Vectorization - Science topic

Hello fellow scientists! I'm currently trying to construct a vector for agrobacterium-mediated transformation into rice. Our construct aims to overexpress two proteins (protein A and protein B), each driven by an ubiquitin promoter and nos terminator. We have succeeded in cloning two vectors with each protein individually, but we want to put them into the same vector for transformation, a vector that will be about 20 kb.

Our problem seems to be that, for some reason - potentially toxicity - protein B will not successfully insert into the full vector and be replicated by E. coli. Indeed, getting protein B into its original vector took many attempts with DH5a colonies growing slowly on the selection plates, then not at all in liquid culture. We have run backbone only controls to verify that our antibiotic isn't bad, or that our LB is off. Furthermore, our first attempt at cloning the full vector with both proteins succeeded, but the protein B actually turned out to be flipped (we are forced to use just one restriction digest site), and non-expressible with its stop codon adjacent to the promoter, which suggests that the assembly strategy works. We also tried using a different strain (DH10-B), but all 20 picked colonies were self-ligation products (we are using more insert than vector to try and account for this). To me, it seems like the best explanation would be that the ubiquitin promoter has leaky expression in E. coli, and that protein B is toxic.

So, my questions for you all are: 1. Are there other possible explanations for the reduced to complete lack of growth of DH5a with the insert vs. backbone only? 2. Do you have any other strategies that we should consider for cloning the fully assembled vector?

Thank you in advance for your help!

I have been trying to insert a 1.2kb fragment in pGEMT vector. I have used taq polymerase for the PCR amplification and did use gel extraction process to purify the PCR product. After ligation and transformation into the vector I got 7 white colonies in blue white screening but none of them has the insert within. Can anybody please tell me what can be the possible reason and how to troubleshoot?

I cut a vector that already contain the promoter using BstBI enzyme. The electrophoresis gel result showed that no different between control and vector+plasmid cut BstBI enzyme. There are more than 1 band found in the gel. Does anyone have any idea why it is this way?

Hi everyone

I have 2 vectors and I want to transform these into one bacteria cell (SHuffle strain).

Do you think co-transformation (Transforming 2 vectors together in one step into the competent cell) has an effect on Protein expression?

Or, that I have to transform the vectors step by step (e.g. transforming vector number 1 after that competent this cell and transform vector number 2).

is really different between these two strategies for Protein expression?

Note: I used co-transformation for these 2 vectors But the Expression rate was so low Compared with when I Expressed one vector Separately.

I tried Gibson Assembly to do cloning recently but all failed.

I used Snapgene to get primers for the amplication of vector and fragment. PCR worked well. Vector is 2.6kb and Fragment is 4.3kb. Notice the fragment (insert) is bigger than the vector.

I used 2X Gibson mix, always 50ng of vector, and tried Vector : Fragment = 3:1 and 1:3, since fragment is bigger than vector. The incubation time I tried 50C 15min, 25min, 60 min. The transformation I tried electrocompentent cells, stabl3 cells, and One shot cells.

I smeared all bacterial onto the selective plate for colony growth.

I could find a few colonies on the plate, but the sequencing results showed they are all original vectors.

Then I further used Dpn I to digest the Gibson reaction products before transformation, and the subsequent sequencing results of the colonies showed that they are the self-circled constructs of vector PCR product.

Anyway, the Gibson assembly did not work. Why? because the fragment is too larger? Do I need to try vector : Fragment=1:1? Do I need to extend the incubation time for Assembly, like 2-3 hours? The overlap of primers is 40 bp.

Thank you so much for your suggestion. I am looking forward to your opinion.

Qinhong Wang

UNC-Chapel Hill

Following the findings in the field of deformable algebra, can deformation of an n-dimensional vector space contribute to changing its initial dimension?

How will this contribute to finding the appropriate deformations for infinite-dimensional algebra on the basis that algebra is a vector space with an additional structure, with the hope that this will lead to new physical systems with an infinite number of symmetries, and thus complementarity in the hope of enhancing one of what the theory of strings aspires to ?

Hi all, I am currently working with a bacterial membrane protein with intentions on solubilizing it through styrene-maleic acid (SMA) copolymers. Previously, I'm able to express this protein to good yield in the pET-21a(+) vector with a C-terminal 6xHis-tag, however, I am not able to purify this protein using IMAC due to unfavorable interactions between the copolymer and nickel resin. Because of this, I wanted to use a metal-free affinity purification technique, such as the twin-strep system. I constructed a new vector in the same pET-21a(+) vector, but with an added N-terminal twin-strep tag, but this construct did not express at all with different media, temperatures, times, etc. I constructed another vector, but this time adding a twin-strep-SUMO N-terminal tag, hoping that the possible disorder from the twin-strep tag would be alleviated with the added SUMO tag, however, I am getting the same issue with the protein not overexpressing. Does anyone have any solutions to this? I am currently growing in 1L TB media, BL21 cell line, 37C growth with 18C overnight induction with IPTG. It is possible that adding the N-term tags disable the protein from being expressed, since without it, the protein is expressed to good yields.

My lab has the NEB Gibson Assembly kit (unfortunately not the Hifi kit) and I have been struggling for months to assemble various different constructs. I'm wondering if anyone has used this kit specifically and if there are any specific things/tricks you do or use?

I have tried to insert 3 fragments (ranging between 500 bp - 2 kb) into a vector backbone, as well as overlap PCRs to insert 1 fragment into the vector. All fragments have between 30-40 bp homology regions. I PCR amplify all of my pieces (including backbone) and gel extract them because we don't have DpnI. I can get the overlap PCR working well, so I thought the primers/homology regions were designed ok. Yet, I can't get a simple 1 insert into 1 vector reaction working - I consistently get zero colonies (occasionally I've gotten an absurdly low number like 2 or 4, but screening them they're false positives).

I've used NEB's positive control to make sure the Gibson mix is working and got many colonies, but unfortunately they don't provide much information on the contents other than it's 2 DNA fragments so I'm not sure how they designed the two fragments to be ligated.

I have typically been adding 50 ng vector and tried both equimolar amounts of insert and 2-3 fold molar excess of insert. Is there a concern that there is too much salt contamination carried over from the gel extraction? I was curious about the positive control NEB provides and nanodrop read quite comparable A260:A230 ratio between that and my fragment mix. I've also tried adding 5% DMSO into the reaction in case secondary structures were preventing efficient assembly, as well as transforming 50 uL of NEB10b with 2uL vs. 10uL of the Gibson reaction. And nothing seems to stick.

Sidenote I tried IVA once and didn't work for me, but if you have any specific recommendations with that I'd also be willing to try troubleshoot that method if I continue to have issues with Gibson.

I have an overnight culture in 2XYT broth-medium, which has been transformed using M13 phages as vector.

I would like to extract the plasmid for gene sequencing. Could someone tell me how long they could be stored at 4°C and if the plasmid would still be fit for sequencing.

Thank you in advance.

I ask a physical interpretation of the relationship between states of a quantum system introduced, in analogy with the causal relationship between events in Minkowski space-time by means of the formula xRy if and only if < x-y/ T( x-y)> > or = 0. Here x, y are vectors of a Hilbert space and T is a Hermitian operator applied in it. In the original relation x,y are Minkowski space-time four- vectors and T is the metric tensor diag ( 1,-1,-1--1). The relation is equivalent to the inequality <T>(x) + <T>(y) > or= 2 Re (<x/ T(y)>) where the first member is the sum of the mean values of the operator T in the states x and y respectively. ( Gennaro Franco, Giuseppe Marino, Possible causal relationship extensions and properties of related causal isomorphisms, Linear and nonlinear analysis, january 2020)

Hi all,

I'm attempting to clone a GC rich insert (500bp) into a vector that is approximately 5kb and also GC rich. After sequential digests (one enzyme works at 37 while the other works at 65 degrees Celsius), a 0.5% agarose gel reveals that the vector was efficiently cut as indicated by a 500bp shift down of the parent insert vector. Oddly, the 500 bp insert is barely visible. When blown out, the gel shows a smear near the 500 bp region. Is there a reason this is occurring? We are struggling to get any colonies to appear for diagnostic digests so any help would be appreciated.

Thank you!

It is very likely that it is none of this?

The question arises, does the answer to the question belong to "Shut up and calculate"?

I tried and cloned the gene in the 3xFLAG-APEX2-NES vector. i am transfecting 1.5ug of each plasmid in HEK293T cells in 12 well plates at 80% confluency then after 48 hrs of transfection I prepared lysate using RIPA+PIC. on probing with flag antibody only empty vector control is expressed not the fused protein. I have confirmed the clone by sequencing also.

Please help me out with the problem of why fusion protein is not expressed.

thank you

I need research papers on creativity in designing ready-made vector graphics or similar

For the Gibson cloning into pH-ePPE vector (19kb), I use NEB Hifi builder mix with 400ng of vector backbone (18kb) and 10ng of 250bp insert and NEB chemically competent 10beta cells for transformation. I know my Gibson assembly is working as I have confirmed by PCR. I have used 1ul to 10 ul of Gibson product as well as 1ul of 1:3 diluted product, but I am not getting a single colony post transformation.

Can anybody suggest how to troubleshoot this problem.

I have a insert of 400 bp cloned in vector pbluescript II KS (+) of size 3.0kb at RE sites XbaI and XhoI. But when I try to double digest the plasmid it is not happening. I am sharing picture of result showing the same. Please can anyone provide me the reason and solution for this.

Fig: Lane1: 100 bp plus ladder; lane 2: plasmid double digested; lane 3: plasmid single digested; lane 4: uncut plasmid

Dear all,

I'm using lentiviruses to knock down p53, and have had remarkable success so far with un-concentrated harvested media.

I have noticed that the transduction efficiency declines over the period of a few weeks storage at -80, and I was wondering if anyone has a suggested protocol for cryopreservation of lentiviruses.

I'm considering adding 0.5M sucrose and 0.6mg/ml BSA to the media as per Bandeira et. al.

Also, is there a freezing method which works best? Flash-freezing in liquid nitrogen, or ethanol/dry ice?

Thanks!

Sam

Bandeira V, Peixoto C, Rodrigues AF, Cruz PE, Alves PM, Coroadinha AS, Carrondo MJ. Downstream processing of lentiviral vectors: releasing bottlenecks. Hum Gene Ther Methods. 2012 Aug;23(4):255-63. doi: 10.1089/hgtb.2012.059. Epub 2012 Aug 30. PMID: 22934827.

I am currently making bacmid and consequent baculovirus using pDEST8, pFastBac and 438a vectors and recently switched to DH10EmBacY cells instead of DH10Bac due to the added YFP signal to monitor transfection, etc.

I was wondering if there is any reason for me to not use either of the two competent cells interchangeably to make bacmid DNA?

I am using a three vectors system to package lentivirus in 293T cell lines. I have inserted GFP into my transfection vector. And I transfected all three vectors into 293T cell line with PEI and waited for supernatant collection. I want to know if I can check the transfection effect of PEI by detecting the GFP from 293T? Will the gene on the transfection vector also express during the lentivirus package?

Dear Researchers.

I did phonon calculations and I am interested in plotting phonon displacement vectors, Does anyone have any idea about this plotting?

Is there any online tool available to check, if designed primers are suitable to get overexpression of the histidine-tagged protein, cloned in pET28a vector?

How to confirm the suitability of primers for the same.

Error [65]: Error, extent of vector too large or attribute table error." I uninstalled and reinstalled QGIS 3.26.2 but I still get the error. Any idea what is causing this?

I am using Escherichia coli MC1064 as competent cells to insert an empty vector. I use CD 3-434 Vector(https://www.arabidopsis.org/servlets/TairObject?type=stock&id=313445) . i used kanamycin as antibiotic and then i realized this is for screening in plant . i haven't any map of it. does anyone know what antibiotic should i use?

Need to add a gfp tag as well.

Hello.

We did golden gate assembly where in part vectors we chose kanamycin resistance gene and in destination vector we chose ampicillin resistance.

Why is that?

I’m trying to reproduce the library transformation efficiencies seen in this 2010 paper:

in which they claim 1.5 x 10^8 cf/ug DNA. My intact circular vector is the same size as their pcr product + linearized vector, but I’m getting 10^5 ish transformants/ug, similar to chemical transformation with the zymo kit.

Has anyone successfully done this? so far we’ve tried different electroporators, voltages, recovery media, etc but nothing seems to be working.

Any other ideas or troubleshooting would be much appreciated, thanks in advance

In the field of solid mechanics, Navier’s partial differential equation of linear elasticity for material in vector form is:

(λ+G)∇(∇⋅f) + G∇²f = 0, where f = (u, v, w)

The corresponding component form can be evaluated by expanding the ∇ operator and organizing it as follows:

For x-component (u):

(λ+2G)*∂²u/∂x² + G*(∂²u/∂y² + ∂²u/∂z²) + (λ+G)*(∂²v/(∂x∂y) + ∂²v/(∂x∂z)) = 0

However, I find it difficult to convert from the component form back to its compact vector form using the combination of divergence, gradient, and Laplacian operators, especially when there are coefficients involved.

Does anyone have any experience with this? Any advice would be appreciated.

I have a satellite dataset from GOES-10 and I want to convert the vector magnetic field data into the mean-field aligned coordinate system. Thanks in advance.

Dear professors and colleagues

Situation:

I am currently preparing a recombinant DNA consisting of a 1000bp insert and a 6000bp vector.

- Insert: The 1000bp insert is prepared by amplification using PCR and then double-digested to create sticky ends.

- Vector: The 7500bp vector has been double digested using the same restriction enzymes and then extracted and purified 6000bp part from 0.6% agarose gel.

Trouble:

1- After extraction and purification the final concentration is 12-20ng/ul and the desired concentration to perform successful ligation is 100ng/ul or more. What is your advice to get a high concentration from the gel?

2- After proceeding to ligation using different protocols and companies,

insert to vector ratio is 3:1 using 270ng/ul of insert and 12ng/ul of vector; the end result in gel electrophoreses is way longer than the desired length by approximately 10000bp.

Do you have any suggestions?

I will appreciate your opinion and advice....

Hello everyone; I am new to CRISPR.

Owning to our strategy to screen positive cells, we yearn to involve two selection markers (GFP and puromycin) in the LentiCRISPRv2 vector. However, we figure out that the viral titer is low in this way, and the possible explanation is the large size of the vector. Also, we noticed that there are several non-functional sequences (?) in this vector. The main question is: Is it ok to remove the highlighted sequence (including EM7 promoter, BleoR, SV40polyA signal, lac promoter, and CAP binding site) in the file?

We think this strategy might be practical since the selection strategy in prokaryotic system in based on Ampicillin, and Zeocin (BleoR) should be the a trademarker, which is actually non-functional?

Thanks a lot

This is a survey relating to the famous Lyapunov convexity theorem (about the range of the non-atomic vector measure).

how can we insert a gene into a vector without restriction enzymes to cut the vector we need restriction enzymes.how can we insert the gene of interest without them?

For example, in the case of compactification in R\times S^{3}, what can be said about the vector field on this manifold? Since the flow of the linear tangent to the three-dimensional sphere of the vector field is closed, in this case we can talk about the proper rotation of such a vector field, and the revolutions of the proper rotation can be identified with the phase action of the quantum particle S/h. It is also remarkable that the algebra of tangent vector fields of a three-dimensional sphere is isomorphic to su(2). Moreover, if we consider the random walk of this rotating spherical flow over the manifold R\times S^{3}, we obtain the Schrodinger equation for a free quantum particle.

Hello everyone, I am currently doing transient transfection. I want to transfect the overexpressed plasmid into HCC cells, and this plasmid has 10000+ base pairs. The transfection reagent I used was lipo3000. After transfection, the empty vector group had green fluorescence, but the overexpression group had no green fluorescence, and the plasmid was increased from 2.5 μg to 5 μg, but the result was still ineffective. I wonder what aspects I should consider?

The specific operation is as follows:

the first day of six-hole plate laying plate;

Two hours before transfection, double antibody-free serum-free medium was replaced. Tube A (opti-mem 125 microliter, plasmid 5 microliter, p3000 10 microliter) was left for 5min, tube B (opti-mem 125 microliter, lipo3000 10 microliter) was left for 5min. Tube A was added to tube B and left for 20min. Pour the mixture drop by drop into the 6-well plate;

After 6 hours, the medium was replaced with complete medium.

Thank you in advance!

Is this vector have only two restriction sites e.g., EcoRI and XhoI only?

Thanks

I am trying to do some harmonic analysis , I have to select the most effective natural modes. I have the modal matrix (natural modes eigen vectors), but I am confused between many techniques. some techniques depend on selection of modes based on orthogonality of modes. while some techniques depend on independency of the modes like (Modal Independence Factor (MIF), Modal Independence Index (MII), and Modal Assurance Criterion (MAC)).

Are there any other techniques ? and which of them consider the most effective and feasible technique ? and if it is possible to include a literature for such method ?

Nature is linear, binary and symmetrical.

We assume that any statistical transition matrix M that satisfies the above conditions would generate the solution of PPDE with Dirichlet boundary conditions simply as,

W(x,y,z,t)= M(N).b

where b is the boundary vector working as the solution-generating agent and N is the number of time steps.

The boundary conditions b are no longer problematic but rather a source of simplified solutions.

Clone the sequence of a protein in two different vectors, one is pET21a+ which gives a His sequence at the C-terminus and the other vector is pET41A+ which gives His at the C-terminus as well as at the N-terminus, but in addition this last vector gives a GST at the N-terminus. The cloned sequence in both vectors is already verified by PCR and restriction enzyme digestion. These vectors with the protein sequences were transformed into E.Coli BL21 bacteria (this step is also verified) which were grown to an OD of 0.6 and then induced by IPTG at 20ºC overnight. After induction I centrifuge the bacteria and mix the pellet with a solubilization buffer to perform a sonication of 6 pulses of 20 seconds (the whole process was performed on ice). The problem I have is that when I perform the purification either by Ni-NTA resin or Glutathione resin, the protein is not observed in the SDS-PAGE. I am performing the protocol provided by the supplier which I have already performed with other proteins of the same type and which have been purified correctly. So I really do not know where the problem could be, the protein sequence is correct, the protocol works for other proteins of the same type, however with the protein that I am currently working with I have not been able to purify it. The protocols and buffers I have used to purify are as follows: 1) https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0011804_HisPurTM_NiNTA_SupfLw_Agarose_UG.pdf 2) https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2FMAN0011719_Pierce_Glutathione_Agarose_UG.pdf

Can lentivirus vectors be directly transfected without packaging the virus？

Does anyone know of any vector backbones that can co-express two gene of interest from divergent promoters (or a single bidirectional promoter that has comparable activity in both directions)?

Hi All,

Sorry to bother you guys.

If there anyone can provide some advice on lentiviral packaging issue in my experiments?

Recently, I tried to packaging pMRX-IP-GFP-LC3-RFP-LC3DeltaG (Transfer vector) with psPAX2 (Packaging vector) along with pMD2.G (Envelope vector) in 293 T cells, but I cannot get lentiviral particles. I used the ratio of three plasmids of 4 : 3 :1, total plasmids of 1.25ug or 2.5ug on 1 x 10^5 cells/ml/well in 24-well plate, I got great transfection efficiency with Lipofectamine 3000 reagent, but could not see any infection (GFP) when I use lentiviral particles I collected (48 hpt & 72 hpt) to infect my target cells (BeWo). Anyone out there could give some suggestions on the optimization of the transfection to improve packaging efficiency? Your help will be much appreciated.

Best Regards

Baojun Yang

110822

Antibiotic resistance , enzyme production are types of screening method . Both have advantages and disadvantages so , in these two which method is more preferred to insert in vector and provides maximum results . Are there any considerations of these methods while performing gene cloning?

Hi there,

I would like to understand numerical hessian calculation in molecular modelling better.

If I estimate the (semi)numerical hessian, so either using the gradient or only the energies for the displaced molecule, I get the hessian matrix. After mass weighting, diagonalisation, taking the root and some unit conversion, I end up with frequencies. In case of imaginary ones, I have a not fully optimsed structure or transition state.

After implementing all this in own code, I ended up with sometimes having imaginary frequencies for structure being in a geometrical equilibrium.

--

--

For smaller molecules, the results fit to the results obtained with another program (some differences due to numerical noise). For larger molecules, there are imaginary frequencies I don't understand.

I found an illustrating whitepaper at

. Why would the force constants be different if the molecule is centered and reorientated, if at all. Is there something else I have overlooked?

The WIP code is located at:

Thanks and best regards,

Conrad

The optimization step proceeds successfully. However, for the frequency calculation, it stops with no clear error message. It always stops by the following:

AX will form 156 AO Fock derivatives at one time.

156 vectors were produced by pass 1.

156 vectors were produced by pass 2.

156 vectors were produced by pass 3.

156 vectors were produced by pass 4.

149 vectors were produced by pass 5.

writwa

I've attached the output file

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG

reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC

I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol, digest vector run gel and get two band ,the small one is about 2kb，Gel purify the large one at a concentration 39.4ng/ul total 30ul of 5ug vector，260/280=1.92，260/230=1.42，phosphorylate anneal my oligos ,dilute annealed oligos 1:200, ligation reaction as the protocol indicated, transform 5ul of ligation production into 50ul stbl3 cell, grow in 30℃ for 20hours,each plate have about 15 colonies , then pick 8 of them for sanger sequence, none of them are correct,have anybody meet the same situation , which steps maybe wrong? any suggestion for me ,thankyou ! files are my sequence result ,lenticrispr v2 are the same as addgene show

Gene cloning is a process to make an multiple copies of our GOI.so what are consequences that we face in selection of vectors and GOI

I am working on a vector for gene integration but the information on that vector is given in bits and pieces. I want to construct the complete vector. Can anyone suggest me some software where I can put all of the sequences given in pieces and create a circular model for the vector?

I am using a gateway cloning vector to overexpress a gene, but I want a control vector as well (without my insert). I want to cut out the ccdb gene so it wont self destruct but I dont have a vector to insert. compatible cut sites were not immediatley obvious looking at the map and looking at each restriction site is not very efficient. Is there an easy way to do this or another way to make a control vector?

Hello everyone,

I have a recombinant plasmid always getting overlapped peaks when sequencing. The sequencing primer is located on the backbone of the vector, tens of nts ahead the cloning site, and the primer works perfectly for other plasmid using the same vector.

I have tried purifying the plasmid by plate streaking which turned out no help.

What's weired is that the plasmid expresses the correct proteins.

So, I wonder if it is possible that the E.coli contains 2 different sequences that I can't get it purified by plate streaking? However, this is contrary to the plasmid incompatibility theory.

Do you have any suggestions? Thank you!

Hello,

I want to silence my gene of interest using ptdT-RNAi vector, so what I need to know is either if the amplicon must include the 5’UTR region, the ATG or both. I know that the length has to be around 200 bp.

Thanks, I hope an early answer.

Dear researchers,

I have performed a cloning study for a gene 3550 bp but it didn't work. Firstly I gel-extracted the gene after digesting the vector with two restriction enzymes. I have also digested the recipient vector with the same enzymes and gel extracted respected band. I have checked insert and vector purity and band size in agarose gel and they were looking at expected size single bands. I have tried 1:1, 2:1, 3:1 ratios for ligation with NEB T4 DNA Ligase with the manufacturer's instruction. I have transformed the ligation product into E. coli XL10 but there are no colonies. I guess I am stuck in the ligation ratio. Which ratio I must use? Or is there a different ligase option that you newly know about?

I generated Hela-KRAB-dCas9 stable cell line, and to validate dCas9 activity, I introduced two sgRNA expressing vectors driven by either hU6 or mU6 promoter. I found that the mU6 promoter driven vector did show any knock down effect, but the hU6 one did. I wonder if mU6 promotor is really inactive in Hela cell, and whether mU6 promoter can be active in some human cell lines. Any one has this information? So many thanks!!!

Hello,

for my master's thesis, I have been working with phage display. One of my experiments involved electroporating a pUC19 vector containing the M13 full length gene 3, and a helper phage plasmid containing a super short version of this gene into TG1 E.coli cells. The pUC vector has no packaging signal whatsoever, yet when phage particles from this helper phage plasmid were allowed to infect empty TG1 cells, the antibiotic resistance of this pUC vector remained, suggesting that the plasmid, or part of it, is still present in the phage particle. Does anybody know what might have happened?

when I am expressing my cloned gene, i am getting the desired band in clone induced but the vector induced is also having a band on the same position but faint.

Hello Everyone,

I am planing to conduct a Yeast One-Hybrid screen using the Takara Matchmaker Y1H Gold screening kit.

Reading trough the manual I did not really find information on how this strategy would ensure, that the cDNA library clones are translated in frame with the fused Gal4 activation domain. There is only one section elaborating on this problem saying, that yeast can tolerate frame shifts and as I understand still expresses the right protein.

As I remember in the past there used to be vector systems, where you could insert your cDNA clones in different frames (e.g. +1, +2, +3) and therefore one of the three vectors resulted an in-frame protein fusion. (for clarity: in such case you had to prepare 3 libraries one with each vector)

Maybe there is a trick during the SMART cDNA synthesis. I mean that the adaptors which are fused to the cDNA library clones for recombination cloning are ensuring that every third of the cloned transcripts are cloned in a different frame.

I would appreciate if anyone can clarify this question for me.

I need to select an appropriate plasmid to transform several different plant species. Ideally, I would like to use the same vector for all the species to limit variable differences and time. What is the best way to go about finding existing vectors that will work across multiple plant species while also filtering for specific elements I would like to use (e.g. nptII resistance and GFP/GUS markers)?

I would appreciate advice on common mistakes and important aspects to consider while I search, but I am mainly interested in efficient and reliable steps to follow.

Thanks in advance!

What volume of vector and insert should be taken (in microliters) for ligation, if both the insert and vector amount is same in nanograms after gel extraction (say both are 12ng/μl)?

I am starting with 1.15 ug of both vector and insert for double digestion. But after gel elution I am only able to get around 3.7 ng/ul; and 10 ng/ul for vector and insert respectively in 15ul of elution buffer. I am using HiPura Himedia quick gel purification kit. The kit is around 2-3 years old. Is the inefficiency of the kit reason for very low recovery of my plasmid and insert?

I have been working with A. tumefaciens for several months. I have generated different vectors (with Kanamycin resistance as bacterial selection maker) that I would like to test in A. rhizogenes (strain K599). I transformed my cells by electroporation following this strain's suggested settings, but I am not getting any resistant colony. I think that the origin of replication in my vectors that works in tumefaciens might not be compatible with rhizogenes. I am using the pVS1 origin of replication. I have considered testing RK2 or pRIA4 instead. I wonder if someone from the community has worked with K599 and has any suggestions.

Has any got experience packaging MSCV vectors with large cargo? Im in the final stages of plasmid design and so far the size is ~8.8kb.. I'm concerned the virus will fail packaging.

I am looking to amplify a gene from a separate plasmid and insert into a plasmid. the plasmid i will cut with a restriction enzyme that gives sticky ends! Do I need to use T4 polymerase to blunt these ends before the gibson assembly reaction?

Exemple:

# TPCS version: 6

# key positions

key contours 1 at 3

key contours 2 at 1

key contours 3 at 6

key electrical at 6

key vectors at 6

key overlay at 2

key regions at 4

# various properties

log label 0

select 1

# plot flags, special

show mesh off

show edges on

show materials off

show contours on

show light off

show vectors off

show junctions on

show electrodes on

show threed off

draw 1

Previously, I used Frank formula D=b/2sinA to determine. For example, D=a*(z1*z1+z2*z2+z3*z3)/sqrt(z1*z1+z2*z2+z3*z3), where z1-z3 is the crystal orientation along GB normal z. This is successful for [001], but does not work for [011] and [111]. Now I have to use the box size to rigid body translation, please help.

My vector is PET 28a with no insert.

I want digest it with EcoRl and XhoI.

After single and double digestion I get 2 band instead of 1 band.

Gel picture: marker, digestion with xhol, digestion with EcoRl and plasmid uncuted (no insert)

Anyone can help me to solving this problem?

I produce lentivirus but the titer is very low, can anyone guide to me how to increase the titration and my transfer vector is high weight I think the low titer of the virus is due to the high weight of the transfer vector

Stokes’ theorem says we can calculate the flux of curl F across surface S by knowing information only about the values of F along the boundary of S. Conversely, we can calculate the line integral of vector field F along the boundary of surface S by translating to a double integral of the curl of F over S.

Let S be an oriented smooth surface with unit normal vector N. Furthermore, suppose the boundary of S is a simple closed curve C. The orientation of S induces the positive orientation of C if, as you walk in the positive direction around C with your head pointing in the direction of N, the surface is always on your left. With this definition in place, we can state Stokes’ theorem.

source: 6.7 Stokes’ Theorem - Calculus Volume 3 | OpenStax

I have a collection of sentences that is in an incorrect order. The system should output the correct order of the sentences. What would be the appropriate approach to this problem? Is it a good approach to embed each sentence into a vector and classify the sentence using multiclass classification (assuming the length of the collection is fixed)?

Please let me know if there can be other approaches.

My Aim is to make THP-1 cell line GFP+. Which methods are the best to get fused expressable GFP or maybe just GFP. I have three options

1. Used lentivrus but i am not sure about its efficiency in THP-1 and which lentirus plasmid maybe the best option.

2. I should use piggyBac but then again i don't have plamsid for transposes and its very expensive if bought from company.

3. I should directly do the transfection with expressable vectors

Hi, I would like to approach Professors/ researchers from my field i.e. mammalian cell line development and vector optimization/ molecular biology to guide me in my project. I have around 4 years of experience in similar area working with Chinese Hamster Ovarian (CHO) cell line for the production of recombinant antibodies/ biotherapeutics and would appreciate an opportunity to collaborate and learn. Could anyone please suggest me how to request the experts to guide me through?

Dear RG community.

I want to estimate the edge dislocation density of AlN so I need to know magnitude of burgers vector.

0.3112 or 1/3*0.3112

Hi all,

I am looking for an open source software/tool (for Linux) to compute the quadratic equations coming from the Jacobi identity, for a vector space equipped with a bilinear, skew-symmetric bracket.

May I use Octave, Maxima or SageMath for this task?

I'm wanting to express 2 proteins (A,B) into a vector and transform cells with this.

In the distributed construct strategy, each insert is cloned into a different, compatible vectors that can be transformed into a cell. Rather than 2 DNA inserts (AB) in the same vector, and then cloned together in a parallel step, What is the advantage of such a strategy? Won't there be an uneven amount of A and B that has been uptaken by the cell as they are located in different plasmids/vectors?

Refer to the diagram below.

Hello, good evening. I have a question that arose when running an agarose gel for DNA. Some time ago, we transfected CHO cells with a plasmid and wanted to see if it could transcribe with that plasmid, we used that RNA to make some cDNA. Lane 1 indicates the marker, the second indicates the control of the PCR reaction for the plasmid, the third indicates CHO cells without the plasmid, the fourth lane indicates the circular plasmid, the fifth indicates the linearized plasmid, and the sixth indicates the pure vector. So far, so good. The problem is with the Beta-actin controls. When running them in the same order (except for using another cell line as a control), the lane corresponding to the circular plasmid (ninth lane) shows an extra band. At first, I thought it was some kind of primer non-specificity for Beta-actin, but the problem is that they did not amplify the same corresponding band for the same linearized plasmid (tenth lane). It couldn't be contamination in the reaction because negative controls and controls without the plasmid did not amplify. It also couldn't be contamination of the master mix because if so, all the lanes would have amplified. The DNA quantities vary by 1-4 nanograms and have similar degrees of purity. I don't know what could be happening since the same linear plasmid did not amplify, but it did for the circular one for Beta-actin. I have carried out the experiment twice and will do it again, but I have not found the reason why that band could have appeared.

I placed some arrows so you can identify the band that correspond the cdna of the plasmid transcript (red ones) and the unknown band (green one), and yes, they have similar sizes but not the same.

i also add another gel for only the B-actin PCRs of that same cDNA (the third lane correspond to the same double band pattern)