No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Disulphide-isomerase-enabled shedding of tumour-associated NKG2D ligands
Abstract
Tumour-associated ligands of the activating NKG2D (natural killer group 2, member D; also called KLRK1) receptor-which are induced by genotoxic or cellular stress-trigger activation of natural killer cells and co-stimulation of effector T cells, and may thus promote resistance to cancer. However, many progressing tumours in humans counter this anti-tumour activity by shedding the soluble major histocompatibility complex class-I-related ligand MICA, which induces internalization and degradation of NKG2D and stimulates population expansions of normally rare NKG2D+CD4+ T cells with negative regulatory functions. Here we show that on the surface of tumour cells, MICA associates with endoplasmic reticulum protein 5 (ERp5; also called PDIA6 or P5), which, similar to protein disulphide isomerase, usually assists in the folding of nascent proteins inside cells. Pharmacological inhibition of thioreductase activity and ERp5 gene silencing revealed that cell-surface ERp5 function is required for MICA shedding. ERp5 and membrane-anchored MICA form transitory mixed disulphide complexes from which soluble MICA is released after proteolytic cleavage near the cell membrane. Reduction of the seemingly inaccessible disulphide bond in the membrane-proximal alpha3 domain of MICA must involve a large conformational change that enables proteolytic cleavage. These results uncover a molecular mechanism whereby domain-specific deconstruction regulates MICA protein shedding, thereby promoting tumour immune evasion, and identify surface ERp5 as a strategic target for therapeutic intervention.
... 17 18 Release of soluble MICA/B cleavage products into the TME chronically engages the NKG2D receptor and promotes NK cell exhaustion. [17][18][19][20] Along these lines, antibody-mediated targeting of MICA/B shedding potentiates NK cellinduced antitumor immunity. 21 Tumor cell production of extracellular vesicles (EVs) expressing NKG2D ligands and immunosuppressive effectors has also been identified as a mechanism associated with NK cell exhaustion, immune evasion and cancer progression. ...
... 39 The related disulfide-isomerase ER protein 5 (ERp5; PDIA6) is necessary for ADAM10/17-mediated MICA/B shedding. 17 Unlike AGR2, there is no known interaction between ERp5 and MUC1-C. The MUC1-C CD CQC motif represents a site for interactions with reactive Cys residues in PDIs. 1 39 Along these lines, we ...
... ERp5 interacts with MICA/B in promoting conformational changes necessary for their proteolytic processing and shedding. 17 Of interest in this regard, we found that GO-203 also attenuates the interactions between ERp5 and MICA/B (figure 5G). These findings and those demonstrating that GO-203 inhibits the MUC1-C/ ERp5 interaction and MICA/B shedding support a mechanism in which MUC1-C contributes to the ERp5mediated conformational change in MICA/B that is necessary for their proteolysis. ...
Background
The MUC1-C protein evolved in mammals to protect barrier tissues from loss of homeostasis; however, MUC1-C promotes oncogenesis in association with chronic inflammation. Aberrant expression of MUC1-C in cancers has been linked to depletion and dysfunction of T cells in the tumor microenvironment. In contrast, there is no known involvement of MUC1-C in the regulation of natural killer (NK) cell function.
Methods
Targeting MUC1-C genetically and pharmacologically in cancer cells was performed to assess effects on intracellular and cell surface expression of the MHC class I chain-related polypeptide A (MICA) and MICB ligands. The MICA/B promoters were analyzed for H3K27 and DNA methylation. Shedding of MICA/B was determined by ELISA. MUC1-C interactions with ERp5 and RAB27A were assessed by coimmunoprecipitation and direct binding studies. Exosomes were isolated for analysis of secretion. Purified NK cells were assayed for killing of cancer cell targets.
Results
Our studies demonstrate that MUC1-C represses expression of the MICA and MICB ligands that activate the NK group 2D receptor. We show that the inflammatory MUC1-C→NF-κB pathway drives enhancer of zeste homolog 2-mediated and DNMT-mediated methylation of the MICA and MICB promoter regions. Targeting MUC1-C genetically and pharmacologically with the GO-203 inhibitor induced intracellular and cell surface MICA/B expression but not MICA/B cleavage. Mechanistically, MUC1-C regulates the ERp5 thiol oxidoreductase that is necessary for MICA/B protease digestion and shedding. In addition, MUC1-C interacts with the RAB27A protein, which is required for exosome formation and secretion. As a result, targeting MUC1-C markedly inhibited secretion of exosomes expressing MICA/B. In concert with these results, we show that targeting MUC1-C promotes NK cell-mediated killing.
Conclusions
These findings uncover pleotropic mechanisms by which MUC1-C confers evasion of cancer cells to NK cell recognition and destruction.
... However, cancer cells escape immunosurveillance among other pathways through proteolytic cleavage of MICA/B molecules from the cell surface. Shedding of MICA/B is mediated by endoplasmic reticulum protein 5 (ERp5) and several A Disintegrin and Metalloproteinases (ADAM) family proteins and matrix metalloproteinases (MMP) family proteins [54][55][56]. ERp5 binds to the conserved motif in the α3-domain of MICA and MICB [54]. This binding process induces a conformational change of MICA/B to allow further proteolytic cleavage. ...
... Shedding of MICA/B is mediated by endoplasmic reticulum protein 5 (ERp5) and several A Disintegrin and Metalloproteinases (ADAM) family proteins and matrix metalloproteinases (MMP) family proteins [54][55][56]. ERp5 binds to the conserved motif in the α3-domain of MICA and MICB [54]. This binding process induces a conformational change of MICA/B to allow further proteolytic cleavage. ...
Acute myeloid leukemia (AML) is a hematological malignancy characterized by clonal expansion of stem and myeloid progenitor cells. Immunotherapy has revolutionized the care for other cancers such as solid tumors and lymphomas, and has the potential to effectively treat AML. There has been substantial progress in the developments of immunotherapeutic approaches for AML over the last several years, including the development of antibodies that further increase the innate immunogenicity of leukemia cells by the inhibition of NKG2D ligand—particularly MICA and MICB—shedding, chimeric proteins such as IL-15 superagonist that expand natural killer (NK) cells, blockers of immunologic checkpoints such as NKG2A, and chemicals that indirectly increase expression of immune stimulatory proteins in leukemia stem cells. Furthermore, cellular therapies have been designed to enable alloreactive immunity by allogeneic NK cells or target leukemia antigens such as mutated NPM1. These immunotherapeutic approaches have demonstrated remarkable efficacies in preclinical studies and have successfully transitioned to early phase clinical trials, to establish safety and initial signal of clinical activity. Here, we briefly discuss some of the most recent and impactful developments in the AML immunotherapy field and provide our perspectives for the future directions of this exciting and new therapeutic opportunity.
... NKG2D is an activating receptor that triggers cytotoxicity (Billadeau et al., 2003) and cytokine secretion of NK cells (Andre et al., 2004), rendering NKG2Dmediated pathways important for the elimination of malignant cells . However, a phenomenon called 'MICA shedding' results in the reduction of NKG2D receptor in both, CD8 + tumourinfiltrating T cells and peripheral blood T cells, thereby impairing rather than activating anti-tumour responses (Groh et al., 2002;Kaiser et al., 2007). Herein, MICA proteins are proteolytically cleaved into sMICA upon interaction with the surface of tumour cells. ...
... Herein, MICA proteins are proteolytically cleaved into sMICA upon interaction with the surface of tumour cells. The resulting sMICA:NKG2D complexes are subsequently internalized (due to a missing second signal) and degraded, while immunosuppressive T cells are consequently stimulated (Doubrovina et al., 2003;Groh et al., 2002Groh et al., , 2006Kaiser et al., 2007). Interestingly, high levels of sMICA in patients undergoing HSCT were correlated with an increased risk of relapse and chronic GvHD (Boukouaci et al., 2009). ...
Unrelated haematopoietic stem cell transplantation (HSCT) has evolved from an experimental protocol to a potentially curative first‐line treatment in a variety of haematologic malignancies. The continuous refinement of treatment protocols and supportive care paired with ongoing achievements in the technological field of histocompatibility testing enabled this transformation. Without a doubt, HLA matching is still the foremost criterion for donor selection in unrelated HSCT. However, HSCT‐related treatment complications still occur frequently, often resulting in patients suffering severely or even dying as a consequence of such complications. Current literature indicates that other immune system modulating factors may play a role in the setting of HSCT. In this review, we discuss the current clinical evidence of a possible influence of nonclassical HLA antigens HLA‐E, HLA‐F, and HLA‐G as well as the HLA‐like molecules MICA and MICB, in HSCT.
... The detailed mechanism of this inactivation pathway remains unclear, but P5 was shown to cleave the intermolecular disulfide bonds in IRE1a oligomers to initiate inactivation and negatively regulate the UPR (Eletto et al., 2014b). In addition, it has been reported that P5 cleaves a specific disulfide bond buried inside the major histocompatibility complex class I chain-related polypeptide A molecule on the surface of tumor cells, and thereby promotes tumor immune evasion (Kaiser et al., 2007). Thus, several lines of evidence indicate that P5 plays essential roles in oxidative and reductive processes under physiological conditions (Matsusaki et al., 2020). ...
... Regarding structure-function relationships of P5, the protein comprises two redox-active and one redox-inactive Trxlike domains to catalyze oxidative and reductive processes in the ER (Eletto et al., 2016;Kaiser et al., 2007;Sato et al., 2013). The present SAXS analysis revealed that P5 forms a homodimer in which the six Trx-like domains are separately arranged in multiple possible ways, and both the redoxactive sites in domains a 0 and a are exposed to the solvent. ...
P5, also known as PDIA6, is a PDI family member involved in the ER quality control. Here, we revealed that P5 dimerizes via a unique adhesive motif contained in the N-terminal thioredoxin-like domain. Unlike conventional leucine zipper motifs with leucine residues every two helical turns on ∼30-residue parallel α helices, this adhesive motif includes periodic repeats of leucine/valine residues at the third or fourth position spanning five helical turns on 15-residue anti-parallel α helices. The P5 dimerization interface is further stabilized by several reciprocal salt bridges and C-capping interactions between protomers. A monomeric P5 mutant with the impaired adhesive motif showed structural instability and local unfolding, and behaved as aberrant proteins that induce the ER stress response. Disassembly of P5 to monomers compromised its ability to inactivate IRE1α via intermolecular disulfide bond reduction and its Ca²⁺-dependent regulation of chaperone function in vitro. Thus, the leucine-valine adhesive motif supports structure and function of P5.
... As reviewed above, MICA/B proteins are downregulated via proteolytic cleavage that causes escape from NKG2D recognition. 14,16,17 Previous studies utilised small molecules to block ERp5 or the proteases that cleave MICA/B, with the goal of restoring NKG2D recognition of tumor cells. 14,16 However, these enzymes have broad substrate specificities, and thereby, small molecule inhibitors may block the cleavage of multiple other substrates beyond these NKG2D ligands. ...
... 14,16,17 Previous studies utilised small molecules to block ERp5 or the proteases that cleave MICA/B, with the goal of restoring NKG2D recognition of tumor cells. 14,16 However, these enzymes have broad substrate specificities, and thereby, small molecule inhibitors may block the cleavage of multiple other substrates beyond these NKG2D ligands. For example, ADAM-17 cleaves MICA/B, TNF-alpha, cytokine receptors, cell adhesion molecules and growth factors. ...
Natural killer (NK) cells are innate lymphocytes with cytotoxic functions and recognise target cells with the NK group 2D (NKG2D) receptor. Tumor cells are marked for NK‐cell‐mediated destruction upon expression of MICA and MICB (MICA/B), which are NKG2D ligands upregulated by many human cancers in response to cellular stress pathways associated with malignant transformation such as DNA damage and accumulation of misfolded proteins. However, MICA/B proteins are downregulated by tumor cells via intriguing molecular mechanisms, such as post‐translational modifications in which the external domains of MICA/B are proteolytically cleaved by surface proteases and shed into the extracellular space. MICA/B shedding by cancer cells causes effective escape from NKG2D recognition and allows the development of cancers. Patients frequently have increased concentrations of soluble MICA/B molecules shed in the blood plasmas and sera, thus indicating that MICA/B shedding is a therapeutic target in immune‐oncology. Here, we review the clinical significance of MICA/B shedding in cancer as well as novel immunotherapeutic approaches that aim to restore NKG2D‐mediated surveillance. We also briefly discuss potential roles of MICA/B shedding beyond oncology, such as in viral infections and immune tolerance. This review will help to inform the future developments of NKG2D‐based immunotherapies.
... To date, several immunotherapeutic approaches have been proposed to target the NKG2D-NKG2DL axis for cancer therapy [46]. One promising therapeutic option is the use of small molecule-shedding inhibitors to prevent immune escape [47][48][49]. Others suggest the promising use of antibodies, either to reduce serum levels of soluble ligands or to prevent shedding as well [50,51]. ...
Ligands of the natural killer group 2D (NKG2DL) family are expressed on malignant cells and are usually absent from healthy tissues. Recognition of NKG2DLs such as MICA/B and ULBP1-3 by the activating immunoreceptor NKG2D, expressed by NK and cytotoxic T cells, stimulates anti-tumor immunity in breast cancer. Upregulation of membrane-bound NKG2DLs in breast cancer has been demonstrated by immunohistochemistry. Tumor cells release NKG2DLs via proteolytic cleavage as soluble (s)NKG2DLs, which allows for effective immune escape and is associated with poor prognosis. In this study, we collected serum from 140 breast cancer (BC) and 20 ductal carcinoma in situ (DCIS) patients at the time of initial diagnosis and 20 healthy volunteers (HVs). Serum levels of sNKG2DLs were quantified through the use of ELISA and correlated with clinical data. The analyzed sNKG2DLs were low to absent in HVs and significantly higher in BC patients. For some of the ligands analyzed, higher sNKG2DLs serum levels were associated with the classification of malignant tumor (TNM) stage and grading. Low sMICA serum levels were associated with significantly longer progression-free (PFS) and overall survival (OS). In conclusion, we provide the first insights into sNKG2DLs in BC patients and suggest their potential role in tumor immune escape in breast cancer. Furthermore, our observations suggest that serum sMICA levels may serve as a prognostic parameter in the patients analyzed in this study.
... NKG2D-NKG2D ligand interactions mediate increased cytotoxicity that can be protective against tumors or infections but can also lead to enhanced immunopathology. Tumors and some viruses block this pathway, demonstrating its important role in protection [39][40][41][42]. However, it can also be detrimental, as is evident in some autoimmune diseases [43,44]. ...
Cutaneous leishmaniasis exhibits a spectrum of clinical presentations dependent upon the parasites' persistence and host immunopathologic responses. Although cytolytic CD8 T cells cannot control the parasites, they significantly contribute to pathologic responses. In a murine model of cutaneous leishmaniasis, we previously found that NKG2D plays a role in the ability of cytolytic CD8 T cells to promote disease in leishmanial lesions. Here, we investigated whether NKG2D plays a role in human disease. We found that NKG2D and its ligands were expressed within lesions from L. braziliensis-infected patients and that IL-15 and IL-1β were factors driving NKG2D and NKG2D ligand expression, respectively. Blocking NKG2D reduced degranulation by CD8 T cells in a subset of patients. Additionally, our transcriptional analysis of patients' lesions found that patients who failed the first round of treatment exhibited higher expression of KLRK1, the gene coding for NKG2D, than those who responded to treatment. These findings suggest that NKG2D may be a promising therapeutic target for ameliorating disease severity in cutaneous leishmaniasis caused by L. braziliensis infection.
... Finally, the pharmacological inhibition of a transcriptional repressor effectively restored highdensity NKG2D-ligand expression and enabled the elimination of previously resistant leukemia stem cells by NKG2D-expressing NK cells [60]. This suggests that sensitizing agents, which promote ligand expression or prevent shedding thereof by multiple mechanisms [70][71][72][73], may prove valuable as combination treatments acting in concert with other therapeutic approaches. ...
Natural killer (NK) cells are innate lymphocytes that participate in immune responses against virus-infected cells and tumors. As a countermeasure, viruses and tumors employ strategies to evade from NK cell-mediated immunosurveillance. In this review, we examine immune evasion strategies employed by viruses, focusing on examples from human cytomegalovirus (HCMV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). We explore selected viral evasion mechanisms categorized into three classes: (1) providing ligands for the inhibitory receptor NKG2A, (2) down-regulating ligands for the activating receptor NKG2D, and (3) inducing the immunosuppressive cytokine transforming growth factor (TGF)-β. For each class, we draw parallels between immune evasion by viruses and tumors, reviewing potential opportunities for overcoming evasion in cancer therapy. We suggest that in-depth investigations of host-pathogen interactions between viruses and NK cells will not only deepen our understanding of viral immune evasion but also shed light on how NK cells counter such evasion attempts. Thus, due to the parallels of immune evasion by viruses and tumors, we propose that insights gained from anti-viral NK cell responses may serve as valuable lessons that can be leveraged for designing future cancer immunotherapies. This article is protected by copyright. All rights reserved.
... Because accumulation of misfolded proteins in the cell can lead to enhanced cellular stress and death [35], upregulation of PDI can act to reduce stress-associated apoptosis. Human PDI-family member ERp5 has been shown to promote shedding of MICA from epithelial tumours [36]. MICA is the ligand for the NKG2D (NK group member 2D) receptor on NK, CD8 + T, NKT and T cells, and upon ligation, activates cytolysis of the target cell. ...
... 28 Previous studies have attempted to utilize small molecule inhibitors against the proteases contributing to MICA/B shedding, but these membrane-associated proteases are also involved in the shedding of many other substrates. 11,13 A more selective approach has been the development of monoclonal antibodies (mAbs) specific to the MICA/B a3 domain that inhibit proteolytic shedding by steric inhibition of protease binding. 29,30 Monoclonal antibodies that target the MICA/B a3 domain have significant activity against tumor metastases through promoting NKG2D and CD16a-mediated tumor recognition by NK cells. ...
Background:
The advent of chimeric antigen receptor (CAR) T cell therapies has transformed the treatment of hematological malignancies; however, broader therapeutic success of CAR T cells has been limited in solid tumors because of their frequently heterogeneous composition. Stress proteins in the MICA and MICB (MICA/B) family are broadly expressed by tumor cells following DNA damage but are rapidly shed to evade immune detection.
Methods:
We have developed a novel CAR targeting the conserved α3 domain of MICA/B (3MICA/B CAR) and incorporated it into a multiplexed-engineered induced pluripotent stem cell (iPSC)-derived natural killer (NK) cell (3MICA/B CAR iNK) that expressed a shedding-resistant form of the CD16 Fc receptor to enable tumor recognition through two major targeting receptors.
Findings:
We demonstrated that 3MICA/B CAR mitigates MICA/B shedding and inhibition via soluble MICA/B while simultaneously exhibiting antigen-specific anti-tumor reactivity across an expansive library of human cancer cell lines. Pre-clinical assessment of 3MICA/B CAR iNK cells demonstrated potent antigen-specific in vivo cytolytic activity against both solid and hematological xenograft models, which was further enhanced in combination with tumor-targeted therapeutic antibodies that activate the CD16 Fc receptor.
Conclusions:
Our work demonstrated 3MICA/B CAR iNK cells to be a promising multi-antigen-targeting cancer immunotherapy approach intended for solid tumors.
Funding:
Funded by Fate Therapeutics and NIH (R01CA238039).
... A prerequisite for cleavage of MICA/B appears to be the reduction of a single disulfide bridge in the alpha 3 domain by protein disulfide isomerase endoplasmic reticulum protein 5 (ERP5), which may enable MICA/B to adopt a proteasesensitive conformation. 104 Shedding of MICA/B from the tumor cell membrane leads to an accumulation of soluble MICA/B in the blood of cancer patients. 105,106 The potentially pivotal role of the NKG2D/ ligand axis in immune surveillance is evident from the negative prognostic value of soluble MICA in a variety of cancers, including solid tumors, such as hepatocellular carcinoma (HCC), as well as hematological malignancies, like MM. ...
The field of immuno-oncology has revolutionized cancer patient care and improved survival and quality of life for patients. Much of the focus in the field has been on exploiting the power of the adaptive immune response through therapeutic targeting of T cells. While these approaches have markedly advanced the field, some challenges remain, and the clinical benefit of T cell therapies does not extend to all patients or tumor indications. Alternative strategies, such as engaging the innate immune system, have become an intense area of focus in the field. In particular, the engagement of natural killer (NK) cells as potent effectors of the innate immune response has emerged as a promising modality in immunotherapy. Here, we review therapeutic approaches for selective engagement of NK cells for cancer therapy, with a particular focus on targeting the key activating receptors NK Group 2D (NKG2D) and cluster of differentiation 16A (CD16A).
... A very important factor in the control of tumour development and progression is the NKG2D molecule and its ligand HLA-E. Because neoplasms are able to release NKG2D ligands MICA/B and ULBP1/2/3 by proteolytic cleavage, and thus evade NKG2D-mediated NK cell cytotoxicity [283,512,513]. The observed functional activity of NK cells within the tumour was reduced, reflecting a dominant inhibitory phenotype, also accompanied by enrichment for PD-1 + TIGIT + NK cells and a reduction in CD16, a receptor capable to bind the antibody Fc fragment, thus enabling NK cells to perform ADCC. ...
Simple Summary
According to the latest GLOBOCAN data, head and neck squamous cell carcinoma (HNSCC) represents the sixth most prevalent human malignancy. Recent studies indicate that various immune cell populations may determine the pathogenesis of HNSCCs. The aim of this review was to provide a comprehensive overview of the role of the immune response in HNSCC tumorigenesis, molecular signatures and the mechanisms regulating pro- and anti-cancer activity; it also examines their impact on the current status and future prospects of immunotherapeutic strategies for overcoming immune escape of HNSCC. The study corpus encompasses a wide range of recent molecular, observational and intervention studies on the role of immune signalling pathways and interaction between neoplastic cells and immune cells in human HNSCCs. Rapid advances in the field of immuno-oncology and the constantly growing body of knowledge concerning immunosuppressive mechanisms have allowed effective and personalized immunotherapy to be used as a first-line therapeutic procedure or an essential component of a combination therapy for primary, relapsed and metastatic HNSCC. A greater understanding of the immune response in cancers may also contribute to the further identification of new potential immunological biomarkers necessary for greater clinical benefit in HNSCC patients.
Abstract
Head and neck squamous cell carcinoma (HNSCC) is one of the most aggressive and heterogeneous groups of human neoplasms. HNSCC is characterized by high morbidity, accounting for 3% of all cancers, and high mortality with ~1.5% of all cancer deaths. It was the most common cancer worldwide in 2020, according to the latest GLOBOCAN data, representing the seventh most prevalent human malignancy. Despite great advances in surgical techniques and the application of modern combinations and cytotoxic therapies, HNSCC remains a leading cause of death worldwide with a low overall survival rate not exceeding 40–60% of the patient population. The most common causes of death in patients are its frequent nodal metastases and local neoplastic recurrences, as well as the relatively low response to treatment and severe drug resistance. Much evidence suggests that the tumour microenvironment (TME), tumour infiltrating lymphocytes (TILs) and circulating various subpopulations of immunocompetent cells, such regulatory T cells (CD4⁺CD25⁺Foxp3⁺Tregs), cytotoxic CD3⁺CD8⁺ T cells (CTLs) and CD3⁺CD4⁺ T helper type 1/2/9/17 (Th1/Th2/Th9/Th17) lymphocytes, T follicular helper cells (Tfh) and CD56dim/CD16bright activated natural killer cells (NK), carcinoma-associated fibroblasts (CAFs), myeloid-derived suppressor cells (MDSCs), tumour-associated neutrophils (N1/N2 TANs), as well as tumour-associated macrophages (M1/M2 phenotype TAMs) can affect initiation, progression and spread of HNSCC and determine the response to immunotherapy. Rapid advances in the field of immuno-oncology and the constantly growing knowledge of the immunosuppressive mechanisms and effects of tumour cancer have allowed for the use of effective and personalized immunotherapy as a first-line therapeutic procedure or an essential component of a combination therapy for primary, relapsed and metastatic HNSCC. This review presents the latest reports and molecular studies regarding the anti-tumour role of selected subpopulations of immunocompetent cells in the pathogenesis of HNSCC, including HPV+ve (HPV⁺) and HPV−ve (HPV⁻) tumours. The article focuses on the crucial regulatory mechanisms of pro- and anti-tumour activity, key genetic or epigenetic changes that favour tumour immune escape, and the strategies that the tumour employs to avoid recognition by immunocompetent cells, as well as resistance mechanisms to T and NK cell-based immunotherapy in HNSCC. The present review also provides an overview of the pre- and clinical early trials (I/II phase) and phase-III clinical trials published in this arena, which highlight the unprecedented effectiveness and limitations of immunotherapy in HNSCC, and the emerging issues facing the field of HNSCC immuno-oncology.
... 91 Moreover, tumor cells may produce metalloproteinase to cleave NKG2D ligands from their surfaces and remove them by endocytosis, inhibiting the activation of NK cells. 92 Metalloproteinase inhibitors prevent tumor cells from spoiling NKG2D ligands and potentiate the revitalization of NK cell activity. In addition, MDSCs, Treg cells, TAMs and stromal cells accumulated in HCC microenvironment contribute to the dysfunction of NK cells by secreting various inhibitory cytokines. ...
Hepatocellular carcinoma (HCC) remains a serious medical therapeutic challenge as conventional curative avenues such as surgery and chemotherapy only benefit for few patients with limited tumor burden. Immunotherapy achieves clinical progress in the treatment of this prevalent malignant disease by virtue of the development of tumor immunology; however, most patients have experienced minimal or no clinical benefit in terms of overall survival. The complexity and diversity of tumor microenvironment (TME) built by immune and stromal cell subsets has been considered to be responsible for the insufficiency of immunotherapy. The advance of bioanalytical technology boosts the exploration of the composition and differentiation of these infiltrated cells, which reflect the immune state of the TME and impact the efficacy of the antitumor immune response. Targeting these cells to remodel the TME is one of the important immunotherapeutic approaches to improve HCC treatment. In this review, we focused on the role of these non-cancerous cells in the tumor progression, and elaborated their function on cancer immunotherapy when manipulating them as potential targets.
... PDIA6 is a thioreductase mainly located in the ER lumen, where it modulates the unfolded protein response (59)(60)(61). PDIA6 has also been found in the plasma membrane, where it facilitates antigen shedding and immune evasion (62,63). We selected PDIA6 because: (i) it belongs to the increased binder group, containing RBPs for which melanoma cells show the strongest dependency ( Figures 2D, S2C); (ii) it is a novel RBP that, although detected in other RIC studies, its binding to RNA has not been validated and there is no mechanistic understanding of this novel function. ...
RNA-binding proteins (RBPs) have been relatively overlooked in cancer research despite their contribution to virtually every cancer hallmark. Here, we use RNA interactome capture (RIC) to characterize the melanoma RBPome and uncover novel RBPs involved in melanoma progression. Comparison of RIC profiles of a non-tumoral versus a metastatic cell line revealed prevalent changes in RNA-binding capacities that were not associated with changes in RBP levels. Extensive functional validation of a selected group of 24 RBPs using five different in vitro assays unveiled unanticipated roles of RBPs in melanoma malignancy. As proof-of-principle we focused on PDIA6, an ER-lumen chaperone that displayed a novel RNA-binding activity. We show that PDIA6 is involved in metastatic progression, map its RNA-binding domain, and find that RNA binding is required for PDIA6 tumorigenic properties. These results exemplify how RIC technologies can be harnessed to uncover novel vulnerabilities of cancer cells.
... Эта последовательность присутствует во всех известных аллельных вариантах белков MICA/B. С α3 доменом взаимодействует дисульфидная изомераза Erp5, которая образует дисульфидные связи между остатками цистеинов в α3 домене, что приводит к конформационным изменениям и открытию сайта отщепления [46]. Показано, что молекулы MICA/B локализуются в богатых холестерином кавеолах мембраны при присоединении остатков пальмитиновой кислоты к двум Примечание. ...
MICA and MICB molecules, MHC class I chain-related proteins, are expressed on the membranes of damaged, transformed or infected cells. These glycoproteins bind to the NKG2D receptor of NK cells, resulting in their activation and cytotoxic response against MICA- and/or MICB-expressing cells. Expression of NKG2D receptor ligands allows the elimination of tumor and damaged cells. Soluble forms of MICA/B proteins are produced as a result of protein cleavage. Binding of soluble ligands to NKG2D receptors causes their internalization and degradation, leading to a decrease in NK cell activity. Malignant growth of gastrointestinal tissues, pancreas, liver, kidney, lung, skin, and blood cancers is accompanied by increased concentration of soluble MICA/B in blood plasma of the patients. High concentrations of these proteins are associated with lower overall and recurrence-free survival in the patients. Soluble MICA/B contribute to immunosuppressive tumor microenvironment, and increase in their plasma contents is considered an index of tumor escape from the immune surveillance. The role of MICA/B protein changes during carcinogenesis is also under studies. At the early stage of tumor formation, these proteins contribute to activation of NK cells and elimination of transformed cells, whereas, at the later stage of this process, the increased production of its soluble forms leads to a decrease in anti-tumor activity of NK cells. Standard cancer treatment, such as chemotherapy, is accompanied by increased density of these molecules on the tumor cells. In addition, preclinical studies show that inhibition of MICA/B shedding with antibodies or their derivatives may also promote the anti-tumor activity of NK cells. This review summarizes basic information on the biology of MICA/B molecules, their expression by normal and transformed cells, elucidates the role of these molecules in anti-tumor immune surveillance, and provides information on the potential use of MICA/B in diagnosis and therapy of malignant diseases.
... Of the indicated innate immune cells such as macrophages (Mø) and dendritic cells (DCs), autologous or allogeneic NK cells are adequate to fulfill the biofunction of combating malignant tumors and pathogenic microorganisms via paracrine effects (e.g., IFN-γ, GM-CSF), antibody-dependent cell-mediated cytotoxicity (ADCC) and direct cytolytic effect dispense with preliminary antigen presentation as well as manipulating other immune contextures to recognize and attack cancer cells [1,5,[19][20][21]. However, the heterogeneous tumor cells with genetic or epigenetic variations are also sufficient to elude the immunological surveillance and even reversely suppress NK cell cytotoxicity by interdicting the corresponding activating receptors [5,22,23]. Considering the deficiency of CAR-T and non-gene-edited NK cells, CAR-NK cells have been recognized as novel therapeutic options aiming at reducing the incidence of relapse and attaining complete remission. Of note, considerable progresses have been achieved in an increasing number of therapeutic dimensions ranging from preclinical studies to clinical practices [24]. ...
Natural killer (NK) cells are unique innate immune cells and manifest rapid and potent cytotoxicity for cancer immunotherapy and pathogen removal without the requirement of prior sensitization or recognition of peptide antigens. Distinguish from the T lymphocyte-based cythotherapy with toxic side effects, chimeric antigen receptor-transduced NK (CAR-NK) cells are adequate to simultaneously improve efficacy and control adverse effects including acute cytokine release syndrome (CRS), neurotoxicity and graft-versus-host disease (GVHD). Moreover, considering the inherent properties of NK cells, the CAR-NK cells are “off-the-shelf” product satisfying the clinical demand for large-scale manufacture for cancer immunotherapy attribute to the cytotoxic effect via both NK cell receptor-dependent and CAR-dependent signaling cascades. In this review, we mainly focus on the latest updates of CAR-NK cell-based tactics, together with the opportunities and challenges for cancer immunotherapies, which represent the paradigm for boosting the immune system to enhance antitumor responses and ultimately eliminate malignancies. Collectively, we summarize and highlight the auspicious improvement in CAR-NK cells and will benefit the large-scale preclinical and clinical investigations in adoptive immunotherapy.
... Tumor cells however evolve and evade destruction by NK cells [106]. A common escape mechanism used by tumor cells is the proteolytic shedding of NKG2D ligands [107]. Further, chronic stimulation of NKG2D pathway by tumor-associated expression of TGF-β and NKG2D ligands (including MHC class I homologues MICA and MICB) on the surface of tumor cells can functionally impair NKG2D pathway by inducing endocytosis and destruction of the potent activating NKG2D receptors on NK cells [108,109]. ...
Tumor exists as a complex network of structures with an ability to evolve and evade the host immune surveillance mechanism. The immune milieu which includes macrophages, dendritic cells, natural killer cells, neutrophils, mast cells, B cells, and T cells is found in the core, the invasive margin, or the adjacent stromal or lymphoid component of the tumor. The immune infiltrate is heterogeneous and varies within a patient and between patients of the same tumor histology. The location, density, functionality, and the crosstalk between the immune cells in the tumor microenvironment influence the nature of immune response, prognosis, and treatment outcomes in cancer patients. Therefore, an understanding of the characteristics of the immune cells and their role in tumor immune surveillance is of paramount importance to identify immune targets and to develop novel immune therapeutics in the war against cancer. In this chapter, we provide an overview of the individual components of the human immune system and the translational relevance of predictive biomarkers.
... Given the wide distribution of NKG2D ligands in malignancies, CIK cells appear to be endowed with a broad antitumor spectrum (i.e., in an NKG2D-dependent manner). However, NKG2D ligands have been reported to be lost from the tumor surface either by proteolytic shedding or exosome excretion (49,50). Therefore, the strategy for preventing surface loss or upregulating the expression of NKG2D ligands may help to enhance the cytolytic ability of CIK cells against these tumors. ...
Cytokine-induced killer (CIK) cells are an ex vivo expanded heterogeneous cell population with an enriched NK-T phenotype (CD3+CD56+). Due to the convenient and relatively inexpensive expansion capability, together with low incidence of graft versus host disease (GVHD) in allogeneic cancer patients, CIK cells are a promising candidate for immunotherapy. It is well known that natural killer group 2D (NKG2D) plays an important role in CIK cell-mediated antitumor activity; however, it remains unclear whether its engagement alone is sufficient or if it requires additional co-stimulatory signals to activate the CIK cells. Likewise, the role of 2B4 has not yet been identified in CIK cells. Herein, we investigated the individual and cumulative contribution of NKG2D and 2B4 in the activation of CIK cells. Our analysis suggests that (a) NKG2D (not 2B4) is implicated in CIK cell (especially CD3+CD56+ subset)-mediated cytotoxicity, IFN-g secretion, E/T conjugate formation, and degranulation; (b) NKG2D alone is adequate enough to induce degranulation, IFN-g secretion, and LFA-1 activation in CIK cells, while 2B4 only provides limited synergy with NKG2D (e.g., in LFA-1 activation); and (c) NKG2D was unable to costimulate CD3. Collectively, we conclude that NKG2D engagement alone suffices to activate CIK cells, thereby strengthening the idea that targeting the NKG2D axis is a promising approach to improve CIK cell therapy for cancer patients. Furthermore, CIK cells exhibit similarities to classical invariant natural killer (iNKT) cells with deficiencies in 2B4 stimulation and in the costimulation of CD3 with NKG2D. In addition, based on the current data, the divergence in receptor function between CIK cells and NK (or T) cells can be assumed, pointing to the possibility that molecular modifications (e.g., using chimeric antigen receptor technology) on CIK cells may need to be customized and optimized to maximize their functional potential.
... 2,3 Consequently, a better comprehension of its composition and its chemical environment is of prior importance to decipher biochemical events at the PM and to better understand the involved mechanisms. Among the regulation mechanisms occurring at the PM, reduction by bio thiols through thiol disulfide exchange (TDE) reaction is implicated in various cellular process, 4 including PM composition and function, 5 HIV, hepatitis, and SARS-CoV-2 infections, 6, 7, 8 cancer invasion, 9,10 and cellular uptake. 11,12,13 These reactions are not only driven by proteins, 14,15 but also by efflux of glutathione which can be exported across the PM. ...
... To effectively evade the immune system, tumor cells may use metalloproteinases to cleave the activating NKG2D ligands from their surfaces and remove them by endocytosis and subsequent excretion in exosomes [54,55]. Metalloproteinase inhibitors may prevent tumor cells from NKG2D ligand shedding [56] and may have potential as an adjunct to current immunotherapies [57]. ...
The detection and killing of neoplastic cells require coordination of a variety of antitumor effector cells. Natural killer (NK) cells of the innate immune system are at the forefront of the body's defense systems and evidence suggests that the infiltration and cytotoxicity of NK cells in the cancer tissue influence treatment efficacy and survival.
As powerful effectors in the anticancer immune response, NK cells rapidly recognize and kill transformed cells with little reactivity against healthy self-tissues, which highlights their potential role in cancer immunotherapy.
Modern immunotherapeutic approaches include immune checkpoint inhibitors to revitalize dysfunctional T cells and adoptive cell transfer using CD8⁺ T cells with chimeric antigen receptors to enhance their functionality. However, treatment responses may be short-lived and risk of discontinuation due to adverse effects necessitates the development of safer immuno-oncologic therapies with improved outcomes. To this end, novel combinatorial interventions using T cells and NK cells and strategies for overcoming associated challenges are currently being investigated.
This review summarizes the advances in the research on NK cells in cancer and cancer immunotherapy and discusses the possible implications for future cancer treatment.
... 9 However, MICA/B are downregulated via proteolytic cleavage, a posttranslational modification that removes MICA/B from the cellular surface. [10][11][12][13][14] The sera from patients with AML have average soluble MICA and MICB concentrations 10-fold higher than those from healthy donors. 15 Accordingly, CAR T cells engineered to recognize NKG2D ligands were safe but did not generate antileukemia response in phase 1 trial; all patients with AML in this trial had soluble MICA, MICB, or both in blood plasmas. ...
Acute myeloid leukemia (AML) is a clonal hematopoietic stem and progenitor cell malignancy characterized by poor clinical outcomes. MICA and MICB (MICA/B) are stress-proteins expressed by cancer cells, and antibody-mediated inhibition of MICA/B shedding represents a novel approach to stimulate immunity against cancers. We found that the MICA/B antibody 7C6 potently inhibits the outgrowth of AML in two models in immunocompetent mice. Macrophages were essential for therapeutic efficacy, and 7C6 triggered antibody-dependent phagocytosis of AML cells. Furthermore, we found that romidepsin, a selective histone deacetylase inhibitor, increased MICB mRNA in AML cells and enabled subsequent stabilization of the translated protein by 7C6. This drug combination substantially increased surface MICA/B expression in a human AML line, pluripotent stem cell-derived AML blasts and leukemia stem cells, as well as primary cells from three untreated AML patients. Human macrophages phagocytosed AML cells following treatment with 7C6 and romidepsin, and the combination therapy lowered leukemia burden in a humanized model of AML. Therefore, inhibition of MICA/B shedding promotes macrophage-driven immunity against AML via Fc receptor signaling and synergizes with an epigenetic regulator. These results provide the rationale for the clinical testing of this innovative immunotherapeutic approach for the treatment of AML.
... It is conceivable that, with the amplified inflammatory tumor microenvironment and concurrent immune-suppressive effects induced by sMIC, tumors could override the protective immunity provided by residual tumor cell surface MIC. Noteworthy, tumorshed or recombinant sMIC contains the ectodomain (α1α2α3) of full-length MIC and that NKG2D recognizes the same ectodomain of α1 and α2 of sMIC and membrane-bound MIC 65,66 . It is intriguing how the same recognition of sMIC and mMIC by NKG2D could lead to a partitioned NK cell-intrinsic signaling and thus polarized functional reprogramming. ...
Natural Killer (NK) cell dysfunction is associated with poorer clinical outcome in cancer patients. What regulates NK cell dysfunction in tumor microenvironment is not well understood. Here, we demonstrate that the human tumor-derived NKG2D ligand soluble MIC (sMIC) reprograms NK cell to secrete pro-tumorigenic cytokines with diminished cytotoxicity and polyfunctional potential. Antibody clearing sMIC restores NK cell to a normal cytotoxic effector functional state. We discovered that sMIC selectively activates the CBM-signalosome inflammatory pathways in NK cells. Conversely, tumor cell membrane-bound MIC (mMIC) stimulates NK cell cytotoxicity through activating PLC2γ2/SLP-76/Vav1 pathway. Ultimately, antibody targeting sMIC effectuated the in vivo anti-tumor effect of adoptively transferred NK cells. Our findings uncover an unrecognized mechanism that could instruct NK cell to a dysfunctional state in response to cues in the tumor microenvironment. Our findings provide a rationale for co-targeting sMIC to enhance the efficacy of the ongoing NK cell-based cancer immunotherapy.
... Using NKG2D deficient mice, Guerra et al. demonstrated that NKG2D was required for preventing the incidence and onset of spontaneous and transplantable tumor models [48]. However, to evade NK cell recognition and to reduce the NKG2D-mediated NK cell activation, tumor cells shed MICA and MICB from their surface [49] (Figure 1). The shedding of NKG2D ligands by tumor cells indeed leads to the downregulation of NKG2D on the surface of NK cells and T cells, further dampening the antitumor immunity [50,51]. ...
Natural killer (NK) cells are innate lymphoid cells playing an important role in anti-cancer immunity. NK cells are efficient in controlling the spreading of metastasis but are not very powerful in fighting against primary tumors. The NK cell capability to infiltrate and persist in the tumor microenvironment and to exert their antitumoral functions is often limited by tumor escape mechanisms. These tumor-mediated strategies not only induce NK cell tolerance but also interfere with the NK cell-dependent immune networking. This review will provide an overview of the tumor escape mechanisms impacting NK cells, identify the immune circuits regulating the NK cell-dependent antitumor immunity and revise the emerging therapeutic approaches to unleash NK cells in cancer.
... On the other hand, NK cells also displayed high levels of inhibitory checkpoints PD-1, PD-L1, LAG3, Tim-3 and TIGIT [251,256,[265][266][267] and were capable of generating immunosuppressive adenosine and other soluble mediators [268,269] (Figure 2B). Additional mechanisms that help cancers avoid NK cell recognition and killing, are selective downregulation of MHC-I alleles involved in T-cell recognition (such as HLA-A2) while sparing KIR inhibitory ligands such as HLA-C, and proteolytic shedding of NKG2D ligands MICA and MICB [270][271][272][273] whose cell surface expression normally leads to tumor killing via NKG2D engagement [202,203] ( Figure 2B). Indeed, high serum concentrations of MICA were associated with progression of neuroblastoma, melanoma, gastrointestinal, lung, breast, prostate, renal, gynecological cancers and multiple myeloma [274][275][276][277][278]. ...
It is now well accepted that the immune system can control cancer growth. However, tumors escape immune-mediated control through multiple mechanisms and the downregulation or loss of major histocompatibility class (MHC)-I molecules is a common immune escape mechanism in many cancers. MHC-I molecules present antigenic peptides to cytotoxic T cells, and MHC-I loss can render tumor cells invisible to the immune system. In this review, we examine the dysregulation of MHC-I expression in cancer, explore the nature of MHC-I-bound antigenic peptides recognized by immune cells, and discuss therapeutic strategies that can be used to overcome MHC-I deficiency in solid tumors, with a focus on the role of natural killer (NK) cells and CD4 T cells.
... To escape to NK cell immunosurveillance, tumor cells can also secrete immunomodulatory molecules such as prostaglandin E2 (PGE2), indoleamine 2,3-dioxygenase (IDO), adenosine, TGFβ, and interleukin-10 (IL-10). Tumor cells can proteolytically shed NKG2D ligands (NKG2DLs) leading to a decreased amount of NKG2DL and to the production of soluble ligands that downmodulate NKG2D receptor on NK cells [59,60]. Finally, secretion of immunosuppressive molecules or expression of NKG2DLs by cells of the tumor microenvironment can downmodulate NKG2D receptor on NK cells. ...
Natural killer (NK) cells are crucial components of the innate immune system and play critical roles in host immunity against viral infections and cancer. NK cells' activity is controlled by the interaction of a wide range of receptors expressed on their surfaces with cell surface ligands. Opposite signals delivered by inhibitory and activating receptors tightly regulate NK cells' cytotoxicity. Natural killer cells can discriminate between normal and cancer cells. NK cells are known to directly recognize and kill malignant cells or induce apoptosis. However, tumor cells have the ability to evade those attacks. The main mechanisms involve the lack of expression or downregulation of the expression of major histocompatibility complex (MHC) class I molecules and secretion of soluble NKG2D ligands by tumor cells. Furthermore, tumors harbor a population of cancer stem cells (CSCs), which can drive tumor progression and therapeutical resistance. This chapter highlights the roles of NK cells in tumor immunosurveillance and their applications for cancer immunotherapy. NK cell biology and function as well as the role of their receptor interactions will be described. We will discuss the therapeutic applications of NK cells in cancer and NK cells targeting CSCs as a promising strategy for cancer therapy.
... Thus, even though NK cells are deployed for innate immune defense, a certain number of tumor cells with genetic or epigenetic variations are sufficient to bypass the immunological surveillance and reoccupy the basic prerequisite for tumor formation and progression [12]. For instance, the heterogeneous tumor cells could suppress NK cell function by interdicting the NKG2D receptor via dys-upregulating the inhibitory MHC-I molecules or shedding of the tumor-associated complementary NKG2D ligands [63,64]. ...
Natural killer (NK) cells are advantaged innate cytotoxic lymphocytes with characteristics of tumor immunosurveillance and microorganism elimination. Distinguish from the adaptive T and B lymphocytes, the autologous or allogeneic NK cells efficaciously fulfil the function of combating transformed hematological malignancies and metastatic solid tumors via the proverbial mechanisms including direct cytolytic effect and antibody-dependent cell-mediated cytotoxicity (ADCC) as well as paracrine effects dispense with antigen presentation. Herein, we review the candidate sources (e.g., peripheral blood, umbilical cord blood, placental blood, cell lines and stem cells) for large-scale and clinical-grade NK cell manufacturing, ex vivo cultivation (feeder-, cytokine cocktail- or physicochemical irritation-dependent strategies) for NK cell persistence and activation. Furthermore, we also figure out the promising prospects as well as the accompanied challenges of NK cell- or chimeric antigen receptor-transduced NK (CAR-NK) cell-based adoptive immunotherapy in standardizations for industrialized preparation and clinical practices.
... Alterations in CD58 expression that impair NK cell recognition occur in approximately 60% of DLBCL cases, with the complete absence of surface CD58 in 21% [104]. In cHL, the HRS cells secrete soluble NK group 2D (NKG2D) ligand, which binds to NKG2D on circulating NK cells, where it induces internalization and downregulation of the receptor [147,148]. TGF-β secretion within the TME further reduces NKG2D expression and contributes to impaired NK cell immune surveillance [149,150]. Moreover, killer cell immunoglobulin-like receptor (KIR) is expressed on NK cells, where it interacts with HLA molecules to provide self-tolerance against NK-mediated cytotoxicity [151]. ...
Immunotherapy has emerged as a powerful therapeutic strategy for many malignancies, including lymphoma. As in solid tumors, early clinical trials have revealed that immunotherapy is not equally efficacious across all lymphoma subtypes. For example, immune checkpoint inhibition has a higher overall response rate and leads to more durable outcomes in Hodgkin lymphomas compared to non-Hodgkin lymphomas. These observations, combined with a growing understanding of tumor biology, have implicated the tumor microenvironment as a major determinant of treatment response and prognosis. Interactions between lymphoma cells and their microenvironment facilitate several mechanisms that impair the antitumor immune response, including loss of major histocompatibility complexes, expression of immunosuppressive ligands, secretion of immunosuppressive cytokines, and the recruitment, expansion, and skewing of suppressive cell populations. Accordingly, treatments to overcome these barriers are being rapidly developed and translated into clinical trials. This review will discuss the mechanisms of immune evasion, current avenues for optimizing the antitumor immune response, clinical successes and failures of lymphoma immunotherapy, and outstanding hurdles that remain to be addressed.
... 15 Tumors are capable of shedding soluble NKG2D ligands via proteolytic cleavage, which can paradoxically render NK cells less cytotoxic, possibly by non-functional occupation of the NKG2D receptor binding site. 37 Levels of soluble NKG2D ligands (MICA/B and ULBP1/2/3) in the plasma of patients with HNSCC are significantly elevated compared with healthy controls, presumably due to shedding from the primary tumor after proteolytic cleavage. 34 Primary healthy human NK cells incubated with plasma derived from patients with HNSCC were significantly less efficient at killing target cells in vitro; this effect was reversed by depletion of soluble NKG2D ligands prior to incubation, which suggests that NKG2D ligand shedding may be an important mechanism of HNSCC immune evasion. ...
Head and neck squamous cell carcinoma (HNSCC) encompasses a set of cancers arising from the epithelia of the upper aerodigestive tract, accounting for a significant burden of disease worldwide due to the disease’s mortality, morbidity, and predilection for recurrence. Prognosis of HNSCC in the recurrent and/or metastatic (R/M-HNSCC) setting is especially poor and effective treatment options increasingly rely on modulating T-cell antitumor responses. Still, immunotherapy response rates are generally low, prompting the exploration of novel strategies that incorporate other effector cells within the tumor microenvironment. Within the last decade, important advances have been made leveraging the powerful innate antitumor function of natural killer (NK) cells to treat solid tumors, including head and neck squamous cell carcinoma. NK cells are hybrid innate-adaptive effector cells capable of directly eliminating tumor cells in addition to initiating adaptive antitumor immune responses. In the setting of HNSCC, NK cells are important for tumor surveillance and control, and NK cell infiltration has repeatedly been associated with a favorable prognosis. Yet, HNSCC-infiltrating NK cells are susceptible to an array of immune evasion strategies employed by tumors that must be overcome to fully realize the antitumor potential of NK cells. We believe that a conceptual framework informed by the basic biological understanding of the mechanisms underlying NK cell activation can improve treatment of HNSCC, in part by selecting for patients most likely to respond to NK cell-based immunotherapy. Herein, we review the activity of NK cells in HNSCC, paying special attention to the role of environmental and genetic determinants of NK cell antitumor function. Moreover, we explore the evidence that NK cells are a crucial determinant of the efficacy of both established and emerging treatments for HNSCC.
MICA and MICB are Class I MHC-related glycoproteins that are upregulated on the surface of cells in response to stress, for instance due to infection or malignant transformation. MICA/B are ligands for NKG2D, an activating receptor on NK cells, CD8⁺ T cells, and γδ T cells. Upon engagement of MICA/B with NKG2D, these cytotoxic cells eradicate MICA/B-positive targets. MICA is frequently overexpressed on the surface of cancer cells of epithelial and hematopoietic origin. Here, we created nanobodies that recognize MICA. Nanobodies, or VHHs, are the recombinantly expressed variable regions of camelid heavy chain-only immunoglobulins. They retain the capacity of antigen recognition but are characterized by their stability and ease of production. The nanobodies described here detect surface-disposed MICA on cancer cells in vitro by flow cytometry and can be used therapeutically as nanobody-drug conjugates when fused to the Maytansine derivative DM1. The nanobody-DM1 conjugate selectively kills MICA positive tumor cells in vitro.
The activating receptor natural killer group 2, member D (NKG2D) represents an attractive target for immunotherapy as it exerts a crucial role in cancer immunosurveillance by regulating the activity of cytotoxic lymphocytes. In this study, a panel of novel NKG2D-specific single-chain fragments variable (scFv) were isolated from naïve human antibody gene libraries and fused to the fragment antigen binding (Fab) of rituximab to obtain [CD20×NKG2D] bibodies with the aim to recruit cytotoxic lymphocytes to lymphoma cells. All bispecific antibodies bound both antigens simultaneously. Two bibody constructs, [CD20×NKG2D#3] and [CD20×NKG2D#32], efficiently activated natural killer (NK) cells in co-cultures with CD20+ lymphoma cells. Both bibodies triggered NK cell-mediated lysis of lymphoma cells and especially enhanced antibody-dependent cell-mediated cytotoxicity (ADCC) by CD38 or CD19 specific monoclonal antibodies suggesting a synergistic effect between NKG2D and FcγRIIIA signaling pathways in NK cell activation. The [CD20×NKG2D] bibodies were not effective in redirecting CD8+ T cells as single agents, but enhanced cytotoxicity when combined with a bispecific [CD19×CD3] T cell engager, indicating that NKG2D signaling also supports CD3-mediated T cell activation. In conclusion, engagement of NKG2D with bispecific antibodies is attractive to directly activate cytotoxic lymphocytes or to support their activation by monoclonal antibodies or bispecific T cell engagers. As a perspective, co-targeting of two tumor antigens may allow fine-tuning of antibody cancer therapies. Our proposed combinatorial approach is potentially applicable for many existing immunotherapies but further testing in different preclinical models is necessary to explore the full potential.
Natural killer (NK) cells can elicit an immune response against malignantly transformed cells without recognizing antigens, and they also exhibit cytotoxic effects and immune surveillance functions in tumor immunotherapy. Although several studies have shown the promising antitumor effects of NK cells in immunotherapy, their function is often limited in the tumor microenvironment because tumor cells can easily escape NK cell-induced death. Thus, for efficient tumor immunotherapy, the mechanism by which tumor cells escape NK cell-induced cytotoxicity must be fully understood. Various novel molecules and checkpoint receptors that mediate the disruption of NK cells in the tumor microenvironment have been discovered. In this review, we analyze and detail the major activating and inhibitory receptors on the surface of NK cells to delineate the mechanism by which tumor cells suppress NKG2D ligand expression and increase tumor receptor and inhibitory receptor expression [NKG2A, programmed cell death 1 (PD-1), and T-cell immunoglobulin and immunoreceptor tyrosine inhibitory motif (TIGIT)] on the NK cell surface, and thus inhibit NK cell activity. We also reviewed the current status of treatments based on these surface molecules. By comparing the therapeutic effects related to the treatment status and bypass mechanisms, we attempt to identify optimal single or combined treatments to suggest new treatment strategies for tumor immunotherapy.
T cells and natural killer (NK) cells have complementary roles in tumor immunity, and dual T cell and NK cell attack thus offers opportunities to deepen the impact of immunotherapy. Recent work has also shown that NK cells play an important role in recruiting dendritic cells to tumors and thus enhance induction of CD8 T cell responses, while IL-2 secreted by T cells activates NK cells. Targeting of immune evasion mechanisms from the activating NKG2D receptor and its MICA and MICB ligands on tumor cells offers opportunities for therapeutic intervention. Interestingly, T cells and NK cells share several important inhibitory and activating receptors that can be targeted to enhance T cell– and NK cell–mediated immunity. These inhibitory receptor-ligand systems include CD161-CLEC2D, TIGIT-CD155, and NKG2A/CD94-HLA-E. We also discuss emerging therapeutic strategies based on inhibitory and activating cytokines that profoundly impact the function of both lymphocyte populations within tumors.
Expected final online publication date for the Annual Review of Immunology, Volume 41 is April 2023. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
Plasma membranes, as the network for transferring information and constituents between cells and their microenvironment, play important roles in physiological and pathological processes. As the first defensive barriers of cells, cell membranes take further actions through changes in shapes, morphologies or components once they sense damages from exterior poison stimulations. Thus, the changes of plasma membranes are the direct indication for apoptosis induced by drugs, and non-destructive visualization of these changes is of great significance. Various fluorescent probes for real-time and in situ monitoring these changes of plasma membranes have been explored for more than 20 years. However, a concise review on this specific and important topic is still lacking, which may hamper the development of this field. In this review, the typical fluorescent probes for visualization the changes of plasma membranes during apoptosis in the past decades have been summarized. The representative examples have been classified into five categories according to the biological changes, which included the changes of phosphatidylserine (PS), changes in membrane composition, changes in membrane permeability, changes in morphologies and lipid order in plasma membranes. The basic principle, design strategies, sensing mechanisms and the applications of these fluorescent sensors that have been achieved were discussed. The perspectives and challenges with respect to this field were also presented. We anticipated that this review can promote the development of the probes for sensing the changes of plasma membranes during apoptosis, and facilitate the studies of drug discovery and other relative biomedical fields.
Bi-, tri- and multispecific antibodies have enabled the development of targeted cancer immunotherapies redirecting immune effector cells to eliminate malignantly transformed cells. These antibodies allow for simultaneous binding of surface antigens on malignant cells and activating receptors on innate immune cells, such as natural killer (NK) cells, macrophages, and neutrophils. Significant progress with such antibodies has been achieved, particularly in hematological malignancies. Nevertheless, several major challenges remain, including increasing their immunotherapeutic efficacy in a greater proportion of patients, particularly in those harboring solid tumors, and overcoming dose-limiting toxicities and immunogenicity. Here, we discuss novel antibody-engineering developments designed to maximize the potential of NK cells by NK cell engagers mediating antibody-dependent cellular cytotoxicity (ADCC), thereby expanding the armamentarium for cancer immunotherapy.
Natural killer (NK) cells are emerging as unique players in the immune response against cancer; however, only limited data are available on tumor infiltrating NK cells in head and neck squamous cell carcinoma (HNSCC), one of the most common cancer. Occurrence of HNSCC is closely related to the immune microenvironment, and immunotherapy is increasingly being applied to this setting. However, the limited success of this type of treatment in this tumor calls for further investigation in the field.
Surgical HNSSC specimens of 32 consecutive patients were mechanically and enzymatically dissociated. Tumor cells were separated from infiltrating cells by short centrifugation and infiltrating NK cells were phenotypically and functionally characterized by multiple antibody staining and flow cytometry. Tumor infiltrating NK cells in HNSCC showed a peculiar phenotype predominantly characterized by increased NKG2A and reduced Siglec-7, NKG2D, NKp30 and CD16 expression. This phenotype was associated with a decreased ability to perform antibody-dependent cellular cytotoxicity (ADCC). However, NK, CD4 and CD8 shared an increment of glucocorticoid-induced tumor necrosis factor-related (GITR) costimulatory receptor which could be exploited for immunotherapy with agonistic anti-GITR antibodies combined with checkpoint inhibitors.
Hepatocellular carcinoma (HCC) is the leading cause of cancer-related death worldwide. Enhanced mitochondrial fragmentation (MF) is associated with poor prognosis in HCC patients. However, its molecular mechanism in HCC remains elusive. Although enhanced MF activates effector T cells and dendritic cells, it induces immunoescape by decreasing the number and cytotoxicity of natural killer cells in the HCC immune microenvironment. Therefore, the influence of MF on the activity of different immune cells is a great challenge. Enhanced MF contributes to maintaining stemness by promoting the asymmetric division of liver cancer stem cells (LCSCs), suggesting that MF may become a potential target for HCC recurrence, metastasis, and chemotherapy resistance. Moreover, mechanistic studies suggest that MF may promote tumour progression through autophagy, oxidative stress, and metabolic reprogramming. Human-induced hepatocyte organoids are a recently developed system that can be genetically manipulated to mimic cancer initiation and identify potential preventive treatments. We can use it to screen MF-related candidate inhibitors of HCC progression and further explore the role of MF in hepatocarcinogenesis. We herein describe the mechanisms by which MF contributes to HCC development, discuss potential therapeutic approaches, and highlight the possibility that MF modulation has a synergistic effect with immunotherapy.
Glioblastoma (GBM) is a highly malignant brain tumor characterized by a heterogeneous population of genetically unstable and highly infiltrative cells that are resistant to chemotherapy. Although substantial efforts have been invested in the field of anti-GBM drug discovery in the past decade, success has primarily been confined to the preclinical level, and clinical studies have often been hampered due to efficacy-, selectivity-, or physicochemical property-related issues. Thus, expansion of the list of molecular targets coupled with a pragmatic design of new small-molecule inhibitors with central nervous system (CNS)-penetrating ability is required to steer the wheels of anti-GBM drug discovery endeavors. This Perspective presents various aspects of drug discovery (challenges in GBM drug discovery and delivery, therapeutic targets, and agents under clinical investigation). The comprehensively covered sections include the recent medicinal chemistry campaigns embarked upon to validate the potential of numerous enzymes/proteins/receptors as therapeutic targets in GBM.
Most cancer vaccines target peptide antigens, necessitating personalization owing to the vast inter-individual diversity in major histocompatibility complex (MHC) molecules that present peptides to T cells. Furthermore, tumours frequently escape T cell-mediated immunity through mechanisms that interfere with peptide presentation1. Here we report a cancer vaccine that induces a coordinated attack by diverse T cell and natural killer (NK) cell populations. The vaccine targets the MICA and MICB (MICA/B) stress proteins expressed by many human cancers as a result of DNA damage2. MICA/B serve as ligands for the activating NKG2D receptor on T cells and NK cells, but tumours evade immune recognition by proteolytic MICA/B cleavage3,4. Vaccine-induced antibodies increase the density of MICA/B proteins on the surface of tumour cells by inhibiting proteolytic shedding, enhance presentation of tumour antigens by dendritic cells to T cells and augment the cytotoxic function of NK cells. Notably, this vaccine maintains efficacy against MHC class I-deficient tumours resistant to cytotoxic T cells through the coordinated action of NK cells and CD4+ T cells. The vaccine is also efficacious in a clinically important setting: immunization following surgical removal of primary, highly metastatic tumours inhibits the later outgrowth of metastases. This vaccine design enables protective immunity even against tumours with common escape mutations. A vaccine targeting stress proteins expressed by many cancers blocks a tumour escape mechanism, enabling protective immunity mediated by diverse T cell and NK cell populations.
Background
Cancer is considered the prime source of death. A vast number of conventional chemotherapeutic agents are being used to treat cancer, however, these conventional chemotherapeutics agents are capable to destroy or kill both tumor and healthy cells. Cancer, Immunotherapy, Nanotechnology, Dendrimers
Introduction
Cancer immunotherapy has generated large interest and is being explored presently to treat this so far to a large extent incurable disease. In the case of immunotherapy, the approach of treatment, the cancer cell is only targeted. This therapy has very few side effects compared to conventional chemotherapeutic agents. Nowadays dendrimer as a nano-system carrier plays a very crucial role in the field of immunotherapy.
Methods
Biomaterials such as poly(glycerol), PAMAM, carbohydrate-derived citric acid polyester (PGLSA-OH), polyethylene glycol (PEG), poly(propylene imine) (PPI), melamine, triagine, and phosphorhydrazone have been reported for the production of dendrimer. Dendritic-based nono-carriers are classified according to the size of the dendrimers moiety and their generation. They are also classified based on the presence of internal-layers, dynamic dendritic scaffolds that interact with the drug non-covalently central core moiety, and 3D terminal functional group.
Results
Dendrimers are being researched to deliver DNA drugs for antisensetherapy. There are some reports for non-viral gene transmission where PPI or PAMAM dendrimers were utilized. For the gene delivery, dendrimers that are moderately degenerated are more qualified and used to increase the reagent efficiency, hydrolytic cleavage of the amide bond in fragmentation (initiation).
Conclusion
The dendrimers have the property to hold the therapeutic active ingredients such as DNA in their cavity and deliver them to the desired target site so that these are used effectively in cancer immunotherapy. Different types of dendrimers such as PAMAM-PEG dendrimers, triazine dendrimers, glycodendrimers, phosphorus dendrimers, and carbosilaneden dendrimers are being explored for commercial applications for cancer therapy and so far they have produced encouraging results.
Natural killer (NK) cells are a family of lymphocytes with a natural ability to kill infected, harmed, or malignantly transformed cells. As these cells are part of the innate immunity, the cytotoxic mechanisms are activated upon recognizing specific patterns without prior antigen sensitization. This recognition is crucial for NK cell function in the maintenance of homeostasis and immunosurveillance. NK cells not only act directly toward malignant cells but also participate in the complex immune response by producing cytokines or cross-talk with other immune cells. Cancer may be seen as a break of all immune defenses when malignant cells escape the immunity and invade surrounding tissues creating a microenvironment supporting tumor progression. This process may be reverted by intervening immune response with immunotherapy, which may restore immune recognition. NK cells are important effector cells for immunotherapy. They may be used for adoptive cell transfer, genetically modified with chimeric antigen receptors, or triggered with appropriate antibodies and other antibody-fragment-based recombinant therapeutic proteins tailored specifically for NK cell engagement. NK cell receptors, responsible for target recognition and activation of cytotoxic response, could also be targeted in immunotherapy, for example, by various bi-, tri-, or multi-specific fusion proteins designed to bridge the gap between tumor markers present on target cells and activation receptors expressed on NK cells. However, this kind of immunoactive therapeutics may be developed only with a deep functional and structural knowledge of NK cell receptor: ligand interactions. This review describes the recent developments in the fascinating protein-engineering field of NK cell immunotherapeutics.
Background
Hepatocellular carcinoma (HCC) is the most common liver neoplasm with high morbidity and mortality. Tumor immunotherapy might be promising adjuvant therapy for HCC after surgery. To better develop HCC immunotherapy, comprehensive understanding of cell–cell interactions between immune effector cells and HCC cells remains crucial.
Aim
To review the existing studies to summarize the cell–cell interactions between major immune effector cells and HCC cells providing new data for HCC immunotherapy.
Methods
A systematic review was conducted by searching PubMed database covering all papers published in recent five years up to January 2020. The guidelines of the preferred reporting items for systematic reviews were firmly followed.
Results
There are 9 studies researching the interactions between CD8⁺ T lymphocytes and HCC cells and 22 studies researching that between natural killer (NK) cells and HCC cells. Among the 9 studies, 6 studies reported that CD8⁺ T lymphocytes showed cytotoxicity towards HCC cells while 3 studies found CD8⁺ T lymphocytes were impaired by HCC cells. Among the 22 studies, 20 studies presented that NK cells could inhibit HCC cells. Two studies were found to report NK cell dysfunction in HCC.
Conclusion
Based on the systematic analysis, we concluded that CD8⁺ T lymphocytes and NK cells can inhibit HCC cells. While in turn, HCC cells can also result in the dysfunction of those effector cells through various mechanisms. Organoids and direct contact cell co-culture with primary HCC cells and TILs should be the most innovative way to investigate the interactions and develop novel immunotherapy.
The activating immune receptor natural killer group member D (NKG2D) and its cognate ligands represent a fundamental surveillance system of cellular distress, damage or transformation. Signaling through the NKG2D receptor-ligand axis is critical for early detection of viral infection or oncogenic transformation and the presence of functional NKG2D ligands (NKG2D-L) is associated with tumor rejection and viral clearance. Many viruses and tumors have developed mechanisms to evade NKG2D recognition via transcriptional, post-transcriptional or post-translational interference with NKG2D-L, supporting the concept that circumventing immune evasion of the NKG2D receptor-ligand axis may be an attractive therapeutic avenue for antiviral therapy or cancer immunotherapy. To date, the complexity of the NKG2D receptor-ligand axis and the lack of specificity of current NKG2D-targeting therapies has not allowed for the precise manipulation required to optimally harness NKG2D-mediated immunity. However, with the discovery of clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) proteins, novel opportunities have arisen in the realm of locus-specific gene editing and regulation. Here, we give a brief overview of the NKG2D receptor-ligand axis in humans and discuss the levels at which NKG2D-L are regulated and dysregulated during viral infection and oncogenesis. Moreover, we explore the potential for CRISPR-based technologies to provide novel therapeutic avenues to improve and maximize NKG2D-mediated immunity.
Cancer cells require increased rates of protein synthesis to sustain rapid cell growth and proliferation. Increased secretory and membrane protein synthesis relies on an upregulation of the translational and protein folding machinery in the endoplasmic reticulum to aid tumor growth. For example, many critical cancer signaling kinases, such as EGFR (epithelial growth factor receptor), function as membrane proteins. Protein disulfide isomerase (PDI) is the major enzyme responsible for disulfide bond formation in the endoplasmic reticulum, and knockdown of PDI halts tumor progression. Thus, the goal of this dissertation project was to identify novel PDI inhibitors and provide an extensive preclinical evaluation of their activity for the treatment of cancer, specifically glioblastoma. Through a phenotypic screening approach, we identified the pyrimidotriazinedione 35G8 as a potent cytotoxic agent that inhibited PDI. Because of its known pan-assay interference (PAINS) properties, we first validated that the activity of 35G8 was not due to its redox cycling characteristics and used a variety of assays to confirm PDI inhibition. 35G8 destabilized PDI in cell-based target-engagement assays and had a transcriptomic profile similar to PDI knockdown. These results demonstrated the ability of 35G8 to inhibit PDI and potently kill cancer cells. The chalcone BAP2 was also identified through a phenotypic screening approach, and an initial structure-activity relationship (SAR) campaign with 67 analogues revealed important binding characteristics that allowed us to hypothesize that the compounds were binding in the b’ domain of PDI. Mutation of His256 to Ala abolished BAP2 activity and confirmed the binding hypothesis. Furthermore, BAP2 and analogues inhibit glioblastoma cell growth, induce ER stress, increase expression of G2M checkpoint proteins, and reduce expression of DNA repair proteins. BAP2 and analogues also sensitized glioblastoma (GBM) cells to radiation. These results establish the BAP2 series as PDI inhibitors and support their further study as a novel strategy to treat glioblastoma. Finally, a manual biochemical screen of over 1,000 compounds in the PDI reductase assay produced a benzyl-benzodioxole, AS15, as a potent hit with an IC50 value under 1 μM. SAR analysis was performed with over 100 analogues of AS15. The SAR indicated that the compounds were binding PDI via a retro-Michael addition onto the cysteines, and protein mass spectrometry confirmed covalent binding. Cytotoxicity of the AS15 analogues was improved when combined with glutathione synthesis inhibitor buthionine sulfoximine (BSO), which confirmed that PDI competed with glutathione for binding the AS15 series in the cells. Thus, this study provides an excellent foundation to build analogues that are less sensitive to glutathione and more selective for PDI in the cells. The work as a whole provides an extensive characterization of PDI inhibition and its role in cancer. We were able to provide extensive preclinical evaluation of lead PDI inhibitors identified from medium throughput screens. This work provides the foundation for a guided optimization of the PDI inhibitors discovered to further improve the potency and selectivity of the compounds and design a PDI inhibitor for testing in clinical trials.
Simple Summary
NK cells are innate immune cells that form one of the initial responses to infections and cancers. There have been increasing number of studies investigating the anti-tumor effects of NK cells. Immunotherapy targeting NK cell may enhance the therapeutic efficacy of current immunotherapy regimes. Through pro-inflammatory cytokine production, enhancing B cell production of antibodies, facilitate and activate dendritic cells, activate T cells and participating in anti-tumor immunity through the granzyme B pathway and antibody-dependent cellular cytotoxicity, the versatility of NK cells provides an attractive immunotherapy option. This review highlights NK cell biology, NK cell antitumor immunity, NK cell immune evasive mechanisms and novel immunotherapies that aim to target NK cells.
Abstract
Natural killer (NK) cells are a key component of an innate immune system. They are important not only in initiating, but also in augmenting adaptive immune responses. NK cell activation is mediated by a carefully orchestrated balance between the signals from inhibitory and activating NK cell receptors. NK cells are potent producers of proinflammatory cytokines and are also able to elicit strong antitumor responses through secretion of perforin and granzyme B. Tumors can develop many mechanisms to evade NK cell antitumor responses, such as upregulating ligands for inhibitory receptors, secreting anti-inflammatory cytokines and recruiting immunosuppressive cells. Enhancing NK cell responses will likely augment the effectiveness of immunotherapies, and strategies to accomplish this are currently being evaluated in clinical trials. A comprehensive understanding of NK cell biology will likely provide additional opportunities to further leverage the antitumor effects of NK cells. In this review, we therefore sought to highlight NK cell biology, tumor evasion of NK cells and clinical trials that target NK cells.
Simple Summary
NK cells are innate lymphoid cells involved in the control of tumor growth and metastatic spread. Given their significant cytolytic capacity, several promising strategies have been developed to target NK cells in cancer immunotherapy.
Abstract
Natural Killer cells belong to group 1 innate lymphoid cells, which also includes ILC1s. NK/ILC1s are highly heterogeneous cell types showing distinct phenotypes across tissues and conditions. NK cells have long been described as innate lymphocytes able to directly and rapidly kill tumor cells without antigen-restriction. Different mechanisms were shown to modulate NK cell activation and tumor resistance, mainly based on cytokine stimulation and receptor–ligand interactions, and several strategies have been developed to target NK cells in tumor immunotherapy to promote NK cell function and overcome tumor evasion. The characterization of ILC1 distinct phenotype and function and the specific role in tumors still needs further investigation and will be essential to better understand the impact of innate lymphoid cells in tumors. Here, we review key aspects of NK cell biology that are relevant in tumor immune surveillance, emphasizing the most recent findings in the field. We describe the novel therapeutical strategies that have been developed in tumor immunotherapy targeting NK cells, and we summarize some recent findings related to NK cell/ILC1 transition in tumor models.
The major histocompatibility complex (MHC) class I homolog MIC-A functions as a stress-inducible antigen that is recognized by a subset of γδ T cells independent of β2-microglobulin and bound peptides. Its crystal structure reveals a dramatically altered MHC class I fold, both in detail and overall domain organization. The only remnant of a peptide-binding groove is a small cavity formed as the result of disordering a large section of one of the groove-defining helices. Loss of β2-microglobulin binding is due to a restructuring of the interaction interfaces. Structural mapping of sequence variation suggests potential receptor binding sites on the underside of the platform on the side opposite of the surface recognized by αβ T cell receptors on MHC class I–peptide complexes.
Stress-inducible MICA, a distant homolog of major histocompatibility complex (MHC) class I, functions as an antigen for γδ
T cells and is frequently expressed in epithelial tumors. A receptor for MICA was detected on most γδ T cells, CD8+αβ T cells, and natural killer (NK) cells and was identified as NKG2D. Effector cells from all these subsets could be stimulated
by ligation of NKG2D. Engagement of NKG2D activated cytolytic responses of γδ T cells and NK cells against transfectants and
epithelial tumor cells expressing MICA. These results define an activating immunoreceptor-MHC ligand interaction that may
promote antitumor NK and T cell responses.
Protein disulfide isomerase (PDI) is an enzyme that catalyzes the formation as well as the isomerization of disulfide bonds. In this study, antibodies against PDI were used to show PDI antigen on the platelet surface by indirect immunofluorescence microscopy and by flow cytometry. The platelets were not activated, as evidenced by the absence of staining by an antibody against P-selectin. Permeabilized platelets showed little cytosolic PDI by indirect immunofluorescence microscopy, suggesting that the majority of platelet PDI is localized to the platelet surface. PDI activity against "scrambled" RNase was shown with intact platelets. The activity was inhibited by inhibitors of PDI and by an antibody against PDI. Other blood cells showed little PDI. Platelet surface PDI may play a role in the various physiological and pathophysiologic processes in which platelets are involved.
Human MHC class I-related molecules, MICA and MICB, are stress-induced antigens that are recognized by a subset of gamma delta T cells expressing the variable region Vdelta1. This functional association has been found to be limited to intestinal epithelium, where these T cells are prevalent and where MICA and, presumably, MICB are mainly expressed. However, increased frequencies of Vdelta1 gamma delta T cells have been observed in various epithelial tumors; moreover, MICA/B are expressed on diverse cultured epithelial tumor cells. With freshly isolated tumor specimens, expression of MICA/B was documented in many, but not all, carcinomas of the lung, breast, kidney, ovary, prostate, and colon. In tumors that were positive for MICA/B, the frequencies of Vdelta1 gamma delta T cells were significantly higher than in those that were negative. Vdelta1 gamma delta T cell lines and clones derived from different tumors recognized MICA/B on autologous and heterologous tumor cells. In accord with previous evidence, no constraints were observed in these interactions, such as those imposed by specific peptide ligands. Thus, MICA/B are tumor-associated antigens that can be recognized, in an apparently unconditional manner, by a subset of tumor-infiltrating gamma delta T cells. These results raise the possibility that an induced expression of MICA/B, by conditions that may be related to tumor homeostasis and growth, could play a role in immune responses against tumors.
The major histocompatibility complex (MHC) class I homolog, MICA, is a stress-inducible ligand for NKG2D, a C-type lectin-like activating immunoreceptor. The crystal structure of this ligand-receptor complex that we report here reveals an NKG2D homodimer bound to a MICA monomer in an interaction that is analogous to that seen in T cell receptor-MHC class I protein complexes. Similar surfaces on each NKG2D monomer interact with different surfaces on either the alpha1 or alpha2 domains of MICA. The binding interactions are large in area and highly complementary. The central section of the alpha2-domain helix, disordered in the structure of MICA alone, is ordered in the complex and forms part of the NKG2D interface. The extensive flexibility of the interdomain linker of MICA is shown by its altered conformation when crystallized alone or in complex with NKG2D.
Natural killer (NK) cells attack many tumour cell lines, and are thought to have a critical role in anti-tumour immunity; however, the interaction between NK cells and tumour targets is poorly understood. The stimulatory lectin-like NKG2D receptor is expressed by NK cells, activated CD8+ T cells and by activated macrophages in mice. Several distinct cell-surface ligands that are related to class I major histocompatibility complex molecules have been identified, some of which are expressed at high levels by tumour cells but not by normal cells in adults. However, no direct evidence links the expression of these 'induced self' ligands with tumour cell rejection. Here we demonstrate that ectopic expression of the murine NKG2D ligands Rae1beta or H60 in several tumour cell lines results in potent rejection of the tumour cells by syngeneic mice. Rejection is mediated by NK cells and/or CD8+ T cells. The ligand-expressing tumour cells induce potent priming of cytotoxic T cells and sensitization of NK cells in vivo. Mice that are exposed to live or irradiated tumour cells expressing Rae1 or H60 are specifically immune to subsequent challenge with tumour cells that lack NKG2D ligands, suggesting application of the ligands in the design of tumour vaccines.
The localization of γδ T cells within epithelia suggests that these cells may contribute to the down-regulation of epithelial
malignancies. We report that mice lacking γδ cells are highly susceptible to multiple regimens of cutaneous carcinogenesis.
After exposure to carcinogens, skin cells expressed Rae-1 and H60, major histocompatibility complex–related molecules structurally
resembling human MICA. Each of these is a ligand for NKG2d, a receptor expressed by cytolytic T cells and natural killer (NK)
cells. In vitro, skin-associated NKG2d+ γδ cells killed skin carcinoma cells by a mechanism that was sensitive to blocking NKG2d engagement. Thus, local T cells
may use evolutionarily conserved proteins to negatively regulate malignancy.
CD4, a member of the immunoglobulin superfamily of receptors that mediates cell-cell interactions in the immune system, is the primary receptor for HIV-1. The extracellular portion of CD4 is a concatenation of four immunoglobulin-like domains, D1 to D4. The D1, D2 and D4 domains each contain a disulfide bond. We show here that the D2 disulfide bond is redox-active. The redox state of the thiols (disulfide versus dithiol) appeared to be regulated by thioredoxin, which is secreted by CD4(+) T cells. Locking the CD4 and the thioredoxin active-site dithiols in the reduced state with a hydrophilic trivalent arsenical blocked entry of HIV-1 into susceptible cells. These findings indicate that redox changes in CD4 D2 are important for HIV-1 entry and represent a new target for HIV-1 entry inhibitors.
We previously reported that monoclonal antibodies to protein-disulfide isomerase (PDI) and other membrane-impermeant PDI inhibitors prevented HIV-1 infection. PDI is present at the surface of HIV-1 target cells and reduces disulfide bonds in a model peptide attached to the cell membrane. Here we show that soluble PDI cleaves disulfide bonds in recombinant envelope glycoprotein gp120 and that gp120 bound to the surface receptor CD4 undergoes a disulfide reduction that is prevented by PDI inhibitors. Concentrations of inhibitors that prevent this reduction and inhibit the cleavage of surface-bound disulfide conjugate prevent infection at the level of HIV-1 entry. The entry of HIV-1 strains differing in their coreceptor specificities is similarly inhibited, and so is the reduction of gp120 bound to CD4 of coreceptor-negative cells. PDI inhibitors also prevent HIV envelope-mediated cell-cell fusion but have no effect on the entry of HIV-1 pseudo-typed with murine leukemia virus envelope. Importantly, PDI coprecipitates with both soluble and cellular CD4. We propose that a PDI.CD4 association at the cell surface enables PDI to reach CD4-bound virus and to reduce disulfide bonds present in the domain of gp120 that binds to CD4. Conformational changes resulting from the opening of gp120-disulfide loops may drive the processes of virus-cell and cell-cell fusion. The biochemical events described identify new potential targets for anti-HIV agents.
The process of disulphide bond formation in the endoplasmic reticulum of eukaryotic cells was one of the first mechanisms of catalysed protein folding to be discovered. Protein disulphide isomerase (PDI) is now known to catalyse all of the reactions that are involved in native disulphide bond formation, but despite more than 40 years of study, its mechanism of action is still not fully understood. This review discusses recent advances in our understanding of the human PDI family of enzymes and focuses on their functional properties, substrate interactions and some recently identified family members.
Some stimulatory receptors of the innate immune system, such as the NKG2D receptor (also called KLRK1) expressed by natural killer cells and activated CD8(+)T cells, recognize self-molecules that are upregulated in diseased cells by poorly understood mechanisms. Here we show that mouse and human NKG2D ligands are upregulated in non-tumour cell lines by genotoxic stress and stalled DNA replication, conditions known to activate a major DNA damage checkpoint pathway initiated by ATM (ataxia telangiectasia, mutated) or ATR (ATM- and Rad3-related) protein kinases. Ligand upregulation was prevented by pharmacological or genetic inhibition of ATR, ATM or Chk1 (a downstream transducer kinase in the pathway). Furthermore, constitutive ligand expression by a tumour cell line was inhibited by targeting short interfering RNA to ATM, suggesting that ligand expression in established tumour cells, which often harbour genomic irregularities, may be due to chronic activation of the DNA damage response pathway. Thus, the DNA damage response, previously shown to arrest the cell cycle and enhance DNA repair functions, or to trigger apoptosis, may also participate in alerting the immune system to the presence of potentially dangerous cells.
Upregulation of the inducible gene products MICA (human) and Rae-1 (mouse) may promote tumor surveillance and autoimmunity by engaging the activating receptor NKG2D on natural killer (NK) cells and T cells. Nevertheless, sustained expression of MICA by tumors can also elicit NKG2D downregulation, perhaps indicating 'immunoevasion'. Investigating this paradox, we report here that constitutive Rae-1epsilon transgene expression in normal epithelium elicited local and systemic NKG2D downregulation, generalized but reversible defects in NK cell-mediated cytotoxicity and mild CD8(+) T cell defects. The extent of NKG2D downregulation correlated well with the incidence and progression of cutaneous carcinogenesis, emphasizing the utility of NKG2D as a marker of tumor resistance. Thus, NKG2D engagement is a natural mediator of immunosurveillance, which can be compromised by locally sustained ligand expression but potentially restored by innate immune activation.
The activation NKG2D receptor has been shown to play an important role in the control of experimental tumor growth and metastases expressing ligands for NKG2D; however, a function for this recognition pathway in host protection from de novo tumorigenesis has never been demonstrated. We show that neutralization of NKG2D enhances the sensitivity of wild-type (WT) C57BL/6 and BALB/c mice to methylcholanthrene (MCA)-induced fibrosarcoma. The importance of the NKG2D pathway was additionally illustrated in mice deficient for either IFN-gamma or tumor necrosis factor-related apoptosis-inducing ligand, whereas mice depleted of natural killer cells, T cells, or deficient for perforin did not display any detectable NKG2D phenotype. Furthermore, IL-12 therapy preventing MCA-induced sarcoma formation was also largely dependent on the NKG2D pathway. Although NKG2D ligand expression was variable or absent on sarcomas emerging in WT mice, sarcomas derived from perforin-deficient mice were Rae-1(+) and immunogenic when transferred into WT syngeneic mice. These findings suggest an important early role for the NKG2D in controlling and shaping tumor formation.
CD4 is a coreceptor for binding of T cells to APC and the primary receptor for HIV. The disulfide bond in the second extracellular domain (D2) of CD4 is reduced on the cell surface, which leads to formation of disulfide-linked homodimers. A large conformational change must take place in D2 to allow for formation of the disulfide-linked dimer. Domain swapping of D2 is the most likely candidate for the conformational change leading to formation of two disulfide-bonds between Cys130 in one monomer and Cys159 in the other one. Mild reduction of the extracellular part of CD4 resulted in formation of disulfide-linked dimers, which supports the domain-swapped model. The functional significance of dimer formation for coreceptor function was tested using cells expressing wild-type or disulfide-bond mutant CD4. Eliminating the D2 disulfide bond markedly impaired CD4's coreceptor function. Modeling of the complex of the TCR and domain-swapped CD4 dimer bound to class II MHC and Ag supports the domain-swapped dimer as the immune coreceptor. The known involvement of D4 residues Lys318 and Gln344 in dimer formation is also accommodated by this model. These findings imply that disulfide-linked dimeric CD4 is the preferred coreceptor for binding to APC.
Tumor-associated ligands of the activating NKG2D receptor can effectively stimulate T cell responses at early but not late stages of tumor growth. In late-stage human tumor settings, we observed MIC-driven proliferation of NKG2D(+)CD4(+) T cells that produced the cytokine Fas ligand (FasL) as a result of NKG2D costimulation but were themselves protected from Fas-mediated growth arrest. In contrast, FasL suppressed proliferation of T cells in vitro that did not receive NKG2D costimulation. Similar observations with normal peripheral blood NKG2D(+)CD8(+) T cells demonstrated unrecognized NKG2D-mediated immune functions, whereby FasL release promotes tumor cell death and NKG2D costimulation prolongs T cell survival. These effects, beneficial in conditions of limited NKG2D ligand expression, may be counterweighed when massive expression and shedding of MIC occurs, such as in some late-stage tumors, that causes sustained NKG2D costimulation and population expansion of immunosuppressive T cells.
The activation of NKG2D on innate and adaptive cytotoxic lymphocytes contributes to immune-mediated tumor destruction. Nonetheless, tumor cell shedding of NKG2D ligands, such as MHC class I chain-related protein A (MICA), results in immune suppression through down-regulation of NKG2D surface expression. Here we show that some patients who respond to antibody-blockade of cytotoxic T lymphocyte-associated antigen 4 or vaccination with lethally irradiated, autologous tumor cells engineered to secrete granulocyte–macrophage colony-stimulating factor generate high titer antibodies against MICA. These humoral reactions are associated with a reduction of circulating soluble MICA (sMICA) and an augmentation of natural killer (NK) cell and CD8⁺ T lymphocyte cytotoxicity. The immunotherapy-induced anti-MICA antibodies efficiently opsonize cancer cells for dendritic cell cross-presentation, which is correlated with a diversification of tumor antigen recognition. The anti-MICA antibodies also accomplish tumor cell lysis through complement fixation. Together, these findings establish a key role for the NKG2D pathway in the clinical activity of cytotoxic T lymphocyte-associated antigen 4 antibody blockade and granulocyte–macrophage colony-stimulating factor secreting tumor cell vaccines. Moreover, these results highlight the therapeutic potential of anti-MICA antibodies to overcome immune suppression and effectuate tumor destruction in patients.
• NKG2D
• cytotoxic T lymphocyte-associated antigen 4
• granulocyte-macrophage colony-stimulating factor
• antibody
Cell-surface tissue factor (TF) binds the serine protease factor VIIa to activate coagulation or, alternatively, to trigger signaling through the G protein-coupled, protease-activated receptor 2 (PAR2) relevant to inflammation and angiogenesis. Here we demonstrate that TF·VIIa-mediated coagulation and cell signaling involve distinct cellular pools of TF. The surface-accessible, extracellular Cys¹⁸⁶–Cys²⁰⁹ disulfide bond of TF is critical for coagulation, and protein disulfide isomerase (PDI) disables coagulation by targeting this disulfide. A TF mutant (TF C209A) with an unpaired Cys¹⁸⁶ retains TF·VIIa signaling activity, and it has reduced affinity for VIIa, a characteristic of signaling TF on cells with constitutive TF expression. We further show that PDI suppresses TF coagulant activity in a nitric oxide-dependent pathway, linking the regulation of TF thrombogenicity to oxidative stress in the vasculature. Furthermore, a unique monoclonal antibody recognizes only the noncoagulant, cryptic conformation of TF. This antibody inhibits formation of the TF·PAR2 complex and TF·VIIa signaling, but it does not prevent coagulation activation. These experiments delineate an upstream regulatory mechanism that controls TF function, and they provide initial evidence that TF·VIIa signaling can be specifically inhibited with minimal effects on coagulation.
• allosteric disulfide
• protein disulfide
• isomerase
• S-nitrosylation
• G protein-coupled receptor
Evasion of host immune responses is well documented for viruses and may also occur during tumor immunosurveillance. The mechanisms involve alterations in MHC class I expression, Ag processing and presentation, chemokine and cytokine production, and lymphocyte receptor expression. Epithelial tumors overexpress MHC class I chain-related (MIC) molecules, which are ligands for the activating receptor NKG2D on NK and T cells. We report that NK cells from patients with colorectal cancer lack expression of activating NKG2D and chemokine CXCR1 receptors, both of which are internalized. Serum levels of soluble MIC (sMIC) are elevated and are responsible for down-modulation of NKG2D and CXCR1. In contrast, high serum levels of CXC ligands, IL-8, and epithelial-neutrophil-activating peptide (ENA-78) do not down-modulate CXCR1. In vitro, internalization of NKG2D and CXCR1 occurs within 4 and 24 h, respectively, of incubating normal NK cells with sMIC-containing serum. Furthermore, natural cytotoxicity receptor NKp44 and chemokine receptor CCR7 are also down-modulated in IL-2-activated NK cells cocultured in MIC-containing serum-an effect secondary to the down-modulation of NKG2D and not directly caused by physical association with sMIC. The patients' NK cells up-regulate expression of NKG2D, NKp44, CXCR1, and CCR7 when cultured in normal serum or anti-MIC Ab-treated autologous serum. NKG2D(+) but not NKG2D(-) NK cells are tumoricidal in vitro, and in vivo they selectively traffic to the xenografted carcinoma, form immunological synapse with tumor cells, and significantly retard tumor growth in the SCID mice. These results suggest that circulating sMIC in the cancer patients deactivates NK immunity by down-modulating important activating and chemokine receptors.
Conventional major histocompatibility complex (MHC) class I genes encode molecules that present intracellular peptide antigens to T cells. They are ubiquitously expressed and regulated by interferon gamma. Two highly divergent human MHC class I genes, MICA and MICB, are regulated by promoter heat shock elements similar to those of HSP70 genes. MICA encodes a cell surface glycoprotein, which is not associated with beta 2-microglobulin, is conformationally stable independent of conventional class I peptide ligands, and almost exclusively expressed in gastrointestinal epithelium. Thus, this MHC class I molecule may function as an indicator of cell stress and may be recognized by a subset of gut mucosal T cells in an unusual interaction.
The major histocompatibility complex (MHC) class I homolog MIC-A functions as a stress-inducible antigen that is recognized by a subset of gammadelta T cells independent of beta2-microglobulin and bound peptides. Its crystal structure reveals a dramatically altered MHC class I fold, both in detail and overall domain organization. The only remnant of a peptide-binding groove is a small cavity formed as the result of disordering a large section of one of the groove-defining helices. Loss of beta2-microglobulin binding is due to a restructuring of the interaction interfaces. Structural mapping of sequence variation suggests potential receptor binding sites on the underside of the platform on the side opposite of the surface recognized by alphabeta T cell receptors on MHC class I-peptide complexes.
Native protein disulfide bond formation in the endoplasmic reticulum (ER) requires protein disulfide isomerase (PDI) and Ero1p. Here we show that oxidizing equivalents flow from Ero1p to substrate proteins via PDI. PDI is predominantly oxidized in wild-type cells but is reduced in an ero1-1 mutant. Direct dithiol-disulfide exchange between PDI and Ero1p is indicated by the capture of PDI-Ero1p mixed disulfides. Mixed disulfides can also be detected between PDI and the ER precursor of carboxypeptidase Y (CPY). Further, PDI1 is required for the net formation of disulfide bonds in newly synthesized CPY, indicating that PDI functions as an oxidase in vivo. Together, these results define a pathway for protein disulfide bond formation in the ER. The PDI homolog Mpd2p is also oxidized by Ero1p.
The human cytomegalovirus glycoprotein, UL16, binds to two members of a novel family of molecules, the ULBPs, and to the MHC class I homolog, MICB. The ULBPs are GPI-linked glycoproteins belonging to the extended MHC class I family but are only distantly related to MICB. The ULBP and MICB molecules are ligands for the activating receptor, NKG2D/DAP10, and this interaction is blocked by a soluble form of UL16. The ULBPs stimulate cytokine and chemokine production from NK cells, and expression of ULBPs in NK cell-resistant target cells confers susceptibility to NK cell cytotoxicity. Masking of NK cell recognition of ULBP or MIC antigens by UL16 provides a potential mechanism by which human cytomegalovirus-infected cells might evade attack by the immune system.
In 1986, Kärre and colleagues reported that natural killer (NK) cells rejected an MHC class I-deficient tumor cell line (RMA-S) but they did not reject the same cell line if it expressed MHC class I (RMA). Based on this observation, they proposed the concept that NK cells provide immune surveillance for "missing self," e.g., they eliminate cells that have lost class I MHC antigens. This seminal observation predicted the existence of inhibitory NK cell receptors for MHC class I. Here, we present evidence that NK cells are able to reject tumors expressing MHC class I if the tumor expresses a ligand for NKG2D. Mock-transfected RMA cells resulted in tumor formation. In contrast, when RMA cells were transfected with the retinoic acid early inducible gene-1 gamma or delta (RAE-1), ligands for the activating receptor NKG2D, the tumors were rejected. The tumor rejection was mediated by NK cells, and not by CD1-restricted NK1.1(+) T cells. No T cell-mediated immunological memory against the parental tumor was generated in the animals that had rejected the RAE-1 transfected tumors, which succumbed to rechallenge with the parental RMA tumor. Therefore, NK cells are able to reject a tumor expressing RAE-1 molecules, despite expression of self MHC class I on the tumor, demonstrating the potential for NK cells to participate in immunity against class I-bearing malignancies.
Human P5 (hP5) was expressed in the Escherichia coli pET system and purified by sequential Ni(2+)-chelating resin column chromatography. Characterization of purified hP5 indicated that it has both isomerase and chaperone activities, but both activities are lower than those of human protein disulfide isomerase (PDI). Moreover, hP5 was observed to have peptide-binding ability, and its chaperone activity was confirmed with rhodanese and citrate synthase as substrates, but not with D-glyceraldehyde-3-phosphate dehydrogenase, showing that hP5 has substrate specificity with respect to chaperone activity. Mutation of two thioredoxin-related motifs in hP5 revealed that the first motif is more important than the second for isomerase activity and that the first cysteine in each motif is necessary for isomerase activity. Since thioredoxin motif mutants lacking isomerase activity retain chaperone activity with the substrate citrate synthase, the isomerase and chaperone activities of hP5 are probably independent, as was shown for PDI.
The immunoreceptor NKG2D stimulates tumor immunity through activation of CD8 T cells and NK cells. Its ligand MICA has been shown to be broadly expressed on human tumors of epithelial origin. MICA expression correlates with an enrichment of Vdelta1 T cells in tumor tissue. We report that human tumor cells spontaneously release a soluble form of MICA encompassing the three extracellular domains, which is present at high levels in sera of patients with gastrointestinal malignancies, but not in healthy donors. Release of MICA from tumor cells is blocked by inhibition of metalloproteinases, concomitantly causing accumulation of MICA on the cell surface. Shedding of MICA by tumor cells may modulate NKG2D-mediated tumor immune surveillance. In addition, determination of soluble MICA levels may be implemented as an immunological diagnostic marker in patients with epithelial malignancies.
Protein disulfide isomerases (PDIs) constitute a family of structurally related enzymes which catalyze disulfide bonds formation, reduction, or isomerization of newly synthesized proteins in the lumen of the endoplasmic reticulum (ER). They act also as chaperones, and are, therefore, part of a quality-control system for the correct folding of the proteins in the same subcellular compartment. While their functions in the ER have been thoroughly studied, much less is known about their roles in non-ER locations, where, however, they have been shown to be involved in important biological processes. At least three proteins of this family from higher vertebrates have been found in unusual locations (i.e., the cell surface, the extracellular space, the cytosol, and the nucleus), reached through an export mechanism which has not yet been understood. In some cases their function in the non-ER location is clearly related to their redox properties, but in most cases their mechanism of action has still to be disclosed, although their propensity to associate with other proteins or even with DNA might be the main factor responsible for their activities.
Engagement of the NKG2D receptor by tumour-associated ligands may promote tumour rejection by stimulating innate and adaptive lymphocyte responses. In humans, NKG2D is expressed on most natural killer cells, gammadelta T cells and CD8alphabeta T cells. Ligands of NKG2D include the major histocompatibility complex class I homologues MICA and MICB, which function as signals of cellular stress. These molecules are absent from most cells and tissues but can be induced by viral and bacterial infections and are frequently expressed in epithelial tumours. MIC engagement of NKG2D triggers natural killer cells and costimulates antigen-specific effector T cells. Here we show that binding of MIC induces endocytosis and degradation of NKG2D. Expression of NKG2D is reduced markedly on large numbers of tumour-infiltrating and matched peripheral blood T cells from individuals with cancer. This systemic deficiency is associated with circulating tumour-derived soluble MICA, causing the downregulation of NKG2D and in turn severe impairment of the responsiveness of tumour-antigen-specific effector T cells. This mode of T-cell silencing may promote tumour immune evasion and, by inference, compromise host resistance to infections.
The NKG2D-DAP10 receptor complex activates natural killer (NK) cells and costimulates effector T cell subsets upon engagement of ligands that can be conditionally expressed under physiologically harmful conditions such as microbial infections and malignancies. These characteristics have given rise to the widely embraced concept of immunorecognition of "induced or damaged self," complementing the "missing self" paradigm that is represented by MHC class I allotypes and their interactions with inhibitory receptors on NK cells. However, this notion may only be partially sustainable, as various patterns of constitutive tissue distributions have become apparent among members of one NKG2D ligand family. This review summarizes the biological properties of NKG2D and its ligands and discusses the interactions and regulation of these molecules with emphasis of their significance in microbial infections, tumor immunology, and autoimmune disease.
An emerging concept is that disulfide bonds can act as a dynamic scaffold to present mature proteins in different conformational and functional states on the cell surface. Two examples are the conversion of the receptor, integrin alphaIIbbeta3, from a low affinity to a high affinity state, and the interaction of CD4 receptor with the HIV-1 envelope glycoprotein gp120 to promote virus-cell fusion. In both of these cases there is a remodeling of the protein disulfide bonding pattern. The formation and rearrangement of disulfide bonds is modulated by a family of enzymes known as the thiol isomerases, which include protein disulfide isomerase (PDI), ERp5, ERp57, and ERp72. While these enzymes were reported originally to be restricted in location to the endoplasmic reticulum, in some cells thiol isomerases are found on the cell surface. This may indicate a wider role for these enzymes in cell function. In platelets it has been shown that reagents that react with cell surface sulfhydryl groups are capable of blocking a number of functional responses, including integrin-mediated aggregation, adhesion, and granule secretion. Furthermore, the use of function blocking antibodies to either PDI or ERp5 causes inhibition of these functional responses. This review summarizes current knowledge of the extracellular regulation of disulfide exchange and the implications of this in the regulation of cell function.
Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium
- V Groh
Groh, V. et al. Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium. Proc. Natl Acad. Sci. USA 93, 12445–12450 (1996).
Gafkan for mass spectrometry analyses; K. Smythe for technical assistance; and S. Riddell for comments on the manuscript. This work was supported by the Cancer Research Institute
- M Welcker
- W Sirna
- P Lane
M. Welcker for help with siRNA expression; W. Lane and P. Gafkan for mass spectrometry analyses; K. Smythe for technical assistance; and S. Riddell for comments on the manuscript. This work was supported by the Cancer Research Institute (B.K.K.), the Spanish Fondo de Investigaciones Sanitarias (S.G.), the Deutsche Forschungsgemeinschaft (H.H.M.), the Edson Fund, the Avon Foundation Breast Cancer Immunotherapy Research Initiative, and by grants from the NIH. 567 were GATCTTGTTGTCAAAGTTGGTGCAGTTGTCTTCTTCTCAACTG-CACCAACTTTGACAACATTTTTG and AATTCAAAAATGTTGTCAAAG-TTGGTGCAGTTGAGAAGAAGACAACTGCACCAACTTTGACAACAA, and GATCTTGATAGTTCAAGTAAGAAGGATGTCTTCTTCTCATCCTTCTTA-CTTGAACTATCATTTTTG and AATTCAAAAATGATAGTTCAAGTAAGA-AGGATGAGAAGAAGACATCCTTCTTACTTGAACTATAA, respectively (all 59–39;
Evasion from NK cell immunity by MHC class I chain-related molecules expressing colon carcinoma
- E S Doubrovina
- ES Doubrovina