated vector.
I speculated is it because the gene fragment has complex structure and the host DNA repair system can detect this and remove it? By the way, the GC content of fragment is normal and it has been codon optimized. It took us couple of weeks to shoot this trouble but no progress. Is there anyone has similar experience or any thoughts/suggestions? Thanks!
I was able to transform bacteria sucessfully with small inserts (+-500bp and 1500bp) using infusion technic. However, when it comes to larger inserts (5500bp and 6000bp), it doesnt work. We already follow the troubleshooting guide descript on the protocol, and tried differentes approaches (concentration, proportion, longer incubation).
Our primers were designed following Takara instruction with 15bp of homology and were already checked.
Our linnearized plasmid was diggested by Xho1 and Sal1 and it its 5004bp long. The final concentration of the linnearized plasmid is 195ng/uL. Our insert is 5542bp (larger than the vector) and its final concentration after purification is 27ng/uL. I'm using competent E. coli Stbl3. We use the concentration around 50ng/uL up to 150ng/uL in the infusion solution.
We tried to transform bacteria by using different proportions between the vector and the insert (1:1; 1:2 and 1:3 each). We also incubated the infusion solution for 1 hour at 50ºc (even knowing that the protocol says longer is no better). I already checked the reagents by using the positive control.
We use the heat-shock protocol, by defreezing bacteria for 30 minutes in ice; adding the infusion solution (3uL) on bacteria and leting it incubate for 30 minutes in ice; then we heat shock the bacteria for 45s at 42ºc and quickly put them into the ice again. Final step, we plate it in a petri dish with agar LB and streptomycin and let it incubate for 16-20h.
The thing is that we dont have any colony and when it appears, it doesnt have our interested insert. I dont know what else i can do.
I am trying to convert vector into an image using the code below
clear variables
load(Exe4_2022.mat')
n = length(b);
figure,
imagesc(reshape(b,sqrt(n),sqrt(n))),
colormap(gray),
axis off;
But I am getting this error. Could anybody tells me how to resolve this issue??
Error using reshape
Size arguments must be real integers.
I have attached the "Exe4_2022.mat" file with this post.
Thanks
When I looked up about the above error, certain answers suggested using memory.limit() to expand the memory, but the code is no longer supported in R. How to resolve this vector allocation issue?
Hello dear friends
I am working on gene cloning. One of the stages is pCAMBIA 1304 vector extraction.
The low concentration of vector at the final stage of pCAMBIA 1304 vector extraction, is my main problem.
1- How can I solve the problem to increase the concentration?
2- Could anybody recommend any universal primer for the pCAMBIA 1304 vector?
I appreciate your valuable suggestion.
Regards
Akram
For large-scale matrix Aand vector v, I want to to compute R^{-1]v, where A=QR is the QR factorization of A. The explicit computation of QR and R^{-1} is unaffordable.
Is there any iterative method to approximate R^{-1]v implicitly?
Hi,
I am having troubles cloning a Cas9 gene (around 4300 kb) into a vector, replacing a LacZ cassette. (I use the uloop system.) I use SapI as a restriction enzyme and T4 as a ligase. I cloned several other constructs into the same kind of vector with high efficiency (mainly white colonies, and almost all carry the correct insert when screened).
When I try to insert Cas9 (or also dCas9) I yield the same number of colonies, with again almost all white. However, when I screen the colonies via colony PCR or restriction digest the isolated plasmids of the colonies, no vector carries the insert. I did not sequence these plasmids, but from the restriction digest it suggest, that the plasmid only lost its LacZ cassette and was closed again without any insert (eventhough overhangs are not compatible).
I tried two settings for GGC:
37 C 5min...............37 C 5min
16 C 5min................16 C 5min
(25cycles)................(40cycles)
65 20min-................65 20min
85 10min..................85 10min
4 hold......................4 hold
I tried two different buffer conditions:
-T4 buffer only
-Or 50% T4 buffer, 50% Cutsmart buffer
I started with fresh Cas9 (and dCas9) PCR templates and with several fresh receiver plasmids. Also I used different competent cell batches.
I double checked the overhangs of receiver plasmids and the overhangs created on the Cas9 insert.
I am running out of ideas..
Does anyone know if GGC with single large inserts (4000 kb+) effect GGC efficiency?
Does anyone have a suggestion how I could improve GGC efficiency?
Further troubleshooting suggestions?
I really would appreciate your ideas!
Thanks,
Florian
Hello everyone.
Please help me to understand this agarose gel. I did a plasmid (Pgem vector with an insert with an expected size of about 3kb, from E.coli) extraction with a simple protocol Birnboim e Doly (1979). The first two bands are the different topologies of the plasmid. What I need to know is the last band (very intense) - It's very small and lower than 100bp (maker is 100bp plus). What could it be? Thanks
Hi, I am working with TRBO-G vector with the size of 11.2kb, when i am doing plasmid isolation, it showing single band structure in agarose gel.
can anyone help me to solve the problem with this
Can i confirm that as my plasmid and proceed with my work ?
Hi all,
I want to express differents constructs of Ab such nanobodies or scfv in E. Coli and using pOPIN vectors ( vectors that we are using in our lab). I know there are some complications in express these proteins in the coli citoplasmatic. So I am thinking about the possibility to add a signal peptide to carry to the coli periplasmic. There is a signal peptide called PelB. This is possible ( could run well) or I need another methodology? and what is the sequence (amino and/or DNA) for this PelB signal sequence?
Many Thanks!
David
Hello, Everyone!
I'm trying to construct CRISPR-related plasmids for bacterial genome engineering.
To construct that, a plasmids vector as a starting backbone had been provided by Addgene.
That plasmid's size is about 13 kbp and involves the low-copy pSC101 origin with temperature-sensitive rep101 gene.
The plasmid has been transformed in E.coli DH5a (actually, I have tried that in both DH5a and Top10...) then I performed the alkaline lysis using 150 ml of culture to prepare the vector for cloning. In the final step, I divided my vector sample into two tubes and the EB buffer solution (pH 8.0) was used to suspense the pellet and another DNA sample was suspended by autoclaved DW. After that, the RNaseA solution was added to my samples (final conc.-> 200 ug/ml) then the samples were incubated for overnight at 37°C.
However, as you can see in the below image, there are still lots of small RNA in my plasmid samples even though I purchased the new RNaseA solution from Thermo scientific last week!!
As you can see, the DNA concentration seems to be too low because of low copy origin...I have to concentrate my plasmid vector to continue the downstream work such as vector digestion, ligation, etc... (Or Can I prepare the digested vector using those samples with ignoring small RNA???) but that small RNA makes me dizzy!! Please give me some of your advice!!