Content uploaded by Jacob Samuel Berv
Author content
All content in this area was uploaded by Jacob Samuel Berv on Jan 15, 2015
Content may be subject to copyright.
Volume 132, 2015, pp. 248–264
DOI: 10.1642/AUK-14-108.1
RESEARCH ARTICLE
Divergence in morphology, calls, song, mechanical sounds, and genetics
supports species status for the Inaguan hummingbird (Trochilidae:
Calliphlox ‘‘evelynae’’ lyrura)
Teresa J. Feo,* Jacob M. Musser, Jacob Berv,
a
and Christopher James Clark
b
Department of Ecology and Evolutionary Biology, and Peabody Museum of Natural History, Yale University, New Haven, Connecticut,
USA
a
Current address: Department of Ecology and Evolutionary Biology, and Cornell Laboratory of Ornithology, Cornell University,
Ithaca, New York, USA
b
Current address: Department of Biology, University of California, Riverside, California, USA
*Corresponding author: teresa.feo@yale.edu
Submitted May 13, 2014; Accepted October 5, 2014; Published December 17, 2014
ABSTRACT
The Bahama Woodstar (Calliphlox evelynae), a hummingbird endemic to the Bahama Archipelago, comprises two
currently recognized subspecies: Calliphlox e. evelynae, found throughout the Bahamas and in the Turks and Caicos
Islands, except on Great and Little Inagua; and C. e. lyrura, named for its unique, lyre-shaped outer tail feathers and
found only on the islands of Great and Little Inagua. The two were originally described as separate species, partly on
the basis of their divergent tail morphology, but were subsequently lumped by Peters (1945). These taxa are members
of the North American ‘‘bee’’ hummingbird clade, which produce mechanical sounds with their tails during courtship
displays. Changes in tail shape may produce significant acoustic divergence. To determine the extent of differentiation
between lyrura and evelynae, we collected field recordings of calls, songs, and courtship displays from New Providence
and Great Inagua islands and surveyed morphological variation across the archipelago. We sequenced 4 nuclear loci
and 2 mitochondrial genes from 9 individuals of evelynae and 6 individuals of lyrura. Both sexes of lyrura and evelynae
can be diagnosed by vocal calls, and males can be diagnosed by morphology, song, and courtship display.
Phylogenetic reconstructions based on the genetic data indicate that the 2 populations are reciprocally monophyletic
and that they diverged ~0.69 mya. Our data indicate that lyrura is a unique evolutionary lineage that warrants species
status under both the phylogenetic and the biological species concept.
Keywords: Bahamas, Calliphlox evelynae lyrura, courtship, display dive, sonation, taxonomy
Las divergencias en morfolog´
ıa, llamados, canto, sonidos meca
´nicos y gen ´
etica apoyan el status de
especie de Calliphlox ‘‘evelynae’’ lyrura (Trochilidae)
RESUMEN
Calliphlox evelynae es un picaflor end´
emico del archipi´
elago de Bahamas e incluye dos taxa reconocidos actualmente
como subespecies. Calliphlox e. evelynae se encuentra a lo largo de las Bahamas y Turks y Caicos, excepto en Gran y
Peque ˜
na Inagua. Calliphlox e. lyrura se encuentra solo en las islas de Gran y Peque ˜
na Inagua, y debe su nombre a las
plumas externas de la cola ´
unicas con forma de lira. En parte basada en la morfolog´
ıa divergente de sus colas, evelynae
ylyrura fueron descriptas originalmente como especies separadas, pero fueron agrupadas subsecuentemente por
Peters (1945). Estos dos taxa son miembros del clado de picaflores ‘‘ abeja’’ de Am ´
erica del Norte, que producen
sonidos meca
´nicos con sus colas durante los despliegues de cortejo. Los cambios en la forma de la cola pueden
producir una divergencia ac ´
ustica significativa. Para determinar el grado de diferenciaci ´
on entre lyrura yevelynae,
colectamos registros de campo de llamados, cantos y despliegues de cortejo en Nueva Providencia y Gran Inagua, y
estudiamos la variaci ´
on morfol ´
ogica a trav´
es del archipi´
elago. Secuenciamos cuatro loci nucleares y dos genes
mitocondriales de nueve individuos de evelynae y de seis individuos de lyrura. Ambos sexos de lyrura yevelynae
pueden ser diagnosticados por las llamadas vocales, y los machos pueden ser diagnosticados por la morfolog´
ıa, el
canto y el despliegue de cortejo. Las reconstrucciones filogen´
eticas basadas en los datos gen´
eticos indican que las dos
poblaciones son rec´
ıprocamente monofil´
eticas, y se separaron hace aproximadamente 0,69 millones de a ˜
nos. Nuestros
datos indican que lyrura es un linaje evolutivo ´
unico que justifica el estatus de especie bajo los conceptos de especie
filogen´
etico o biol ´
ogico.
Palabras clave: Bahamas, Calliphlox evelynae lyrura, cortejo, exhibici ´
on de buceo, sonaci ´
on, taxonom´
ıa
Q2015 American Ornithologists’ Union. ISSN 0004-8038, electronic ISSN 1938-4254
Direct all requests to reproduce journal content to the Central Ornithology Publication Office at aoucospubs@gmail.com
INTRODUCTION
Island archipelagos play an important role in avian
speciation because isolation can restrict gene flow among
different island populations. The West Indies, in particular,
have served as a focal point for studies of diversification in
the wood warblers (Lovette et al. 1998, Klein et al. 2004,
Markland and Lovette 2005) and other avian taxa
(Bellemain et al. 2008, Garrido et al. 2009). Within the
West Indies, the Bahama Archipelago, which includes the
islands of the Bahamas and the Turks and Caicos (Figure
1), has been the focus of evolutionary investigation. Studies
examining variation within Yellow-throated Warbler (Se-
tophaga dominica; McKay et al. 2010), Brown-headed
Nuthatch (Sitta pusilla; Hayes et al. 2004), Cuban Parrot
(Amazona leucocephala; Reynolds and Hayes 2009,
Russello et al. 2010), and Greater Antillean Oriole (Icterus
dominicensis; Price and Hayes 2009) have all found
Bahamian island populations to be distinct from those
on the mainland or on other islands in the West Indies.
Furthermore, the Bahamas harbor distinct subspecies
among different islands within the archipelago. Examples
include the endemic Bahama Woodstar (Calliphlox
evelynae; Gill and Donsker 2013) and subspecies of
broader-ranging Caribbean taxa such as Cuban Parrot,
Thick-billed Vireo (Vireo crassirostris; Buden 1985), and
Greater Antillean Bullfinch (Loxigilla violacea; Buden
1987). Bahamian populations all exhibit a similar pattern
FIGURE 1. Distribution of the Bahama Woodstar populations Calliphlox evelynae evelynae (red and orange) and C. e. lyrura (blue). We
took morphological measurements of males from islands shaded red or blue; orange shading indicates islands for which we lacked
male evelynae morphological data. Labeled points on New Providence (lower left insert) and Great Inagua correspond to localities of
sound and video recordings (WB ¼West Bay Street, PW ¼pine woodland, CH ¼Coral Harbor neighborhoods, BR ¼Borris Road, and
MT ¼Matthew Town). Photographs of males courtesy of Anand Varma; note presence of irridescent feathers on forecrown and
elongated tail in lyrura. Base map modified from Curran and White (1995).
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 249
of geographic variation: One or more subspecies are
restricted to a southern island, and an additional
subspecies ranges across one or more northern islands.
This distributional pattern is likely due, in part, to the
complex geological history of the Bahama Archipelago.
The majority of the northern islands are situated on either
the Great or Little Bahama Bank, whereas most of the
southern islands are each situated on their own separate
banks (Figure 1; Carew and Mylroie 1995). Over the past
2.5 Ma, fluctuations in sea level driven by Pleistocene
glacial cycling have resulted in periods during which the
Great and Little Bahama Banks were exposed, uniting the
majority of northern islands into 2 large land masses
(Carew and Mylroie 1995). By contrast, southern islands
during these periods of sea-level minima remained isolated
on their separate banks (Buden 1987, Carew and Mylroie
1995). This complex history of island size fluctuation may
have reproductively isolated bird populations on different
Bahamian islands.
The Bahama Woodstar (Calliphlox evelynae), a member
of the North American branch of the ‘‘ bee’’ hummingbird
clade, is endemic to the islands of the Bahamas and the
Turks and Caicos (Cory 1880, Ridgway 1911, Bond 1936,
McGuire et al. 2007, 2014). There are currently 2
recognized subspecies: C. e. evelynae (Bourcier 1847) and
C. e. lyrura (Gould 1869). Calliphlox e. lyrura is restricted
to the southern islands of Great and Little Inagua, whereas
evelynae is found throughout the remaining islands in the
archipelago (Figure 1). Calliphlox e. lyrura was originally
described as a distinct species from evelynae on the basis of
its diagnostic morphology (Bourcier 1847, Gould 1869,
Cory 1880, 1918, Ridgway 1911, Bond 1936). These 2 taxa
were treated as distinct species in all accounts until 1945,
when they were lumped in the Check-list of Birds of the
World by Peters (1945). A third form, C. e. salita—
described by Greenway (1936) as a subspecies of C.
evelynae from the Turks and Caicos—is no longer
recognized.
The 2 primary characters used to diagnose lyrura from
evelynae were the presence of iridescent feathers on the
forehead and the shape of the elongated, outwardly
curving, outer tail feathers (Figure 1; Bourcier 1847, Gould
1869, Cory 1880). Taxonomists have placed heavy weight
on both tail morphology and iridescent gorget colors in
diagnosing discrete hummingbird lineages (Mulsant and
Verraux 1866, Gould 1869, Stiles 1972, 1983).
Iridescent gorget feathering and tail-feather shape both
appear to play a role in sexual selection and mate choice.
Iridescent feathers are erected and oriented toward
females during displays, whereas tail feathers produce
species-specific sounds (Clark and Feo 2008, 2010, Feo and
Clark 2010, Clark 2011, Clark et al. 2011, 2013c). During a
display dive, airflow causes the feather to vibrate and
produce tonal sound. Pitch is set in part by the feather’s
shape, but the effect of shape change on sound is not easy
to predict on the basis of morphology alone. Small changes
in feather shape can result in changes in a feather’s mode
of flutter that produce changes in sound (Clark and Feo
2010, Clark et al. 2011, 2012, 2013a, 2013b).
The diversity in tail morphology among bee humming-
birds is likely the result of sexual selection on acoustic
elements of male courtship displays (Clark 2010). As with
many other species of bee hummingbird, differences in
tail-feather morphology and iridescent plumage between
evelynae and lyrura may indicate reproductive isolation.
We investigated the degree to which populations of
evelynae and lyrura have diverged in morphology,
courtship displays, vocalizations, and genetics. We use
these data to reevaluate the species status of lyrura.
METHODS
We observed evelynae on New Providence island, Baha-
mas, during December 4–10, 2009, and March 3–8, 2012
(Figure 1). We studied individuals in a variety of habitats
across the island, including Caribbean pine (Pinus
caribaea) woodland south of the airport (Figure 1: PW;
25.0168N, 77.4518W) and residential neighborhoods in
Coral Harbor on the southwest coast (CH; 24.9828N,
77.4618W), Fort Winton on the northeast coast (FW;
25.0438N, 77.2668W), and West Bay Street on the
northwest coast (WB; 25.0558038N, 77.500168W). We
observed and recorded lyrura on Great Inagua in and just
east of Matthew Town (Figure 1: MT; 20.9508N,
73.6758W), during February 24–March 2 and October
29–November 2, 2012. Specimens from both populations
were collected in 2012 and deposited at the Yale Peabody
Museum (Appendix Table 4).
Morphology
We measured the length of rectrix 1 (R1), rectrix 5 (R5),
exposed culmen, and folded wing chord on individuals
captured in the field and on study skins from the Yale
Peabody Museum (YPM), Museum of Comparative
Zoology (MCZ), Field Museum of Natural History
(FMNH), and American Museum of Natural History
(AMNH). We performed a discriminant function analysis
(with prior probabilities computed from group size) and t-
tests to test for significant morphological differences
between adult male, immature male, and female evelynae
and lyrura. Mass was measured from individuals that we
captured in the field, and hovering wingbeat frequency was
measured from high-speed video.
Courtship Displays and Vocalizations
We recorded video and audio of courtship displays that
were incidental or solicited by placing a female in a cage on
a male’s territory (Clark et al. 2012). Audio recordings were
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
250 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
made with a 24-bit recorder (Sound Devices 702).
Recordings were made with shotgun microphone (Senn-
heiser MHK70) sampling at 48 kHz in 2009, or with a
Sennheiser MKH 20 microphone in a Telinga Pro
Universal Parabola sampled at 96 kHz in 2012. Sounds
were analyzed in Raven version 1.4 (see Acknowledg-
ments) and converted into spectrograms using a 512-
sample Hann window function and 50% overlap for
recordings sampled at 48 kHz, and a 1,024-sample Hann
window for recordings sampled at 96 kHz. High-speed
videos of courtship displays were obtained with a
monochrome and color MIRO EX4 high-speed cameras
(Vision Research, Wayne, New Jersey, USA) recording at
500 and 1,265 frames s
1
(800 3600 pixel resolution).
Feather Acoustics
Outer tail feathers (R5) from adult male evelynae and
lyrura were tested in a wind tunnel to determine their
capacity to produce sound (sensu Clark et al. 2013a). We
mounted feathers in the airflow and recorded sound
produced over a range of airspeeds from 10 to 20 ms
1
,
which bracket the likely speeds traveled during a dive. The
feathers were filmed at 23,121 frames s
1
to reveal which
part fluttered to produce sound.
DNA Extraction, PCR, and Sequencing
Total genomic DNA was isolated from 6 lyrura,7evelynae,
and 1 each of Lucifer Hummingbird (Calothorax lucifer)
and Slender Sheartail (Doricha enicura) using a QIAGEN
DNeasy extraction kit (Appendix Table 4). We collected
new DNA sequence data for 4 nuclear loci and 2
mitochondrial genes (Appendix Table 5): fibrinogen beta
chain intron 7 (FGB I7), adenylate kinase 1 intron 5 (AK1
I5), ornithine decarboxylase 1 introns 6 and 7 with
intervening exon (ODC1), Z-linked muscle, skeletal,
receptor tyrosine kinase intron 3 (MUSK I3), mitochon-
drially encoded NADH dehydrogenase 2 (MT-ND2), and
mitochondrially encoded NADH dehydrogenase 4 and
flanking leucine tRNA (MT-ND4). These regions were
amplified using standard polymerase chain reaction (PCR)
protocols and sequenced at the DNA Analysis Facility on
Science Hill at Yale University. All sequence data are
deposited in NCBI GenBank (accession nos. KP136320–
KP136422).
Population Genetics
We calculated several measures of genetic diversity within
populations of evelynae from New Providence and lyrura
from Great Inagua using the program DnaSP (Librado and
Rozas 2009), including haplotype diversity (H
d
; Nei 1987),
nucleotide diversity (p; Nei 1987), Watterson’s estimate of
population mutation rate per site (h
w
; Watterson 1975, Nei
1987), and average number of nucleotide differences
among sequences (Tajima 1983). These measures were
calculated for each locus and population. We also
investigated genetic divergence between the 2 populations
by calculating the number of fixed differences (Hey 1991)
and average number of nucleotide substitutions per site
(Nei 1987) between populations for all loci. For these and
subsequent genetic analyses, we included genetic data
from McGuire et al. (2014) for 2 individuals of evelynae
from New Providence (Appendix Table 6). Finally, because
estimation of several measures required knowing individ-
ual alleles, we reconstructed haplotypes with PHASE
(Stephens et al. 2001, Stephens and Donnelly 2003),
implemented in DnaSP using default settings.
Selection and recent demographic changes can influence
estimates of genetic divergence and estimates of time since
divergence. We calculated Fu’s F
s
(Fu 1997) and Tajima’s D
(Tajima 1989) statistics for all loci to test for departure
from neutral evolution. To test whether the values we
calculated for each locus differed significantly from neutral
expectations, we generated a distribution of expected Fu’s
F
s
and Tajima’s Dvalues using the ‘‘coalescent simula-
tions’’ option in DnaSP. For each locus and population,
1,000 simulations were conducted, assuming a neutral
infinite-sites model and large constant population size, to
generate the expected neutral distribution of Fu’s F
s
or
Tajima’s Dvalues. Actual Fu’s F
s
or Tajima’s Dvalues were
deemed statistically significant if they fell outside the 95%
interval of the simulated distribution.
Phylogenetic Reconstruction
We implemented 2 methods of Bayesian phylogenetic
inference to explore evolutionary relationships among
sampled individuals (sensu Berv and Prum 2014). To assess
whether or not populations from New Providence and
Great Inagua represent reciprocally monophyletic sister
clades, we built individual gene trees and a single
concatenated gene tree using MrBayes version 3.2.2
(Ronquist et al. 2012). Further, we generated a time-
calibrated species tree using *BEAST version 1.8.0
(Drummond et al. 2012). For these analyses, we included
closely related representatives from Calothorax,Archilo-
chus, and Mellisuga (McGuire et al. 2014). Finally, we
chose nucleotide substitution models using Partition-
Finder version 1.1.1 and the Bayesian Information
Criterion (Lanfear et al. 2012, 2014).
For analysis with MrBayes, we used the MCMCMC
settings, priors, and convergence diagnostics described in
Berv and Prum (2014). For *BEAST analyses, alignment
partitions, molecular clock calibrations, and priors were
taken from McGuire et al. (2014)—we performed 4
separate analyses of 2.2 310
8
generations, with trees
sampled every 2.0 310
4
generations. The log files
generated by *BEAST were examined in Tracer version
1.6 (Rambaut et al. 2014) to ensure that the Markov chain
Monte Carlo (MCMC) chain had run long enough and
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 251
that the effective sample sizes for all statistics were .200
(most were .1,000). After discarding the first 10
3
trees
from each of 4 analyses as burn-in, we randomly sampled
2.5 310
3
trees from each, produced a combined tree log
file using LogCombiner version 1.8.0, and generated a
maximum clade-credibility tree using TreeAnnotator
version 1.8.0 with default settings (see Acknowledgments).
Results are presented as means 6SD.
RESULTS
Morphology and Plumage
We investigated the morphology and plumage of the
Bahama Woodstar across most of the major islands within
its range (Figure 1). This included several individuals from
the Turks and Caicos, which were described as C. e. salita
by Greenway (1936) on the basis of tail coloration and
iridescent forecrown feathers. Currently, salita is synon-
ymized with evelynae (Gill and Donsker 2013). We found
no significant differences between salita and the nominate
evelynae in tail-feather coloration, shape, or size. One male
individual of salita (FMNH 42913) had a small patch of
iridescent feathers on the anteriormost portion of the
forecrown, but this was not observed in other males from
this population. These data support that salita is invalid,
and we included Turks and Caicos specimens with
nominate evelynae populations for subsequent morpho-
logical comparisons to lyrura.
Adult males of both evelynae and lyrura have a
completely iridescent gorget and a forked tail with narrow
feathers (Figure 2A–2C). Females from both populations
lack an iridescent gorget and have a rounded tail with
broader feathers (Figure 2A, 2C). Immature males are
similar in appearance to females before they begin to molt
in adult male tail feathers and iridescent feathers.
Nevertheless, they can still be differentiated from females
by a relatively shorter R1 (Figure 2A and Table 1) and by
the presence of more extensive black on the outer vanes of
R3–R5. This gives the overall impression of a blurred black
band in immature male tails versus a sharply defined black
subterminal band in female tails (Figure 2A).
Discriminant function analysis discovered significant
differences between evelynae and lyrura adult males (k¼
0.15, P,0.01), immature males (k¼0.27, P,0.01), and
females (k¼0.83, P¼0.05). Adult male lyrura from the
Inagua islands are diagnosed from adult male evelynae of
other islands by the presence of a fully iridescent
forecrown, lyre-shaped outer tail feathers, and a more
strongly forked tail (Figures 1 and 2; Table 1). Adult male
lyrura have a fully iridescent forecrown of the same color
as the gorget, whereas most evelynae have no iridescent
feathers on the forecrown (Figure 1). We found 3 male
evelynae with a few iridescent feathers on the forecrown.
Two males had 1 or 2 iridescent feathers at the base of the
bill, and a third male from Caicos (FMNH 42913) had a
single row of iridescent feathers along the upper margin of
the bill. The tail of adult male lyrura is more strongly
FIGURE 2. Tail morphology of Calliphlox evelynae evelynae and C. e. lyrura.(A) Study skins with spread tails of adult male, immature
male, and adult female, showing age-, sex-, and population-specific differences in tail shape and pattern. Immature males are
distinguished from females by a shorter rectrix 1 (R1) and by a greater extent of black on leading vanes blurring the black band
across the tail. (B) Adult male folded tails. Male lyrura is distinguished from evelynae by the graded lengths of R1–R5, whereas R3–R5
overlap in evelynae.(C) Adult feather shapes showing sex and population differences. Note the elongated lyre-shaped R5 in male
lyrura. Scale bars ¼1 cm.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
252 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
forked than that of evelynae as a result of graduated tail-
feather lengths (Figures 1 and 2). Adult male lyrura have
significantly shorter R1 and significantly longer R5 (P,
0.01), with no overlap in R5 length between populations
(Table 1). Additionally, we found no evidence of a north–
south clinal transition in either R1 or R5 length in evelynae
(Figure 3).
Female evelynae and lyrura were similar to each other in
overall appearance (Figure 2A, 2C; Table 1), and only
folded wing chord was significantly different between the 2
populations (P,0.01). However, folded-wing-chord range
overlapped between the 2 populations (Table 1), and we
found no discrete morphological characters that could
reliably be used to diagnose female lyrura from evelynae.
Immature male evelynae and lyrura were also similar in
appearance. Nevertheless, immature male lyrura were
diagnosable from immature male evelynae by their
significantly shorter R1 (P,0.01) and significantly longer
R5 (P,0.01).
Breeding Behavior
Male and female evelynae on New Providence were most
common in residential areas where gardens and hum-
mingbird feeders provided sources of food. Females were
also common in the pine woodland near the airport
(Figure 1: PW), where males were less common. In
December 2009, female evelynae were engaged in all stages
of nesting, including gathering of nesting material
(spiderwebs), incubating of eggs, and feeding of fledglings.
In March 2012, we did not happen to find any active nests
of evelynae.
In both December and March, male evelynae guarded
courtship territories, sang, and displayed. Individual males
spent the majority of their time within a given territory of
approximately 25 325 m (core) and utilized 5–10 perches.
The density of males was variable between locations and
times. In December 2009, we found 10 or more males
along a short stretch of road at Fort Winton (Figure 1:
FW), but only 4 males along the same road in March 2012.
TABLE 1. Morphology of adult male, immature male, and female Calliphlox evelynae lyrura and C. e. evelynae (means 6SD, with
ranges below).
Measurement
Adult males
P
a
Immature males
P
Females
Pn Mean and range nMean and range nMean and range
Length R1 (mm)
lyrura 30 12.8 61.0 ,0.01 10 18.8 60.9 ,0.01 18 25.5 60.9 0.33
10.8–14.9 17.1–20.2 23.6–27.2
evelynae 38 15.6 60.9 8 20.8 61.4 41 25.8 61.1
13.8–17.7 19.1–23.0 22.6–28.0
Length R5 (mm)
lyrura 30 38.0 61.1 ,0.01 10 26.5 60.7 ,0.01 19 25.6 61.3 0.07
35.7–39.4 25.6–27.6 22.9–27.7
evelynae 38 31.8 61.1 8 24.9 61.1 42 26.3 61.3
29.4–33.9 23.4–26.4 23.3–29.7
Exposed culmen (mm)
lyrura 28 15.0 60.5 0.01 10 15.0 60.4 0.08 18 15.8 60.7 0.24
14.0–16.1 14.1–15.4 14.8–17.4
evelynae 36 15.4 60.6 7 15.5 60.5 39 16.1 60.8
14.0–16.4 15.0–16.3 14.2–17.9
Folded wing chord (mm)
lyrura 30 38.6 61.0 0.04 11 39.7 61.3 0.40 19 42.0 61.4 ,0.01
37.2–41.0 37.7–41.2 40.0–45.5
evelynae 39 39.3 61.3 7 40.5 61.2 43 43.2 61.2
37.2–43.1 39.3–42.7 40.8–46.5
Mass (g)
lyrura 4 2.4 60.1 – 3 2.2 60.2 – 5 2.4 60.2 –
2.3–2.5 2.1–2.4 2.2–2.7
evelynae 13 2.6 60.2 2 2.7 60.2 3 3.0 60.1
2.4–3.0 2.5–2.8 2.9–3.0
Hovering wingbeat frequency (Hz)
lyrura 4 50.5 64.3 – 2 43.7 61.3 – 5 39.2 62.8 –
44.7–54.7 42.7–44.6 37.3–43.9
evelynae 11 48.4 64.0 1 46.0 6NA 2 39.9 60.2
40.0–53.2 39.7–40.0
a
Pvalues from t-tests comparing evelynae and lyrura age and sex classes.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 253
Elsewhere, we found 1 lone male holding a territory in the
pine woodland.
Male evelynae readily displayed to females that naturally
entered their territory, and to caged females placed within
their territories. During these displays, it was common for
1 or more additional males to perch close by as onlookers
and, occasionally, interrupt the displaying male. Males
infrequently displayed to other adult males that entered
their territory before chasing them away. Once, we
observed a male evelynae display and attempt to copulate
with a fledgling.
Male and female lyrura were common on Great Inagua,
and their behavior differed between the dry season
(February) and the rainy season (October). During the
dry season, lyrura were abundant in the flowering gardens
of Matthew Town (Figure 1: MT), where they visited
flowers of Cordia sebastina,Aloe vera,Carica papaya,
Passiflora sp., Opuntia sp., Bougainvillea sp., and other
unidentified flowers; we estimated that there were 400
birds km
2
in Matthew Town in February. In surveys, we
observed a few additional birds in dune scrub near
Northwest Point and in freshwater riparian habitat but
found no hummingbirds in mangrove or coppice scrub,
which had few flowers during the dry season.
We did not find signs of breeding lyrura during the dry
season, and some birds were in body or tail molt. Both
males and females guarded small territories (about 2 32
m) around dense nectar resources (e.g., Aloe vera), which
they defended against other males and females. Both sexes
defended territories, using scolding calls extensively in
agonistic interactions with other individuals. We also
observed 2 territorial males singing; these birds did not
perform displays.
By contrast, we found very few hummingbirds in
Matthew Town during the rainy season, despite the
presence of blooming Cordia sp. Instead, hummingbirds
were common in coppice just east of town, where
several plants were in bloom, and we estimated 20
birds km
2
. We found evidence of breeding lyrura
during the rainy season: Two males held adjacent
courtship territories in the low coppice just east of
Matthew Town, and both performed displays and songs.
Both territories revolved around 1 or 2 primary exposed
perches,inthedeadbranchesattheverytopofatall
plant, as well as 2 or 3 lower perches, partially exposed
and 5 to 10 m from the main perch. The territories were
similar in size to those of evelynae. In the surrounding
habitat, females were observed hunting insects, as is
typical during breeding.
Vocalizations
Both evelynae on New Providence and lyrura on Great
Inagua produced a repertoire of vocalizations that
included calls, scolding (agonistic) calls, and song
(Figures 4 and 5; Supplemental Material Audio Files A–
J). In both populations, males and females produced
‘‘chip’’ calls when feeding and flying about (Figure 4A,
4B). These calls were composed of a single syllable that
was repeated in a series. Calls varied in both the number
and rate of syllables given in a series, from a single ‘‘chip’’
to a lengthy, rapid-fire sequence. Two additional calls
were recorded only from evelynae on New Providence
(Figure 4B). Male evelynae on New Providence occasion-
ally gave a quiet ‘‘spurt’’ call during shuttle displays or
fights. Fledglings gave ‘‘cheep’’ calls to their mothers near
a nest, and adult birds also infrequently produced this
call.
Male evelynae, and both sexes of lyrura, also gave loud
scolding calls during agonistic interactions such as chases
and fights (Figure 4C, 4D). Scolding calls were highly
variable in both the length of the calls and the pattern of
syllables and phrases. The scolding calls of evelynae and
lyrura were primarily composed of 2 species-specific
syllables given in the phrase ‘‘abb’’ that was repeated a
variable number of times, or simply a single ‘‘a’’ syllable
followed by a variable number of ‘‘ b’’ syllables. The
scolding calls of lyrura were more variable than evelynae,
and lyrura frequently gave an additional scolding call that
was composed of an ‘‘a’’ followed by a variable number of
‘‘c’’ syllables, and sometimes ending with a variable
number of ‘‘ b’’ and ‘‘abb’’ phrases.
Calls and scolding calls qualitatively differed between
lyrura and evelynae, both in fundamental frequency and in
FIGURE 3. Adult male rectrix 5 (R5) and rectrix 1 (R1) length by
island. Male Calliphlox evelynae lyrura from Great Inagua have
significantly longer R5 and shorter R1 than C. e. evelynae from
other islands in the Bahama Archipelago. Error bars are SD;
numbers along the x-axis are sample size.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
254 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
length of syllables. The fundamental frequency of lyrura
‘‘chip’’ calls and scolding calls was between 1.5 and 3 kHz
(Figure 4A, 4C). By contrast, evelynae ‘‘chip’’ calls and
scolding calls had a much higher fundamental frequency,
ranging between 7 and 9 kHz (Figure 4B, 4D).
Male lyrura and evelynae sang either from a perch
(Figure 5) or as a part of their shuttle display (Figure 6).
Within individual males, there were no noticeable
differences between songs that were sung while perched
or while displaying. In both taxa, songs consisted of a
single stereotyped phrase that showed little or no variation
in syllable composition (Figure 5). Song length varied
within an individual solely though variation in the number
of repetitions of this phrase.
The songs of lyrura were relatively short, lasting 5s,
and relatively simple (Figure 5A). Song phrases were
composed of a single, broad-frequency syllable ‘‘ a’’ given
in pairs, and songs consisted of 1–4 repeated phrases. The
songs of lyrura sounded similar to the sound of wet,
squeaking shoes. Most distinctively, the songs were also
very quiet. Unlike evelynae,lyrura songs were audible only
within ~5 m of the male under the quietest conditions,
similar to the ‘‘whisper songs’’ reported for other
hummingbird species (Skutch 1973).
The songs of evelynae were fast, high-pitched, and
relatively long, lasting 3–27 s. They were also louder and
could be heard 20 or 30 m from the bird. We recorded 2
distinct song phrases from evelynae that were apparently
segregated by locality (Figure 5B). Song phrase 1 was
recorded on the eastern side of New Providence (Figure 1:
FW), whereas song phrase 2 was recorded on the western
side of New Providence (Figure 1: CH, PW, and WB). The
2 song phrases were similar in overall quality and differed
in both the type and cadence of syllables given in a
repeated phrase.
Shuttle Display
Both male evelynae and lyrura readily performed shuttle
displays to wild or caged females, and occasionally to wild
males (Figure 6). More observations and field recordings
were made of evelynae than of lyrura, so we present a
FIGURE 4. Calls and scolding calls. (A) Call of Calliphlox evelynae
lyrura.(B) From left to right: C. e. evelynae call, evelynae male
‘‘spurt’’ call, and evelynae fledgling ‘‘cheep’’ call. (C) Represen-
tative segments of lyrura scolding calls given in agonistic
interactions, with species-specific syllables labeled a–d. From
top to bottom: lyrura adult male, lyrura adult female. (D)
Representative segments of evelynae scolding calls given in
agonistic interactions, with species-specific syllables labeled a–b.
Brackets delineate repeated phrases. See Supplemental Material
Audio Files A–G.
FIGURE 5. Representative segments of song. (A) Adult male
Calliphlox evelynae lyrura recorded from Great Inagua. The song
is a realtively quiet repetition of a simple phrase consisting of a
single syllable ‘‘a.’’ (B) Male C. e. evelynae song phrase 1
recorded from eastern New Providence and song phrase 2
recorded from western New Providence. Songs are relatively
loud repetions of a complex phrase consisting of several
syllables. Brackets delineate repeated phrases. See Supplemental
Material Audio Files H–J.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 255
detailed description of the evelynae shuttle display,
followed by a comparison with the lyrura display.
We collected audio recordings of shuttle displays from
at least 7 male evelynae (3 males in 2009 and 4 males in
2012) and 15 high-speed videos from 1 male. A male
flapped his wings throughout the shuttle display and faced
the female in an upright posture with gorget flared and tail
widely spread and depressed (Figure 6A, 6B). The female
actively followed the movements of the male with her head
throughout the display.
The shuttle display of evelynae had 3 kinematically and
acoustically distinct forms: the ‘‘initial’’ shuttle, the
‘‘typical’’ shuttle, and the ‘‘ alternate’’ shuttle. Displays
sometimes began with an ‘‘initial’’ shuttle, which was a
brief, subtle behavior performed at the onset of the display.
During the ‘‘initial’’ shuttle, a male performed a short
shuttle segment (see below) and then paused to hover and
look at the female. The ‘‘ typical’’ form of the shuttle
consisted of rapid, repeated, side-to-side (lateral) flights in
which the male accelerated from rest, flew a distance past
the female, and then decelerated (stopping only momen-
tarily), all while facing the female (i.e. much of the motion
was sideways). We term each individual lateral flight a
‘‘segment’’ because of their discrete, periodic nature.
Shuttle segments were performed at a rate of 3.2 60.24
Hz (segments per second, n¼7 males).
Similar to Calothorax and Archilochus, the shuttle
segments were comparatively wide at the beginning of
the display, up to 0.5–1 m, and decreased in amplitude
with repetition to 20–30 cm, as the display bout
progressed. From one segment to the next, the male often
reversed direction, flying back the way he had come in the
previous segment, or he sometimes continued at a large
angle in relation to the previous segment. As a result, the
display sometimes processed around the recipient in stages
(Figure 6A).
At the end of each lateral shuttle segment, males
produced a sharp buzzing sound with a trill rate of 74.5 6
3.28 Hz (n¼7 males) that corresponded to the wingbeat
frequency (74.3 63.8; n¼8 videos of 1 male), indicating
that this sound was a wing trill (Figure 6D; Supplemental
Material Audio File K). The tail was held spread, with the
stripes on R3 and R4 highly visible, as an apparent visual
signal. Males also flicked their tails 1–3 times to the side,
usually toward the second half of a shuttle segment (Figure
6C). High-speed videos of the shuttle display showed that
FIGURE 6. Shuttle-display kinematics and acoustics for Calliphlox evelynae evelynae;C. e. lyrura displays were incompletely observed
but appeared to be similar. (A) Example path of 6 shuttle segments of a male to a caged female. (B) Path of male as he transitions
between periods of shuttling and hovering: frames from high-speed video show posture during hovering song (above) and shuttling
tail flick (below). (C) Frames from a high-speed video showing 2 tail-flicks (marked with numbers and dashed lines) as a male
transitions between shuttle segments and then flies 1 shuttle segment (solid line). (D) Segments of shuttle-display sounds produced
by evelynae and lyrura; each buzz corresponds to 1 shuttle segment; heavy band of sound between 6 and 8 kHz in lyrura recording is
background cicada. See Supplemental Material Audio Files K–L.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
256 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
the wings occasionally struck the outer rectrices during a
tail flick, but that this did not occur frequently enough to
explain the buzzing sound.
During the alternate shuttle, a male paused after a
typical shuttle segment to hover in front of the female and
sing with bill wide open (Figure 6B, 6D). In many displays,
the male alternated singing with slowly drifting upward
while producing a purring sound with bill closed (Figure
6B, 6D). There was a roughly 2:1 correspondence between
the hovering wingbeat frequency (55.6 63.8 Hz; n¼1
male) and the trill rate of the purring sound (31.9 61.3; n
¼6 males), suggesting that the wings also produced this
sound. However, neither the precise mechanism nor the
feathers responsible for the sound are clear from our data.
The time spent on the typical and alternate shuttles
varied; some displays included only typical flight, whereas
others mostly consisted of hovering after a brief period of
lateral shuttling. Displays performed to females lasted a
relatively long time (3 min) and included both typical
and alternate forms. These bouts ended with the male
pursuing the female or perching nearby or giving chase to
an intruding male. If the female remained, males
sometimes returned after a few minutes to perform
another shuttle display. Displays to males were brief
(10 s), mostly included typical shuttle motions, and
inevitably ended in a chase.
We obtained audio recordings, but not video, of 3
shuttle displays from 2 male lyrura in October 2012. The
first male performed a natural shuttle display that lasted 3
min, apparently to a female, but the entire display was out
of our sight on the far side of a bush, so we were unable to
observe the display kinematics. The second male per-
formed a brief display with short shuttle segments, ~20 cm
in length, to a hatch-year male. The observed kinematics of
this 1 male were generally similar to those of evelynae, with
no obvious differences, other than a slightly increased
shuttle cycle rate. The pattern of sounds produced during
the display were also similar to those of evelynae: a series
of buzz sounds with a trill rate of 74.2 63.84 (n¼2 males)
produced at the end of each shuttle segment, which were
performed at a rate of 3.8 60.48 Hz (Figure 6D;
Supplemental Material Audio File L). Periods of shuttling
were interspersed with periods of hovering and song. None
of these displays included a purring sound (though this
sound was not always present in displays of evelynae
either).
Display Dives
Both male evelynae and lyrura infrequently performed
display dives (Figure 7). We saw or heard ~12 dives from 5
or 6 male evelynae, and we obtained audio recordings of 6
display dives from 3 males and high-speed video of 2 dives
from 1 male. All dives were performed either to wild or to
caged females (none to males), and they were usually
performed immediately after a shuttle display. Males
performed a single dive per bout that appeared to be
oriented toward their main perch. A dive began with a
male ascending 15–20 m high while zig-zagging slightly
from side to side and then, without pausing, turning and
diving in a J- or L-shaped trajectory (Figure 7A). At the
bottom of the dive, the male would spread his tail
repeatedly 6–9 times at a rate of 21.3 60.6 Hz (n¼1
male) and produce the dive sound (Figure 7B;
Supplemental Material Audio File M). Then, after passing
over the female, the male would fly away while undulating
FIGURE 7. Display-dive kinematics and associated sounds. (A)
Kinematics of Calliphlox evelynae evelynae. A male performs a
single dive in which he spreads his tail repeatedly at the bottom
and then flies away in an undulating flight. Kinematics of C. e.
lyrura were incompletely observed but appeared to be similar to
evelynae.(B) At the bottom of a dive, male evelynae and lyrura
produce a series of faint dive notes. (C) Frequency of sounds
produced by tip flutter of evelynae and lyrura rectrix 5 (R5) in a
wind tunnel over a range of airspeeds. See Supplemental
Material Audio Files M–N.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 257
from side to side with the tail widely spread. Males flapped
their wings continuously throughout the display with a
wingbeat frequency of 65 62.1 Hz (n¼1 male).
At the bottom of a dive, males produced a dive sound
that consisted of a series of 6 to 9 tonal notes with an
average pitch of 0.94 60.03 kHz (n¼3 males; Figure 7B).
The notes were produced at a rate of 22.3 60.4 Hz (n¼3
males), and each spread of the tail at the bottom of the dive
corresponded to 1 note. The entire dive sound was
relatively quiet and brief, lasting an average of 0.34 6
0.05 s (n¼3 males).
We heard 10 dives, and obtained audio recordings of 3
display dives, from 1 male lyrura in October 2012. We saw
only a portion of 2 dives, which prevented a detailed
comparison of kinematics. The dive sound of lyrura was
similar to that of evelynae, except that the average pitch of
the notes was slightly higher, at 1.5 60.2 kHz (n¼1 male;
Figure 7B; Supplemental Material Audio File N). The
lyrura dive sound also included an additional 1–3 longer
notes produced later during the undulation phase. The
undulation notes had an average pitch, similar to the notes
produced at the bottom of the dive. The male spread his
tail and produced notes at the bottom of the dive at a rate
of 16.8 60.3 Hz (n¼1 male), and the undulation notes
measured from 1 dive had a rate of 2.7 Hz. The presence of
additional undulating notes on the lyrura recordings, and
not on the evelynae recordings, is probably due to greater
sensitivity of the parabola used to record lyrura (vs.
shotgun microphone for evelynae), rather than a biological
difference.
Feather Acoustics
When placed in the wind tunnel, outer rectrices (R5) of
evelynae and lyrura produced sounds with a tip mode of
flutter corresponding in frequency to their respective dive
sounds (Figure 7C). Rectrix 5 of evelynae fluttered at 0.97
60.01 kHz (n¼3 feathers), and lyrura fluttered at 1.2 6
0.06 kHz (n¼3 feathers). The lyrura R5 produced sounds
at significantly higher frequencies than evelynae R5 (t-test,
P¼0.021). The frequency of sound varied only slightly
with airspeed in both evelynae and lyrura (Figure 7C).
Population Genetics
We sequenced 4 nuclear loci and 2 mitochondrial genes in
individuals of evelynae from New Providence and lyrura
from Great Inagua. This was supplemented by genetic data
from 2 individuals of evelynae collected previously
(Appendix Table 6). Loci ranged in length from 508 to
1,049 base pairs, and all loci exhibited within-population
variation (Table 2). Estimates of h
w
per site ranged from
0.00032 to 0.0021, with the highest estimates found in MT-
ND4 for both evelynae and lyrura. Measures of nucleotide
diversity (p) within each population ranged from 0.028%
for MUSK I3 in evelynae to 0.18% for MT-ND2 and AK1 I5
in evelynae (Table 2).
We also calculated average pairwise divergence between
evelynae from New Providence and lyrura from Great
TABLE 2. Genetic variation within populations of Calliphlox evelynae evelynae (from New Providence) and C. e. lyrura (from Great
Inagua).
Locus nNSghH
d
pH
w
KFu’s F
s
(P) Tajima’s D(P)
MT-ND2
lyrura 6 1,041 1 1 2 0.53 0.00051 0.00042 0.53 0.63 (ns) 0.85 (ns)
evelynae 8 1,041 5 5 5 0.86 0.0018 0.0019 1.86 1.32 (ns) 0.17 (ns)
MT-ND4
lyrura 6 900 3 3 3 0.73 0.0016 0.0015 1.4 0.38 (ns) 0.34 (ns)
evelynae 9 900 5 5 4 0.75 0.0017 0.0021 1.4 3.5 (ns) 0.91 (ns)
AK1 I5
lyrura 12 508 1 1 2 0.17 0.00033 0.00066 0.17 0.48 (ns) 1.1 (ns)
evelynae 16 508 2 2 3 0.71 0.0018 0.0012 0.92 0.81 (ns) 1.3 (ns)
FGB I7
lyrura 12 1,049 1 1 2 0.30 0.00030 0.00032 0.30 0.30 (ns) 0.19 (ns)
evelynae 14 1,049 2 2 3 0.28 0.00030 0.00060 0.29 1.5 (0.04) 1.5 (0.04)
ODC1
lyrura 12 574 1 1 2 0.49 0.00085 0.00058 0.49 1.0 (ns) 1.1 (ns)
evelynae 18 574 2 2 3 0.45 0.00094 0.0010 0.54 0.16 (ns) 0.19 (ns)
MUSK I3
lyrura 10 599 2 2 3 0.60 0.0011 0.0012 0.67 0.27 (ns) 0.18 (ns)
evelynae 12 599 1 1 2 0.17 0.00028 0.00055 0.17 0.48 (ns) 1.1 (ns)
Notes: n¼number of sequences (excludes number of sites with gaps or missing data); N¼number of sites; S¼number of
segregating sites; g¼number of mutations; h¼number of haplotypes; H
d
¼haplotype diversity; p¼nucleotide diversity; H
w
¼
Watterson estimator of population mutation rate per site; K¼average number of nucleotide differences among haplotypes within
population; and ns indicates P.0.1.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
258 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
Inagua (Table 3). Mitochondrial loci exhibited the largest
divergence, 3.0% in MT-ND2 and 2.3% in MT-ND4, with
29 and 18 fixed differences, respectively. Average pairwise
divergence between populations at nuclear loci ranged
from 0.11% (ODC1) to 0.92% (MUSK I3), with 2 of the 4
nuclear loci exhibiting fixed differences (1 in FGB I7 and 5
in MUSK I3). We found no sites where polymorphisms
were shared between both populations. Further, consistent
with assumptions of the infinite-sites model, we found no
evidence of any sites exhibiting multiple mutations.
Our tests for significance of Fu’s F
s
and Tajima’s Din
every combination of locus and population found only 1
case in which these values were significant. The locus
FGB I7 in evelynae had Fu’s F
s
and Tajima’s Dvalues that
were significantly lower then expected under neutral
evolution (P¼0.04 for both values). This may indicate
that this locus, or a nearby linked region, is under
selection.
Phylogenetic Reconstruction
Both lyrura and evelynae populations were recovered as
reciprocally monophyletic sister populations in our
concatenated analysis (Figure 8A). Further, their place-
ment as sister taxa was supported by a posterior
probability (PP) of 1.0 in the *BEAST species tree
(Figure 8B). The 95% highest posterior density (HPD)
*BEAST estimate for the divergence of the Great Inagua
and New Providence populations was 0.41–0.96 mya
(median ¼0.69 mya). The lyrura–evelynae clade is
estimated to have diverged from its most recent
common ancestor with Mellisuga 1.3–2.4 mya (median
¼1.8 mya).
All relationships were supported by a posterior
probability (PP) of 1.0, with the exception of the clade
containing C. evelynae and Mellisuga minima,whichwas
resolved with a posterior probability of 0.51. This low
probability appears to be a consequence of topological
conflict among the sampled genetic markers. In gene
trees generated by *BEAST, mitochondrial DNA resolves
Mellisuga as sister to Archilochus (PP ¼0.54); AK1 I5
resolves Mellisuga as sister to Calliphlox (PP ¼0.97); FGB
I7 resolves Mellisuga as nested within Archilohus (PP ¼
0.92); ODC1 resolves Mellisuga as sister to Archilochus
(PP ¼0.43); and MUSK I3 resolves Mellisuga as sister to
Calliphlox (PP ¼0.92). The gene-tree topologies recov-
ered by *BEAST were otherwise consistent with our final
species tree estimate. Individual gene trees estimated by
MrBayes varied in their resolution but were generally
consistent with those generated by *BEAST (data not
shown).
TABLE 3. Genetic divergence between populations of Calliphlox
evelynae evelynae (from New Providence) and C. e. lyrura (from
Great Inagua).
K
a
Fixed
differences (n)
Shared
polymorphisms (n)
MT-ND2 0.030 29 0
MT-ND4 0.023 18 0
AK1 I5 0.0014 0 0
FGB I7 0.0013 1 0
ODC1 0.0011 0 0
MUSK I3 0.0092 5 0
a
K¼average number of nucleotide substitutions per site
between populations.
FIGURE 8. Phylogenetic analyses of Calliphlox evelynae lyrura
(from Great Inagua), C. e. evelynae (from New Providence), and
other closely related taxa. Nodes labeled with a star have a
posterior probability of 1. (A) MrBayes concatenated gene tree.
Scale bar is proportional to the number of expected substitu-
tions per site. Both target populations are recovered as
reciprocally monophyletic with maximal posterior support. (B)
*BEAST species tree. Node bars indicate the 95% HPD
confidence interval of node height.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 259
DISCUSSION
Our analysis of morphological, acoustic, and genetic
variation among populations of lyrura from the Inagua
islands and among evelynae from the remaining islands of
the Bahama Archipelago discovered consistent and
diagnosable differences between the 2 populations. Our
results confirm that the morphological characteristics
originally used to describe lyrura as a separate species—
iridescent forecrown and lyre-shaped tail feathers—are
valid characters for distinguishing adult male lyrura from
adult male evelynae (Figures 1 and 2). Iridescent head
feathering and, possibly, tail shape serve as visual signals
during the courtship displays that males of both popula-
tions perform to females. Moreover, kinematic and wind-
tunnel evidence indicates that R5 in both lyrura and
evelynae produces the dive sound (Figure 7). The sounds
produced by lyrura tail feathers were significantly higher
pitched than those of evelynae, which suggests that the
different feather shapes between the 2 populations are
responsible for the small divergence in the acoustic signals
of the dive display.
Both sexes of evelynae and lyrura are diagnosed to their
respective populations by their distinct calls and scolding
calls (Figure 4). Male lyrura are additionally diagnosed
from evelynae by distinctly different song (Figure 5).
Although most bird vocalizations appear to be determined
genetically, hummingbirds learn their songs (Gahr 2000).
Cultural transmission via song learning may help explain
the large differences in song between the recently isolated
populations of lyrura and evelynae, as well as the potential
dialects that we recorded from the evelynae of New
Providence.
Breeding behaviors of evelynae and lyrura were similar.
Like other members of the bee hummingbird clade, male
evelynae and lyrura hold courtship territories during the
breeding season. From these territories, males sing songs
and perform 2 different elaborate aerial courtship displays,
shuttles, and dives. Similar to Lucifer Hummingbirds and
Slender Sheartails, males relied primarily on a complex
and lengthy shuttle display that included song when
displaying to a female on their territory, and only
infrequently performed a single display dive (Figures 6
and 7; Scott 1994, Diza-Valenzuela et al. 2011). Males also
infrequently performed shuttle displays to other intruding
males, but these displays were generally shorter than those
performed to females and did not include song.
Phylogenetic reconstruction based on nuclear and
mitochondrial DNA sequences revealed that populations
of evelynae from New Providence and lyrura from Great
Inagua are reciprocally monophyletic, which is consistent
with reproductive isolation (Figure 8). Although we only
sampled genetic data from 2 islands (no other tissues were
available), we found no evidence of a cline in morphology
in evelynae or of individuals with an intermediate
phenotype (Figures 2 and 3). We also recovered an average
mitochondrial pairwise divergence of ~2.7% between the 2
populations. This level of divergence is comparable to that
found among other closely related sister species (Klicka
and Zink 1997) and is greater than the divergence we
estimated for other named sister taxa included in our
phylogenetic reconstruction (i.e. D. eliza and D. enicura:
~2.1% mtDNA divergence).
Furthermore, we estimate that divergence between
evelynae and lyrura populations occurred between 0.41
and 0.96 mya. Fluctuations in sea level during this time
may have played a role in preventing reproductive barriers
from evolving between populations on most northern
islands. The isolation of the Inagua bank from the rest of
the Bahama Archipelago during times of sea-level minima
has presumably maintained a geographic barrier between
these 2 taxa. Thus, data from morphology, behavior,
genetics, and geology support the recognition of lyrura
and evelynae as separate species.
Numerous criteria for species delimitation exist (de
Queiroz 2007). The two that are most commonly applied
in delimiting avian species are the biological species
concept (BSC) and the phylogenetic species concept
(PSC). Under the PSC, species are defined as diagnosable
evolutionary lineages (Cracraft 1983). Our results indicate
that lyrura and evelynae fulfill this criterion. In addition to
fixed genetic differences in both mitochondrial and
nuclear loci, and reciprocal monophyly in our phylogenetic
analysis, the 2 populations can be diagnosed by morphol-
ogy, vocal repertoire, and the mechanical sounds produced
by tail feathers.
Under the BSC, species must be reproductively isolated
(Mayr 1942). This criterion is difficult to apply in the case
of allopatric populations such as evelynae and lyrura. Only
indirect evidence can be used to infer reproductive
isolation, such as divergence in sexually selected traits
that could facilitate the existence of premating isolation
barriers (Alstr¨
om and Ranft 2003). We have found
evidence that adult male evelynae and lyrura diverge in
several characters associated with courtship displays.
These potentially sexually selected traits include songs,
dive sounds, tail-feather shape, and extent of iridescent
plumage. Divergence in both acoustic and morphological
traits associated with courtship display is consistent with
reproductive isolation.
Our findings suggest that lyrura is best considered a full
species. However, the most appropriate generic placement
of evelynae and lyrura is unclear. Anatomical (Zusi 2013)
and molecular phylogenetic analyses (McGuire et al. 2014)
indicate that Calliphlox is polyphyletic, and that evelynae
and lyrura are not woodstars and instead fall within a well-
supported clade containing Archilochus and Mellisuga
minima (Figure 8). However, within this clade, relation-
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
260 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
ships among genera are weakly supported. One possibility
is to place evelynae and lyrura in a resurrected Nesophlox
Ridgway (1910), for which evelynae is the type. Alterna-
tively, evelynae,lyrura, and the 2 members of Archilochus
could be placed in Mellisuga Brisson (1760), which has
nomenclatural priority over Archilochus. Finally, evelynae
and lyrura have previously been placed in a clade with
Calothorax and Doricha based on phenotypic similarity
(Schuchmann 1999, Howell 2002), but this hypothesis
currently lacks molecular phylogenetic support (McGuire
et al. 2014).
Several common names have previously been given to
lyrura: Lyre-shaped Woodstar (Gould 1887), Lyre-tailed
Hummingbird (Cory 1880), Inagua Woodstar (Cory 1918),
and Inagua Sheartail (Howell 2002). ‘‘ Lyre-tailed’’ refers to
the uniquely shaped tail feathers of males, which originally
characterized the species, whereas ‘‘Inagua’’ is the
appropriate toponym. Given the unique, outwardly curving
tail feathers of males and their endemic Inaguan geogra-
phy, we recommend the common name Inaguan Lyretail.
The geographic range of lyrura is small (restricted to
Great and Little Inagua), so a discussion of our limited data
relevant to conservation is warranted. A significant
fraction of Great Inagua is mangrove and saltwater lake,
which appeared to be largely unsuitable habitats. Assum-
ing a density of 20 birds km
2
in low coppice, the
population may be as low as a few thousand birds. In the
dry season the birds appeared to be food limited, in that
they were scarce in natural habitats but abundant in
gardens in town, whereas in the rainy season the opposite
was true. This suggests that limited additional develop-
ment could actually benefit lyrura if it increased this
resource base, as has happened in several North American
species of hummingbirds (Zimmerman 1973, Clark and
Mitchell 2013). Present human activities are unlikely to
have a direct negative impact on the species, and we did
not identify any apparent short-term threats to the
population. One clear long-term threat is sea-level rise,
because the Inagua islands, like much of the Bahamas, are
close to sea level. The Bahamas National Trust protects a
significant fraction of the island, and lyrura has protection
under Bahamian law, so it does not appear to meet the
IUCN criteria for a designation of ‘‘ vulnerable’’ at this
time. Additional surveys and data on the population status
of lyrura, particularly in eastern Great Inagua (which we
did not survey, because of inaccessibility), would provide a
better baseline for future monitoring of this Inaguan
endemic.
ACKNOWLEDGMENTS
We appreciate assistance provided by C. Wardle, Mrs.
Blackwell, A. Hepburn, J. Marks, A. Varma, H. Nixon, T.
Rahming, and the Bahamas National Trust. We thank R. Prum
and two anonymous reviewers for valuable comments on the
manuscript. National Science Foundation (NSF) grant IOS-
0920353 and the W.R. Coe Funds from Yale University
provided funding for this research. This material is based on
work supported by the NSF Graduate Research Fellowship
Program under grant DGE-1122492. This project was
conducted under permits from the Bahamas Environment,
Science and Technology commission (BEST). A. Varma kindly
allowed use of two photos. The following programs are
available online: Raven version (http://www.birds.cornell.edu/
raven), LogCombiner (http://beast.bio.ed.ac.uk/logcombiner),
and TreeAnnotator (http://beast.bio.ed.ac.uk/treeannotator).
LITERATURE CITED
Alstr ¨
om, P., and R. Ranft (2003). The use of sounds in avian
systematics, and the importance of bird sound archives.
Bulletin of the British Ornithologists’ Club 123A:114–135.
Ar`
evalo, E., S. K. Davis, and J. W. Sites (1994). Mitochondrial DNA
sequence divergence and phylogenetic relationships among
eight chromosome races of the Sceloporus grammicus
complex (Phrynosomatidae) in central Mexico. Systematic
Biology 43:387–418.
Bellemain, E., E. Bermingham, and R. E. Ricklefs (2008). The
dynamic evolutionary history of the Bananaquit (Coereba
flaveola) in the Caribbean revealed by a multigene analysis.
BMC Evolutionary Biology 8:240.
Benham, P. (2012). The role of geological history, topography,
and environmental heterogeneity in the diversification of an
endemic Andean radiation: The Metallura hummingbirds.
M.S. thesis, University of New Mexico, Albuquerque, NM, USA.
Berv, J. S., and R. O. Prum (2014). A comprehensive multilocus
phylogeny of the Neotropical cotingas (Cotingidae, Aves)
with a comparative evolutionary analysis of breeding system
and plumage dimorphism andarevisedphylogenetic
classification. Molecular Phylogenetics and Evolution 81:
120–136.
Bond, J. (1936). Birds of the West Indies. Academy of Natural
Sciences, Philadelphia, PA, USA.
Bourcier, J. M. (1847). On undescribed species of Trochilidae.
Proceedings of the Zoological Society of London 15:42–48.
Buden, D. W. (1985). New subspecies of Thick-billed Vireo (Aves:
Vireonidae) from the Caicos Islands, with remarks on
taxonomic status of other populations. Proceedings of the
Biological Society of Washington 98:591–597.
Buden, D. W. (1987). The Birds of the Southern Bahamas: An
Annotated Checklist (J. F. Monk, Editor). BOU Checklist 8.
British Ornithologists’ Union, London, UK.
Carew, J. L., and J. E. Mylroie (1995). Depositional model and
stratigraphy for the Quaternary geology of the Bahama
Islands. In Terrestrial and Shallow Marine Geology of the
Bahamas and Bermuda (H. A. Curran and B. White, Editors).
Special Paper 300. Geological Society of America, Boulder,
CO, USA.
Clark, C. J. (2010). The evolution of tail shape in hummingbirds.
The Auk 127:44–56.
Clark, C. J. (2011). Wing, tail, and vocal contributions to the
complex signals of a courting Calliope Hummingbird. Current
Zoology 57:187–196.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 261
Clark, C. J., D. O. Elias, M. B. Girard, and R. O. Prum (2013a).
Structural resonance and mode of flutter of hummingbird tail
feathers. Journal of Experimental Biology 216:3404–3413.
Clark, C. J., D. O. Elias, and R. O. Prum (2011). Aeroelastic flutter
produces hummingbird feather songs. Science 333:1430–
1433.
Clark, C. J., D. O. Elias, and R. O. Prum (2013b). Hummingbird
feather sounds are produced by aeroelastic flutter, not
vortex-induced vibration. Journal of Experimental Biology
216:3395–3403.
Clark, C. J., and T. J. Feo (2008). The Anna’s Hummingbird chirps
with its tail: A new mechanism of sonation in birds.
Proceedings of the Royal Society of London, Series B 275:
955–962.
Clark, C. J., and T. J. Feo (2010). Why do Calypte hummingbirds
‘‘sing’’ with both their tail and their syrinx? An apparent
example of sexual sensory bias. The American Naturalist 175:
27–37.
Clark, C. J., T. J. Feo, and K. B. Bryan (2012). Courtship displays
and sonations of a hybrid male Broad-tailed 3Black-chinned
Hummingbird. The Condor 114:329–340.
Clark, C. J., T. J. Feo, and W. F. D. van Dongen (2013c). Sounds
and courtship displays of the Peruvian Sheartail, Chilean
Woodstar, Oasis Hummingbird, and a hybrid male Peruvian
Sheartail 3Chilean Woodstar. The Condor 115:558–575.
Clark, C. J., and D. E. Mitchell. (2013). Allen’s Hummingbird
(Selasphorus sasin). In Birds of North America Online (A.
Poole, Editor). Cornell Lab of Ornithology, Ithaca, NY, USA.
http://bna.birds.cornell.edu/bna/species/501
Cory, C. B. (1880). Birds of the Bahama Islands. Published by the
author, Boston, MA, USA.
Cory, C. B. (1918). Catalogue of birds of the Americas and the
adjacent islands, part 2, no. 1. Field Museum of Natural
History Zoological Series 13:1–313.
Cracraft, J. (1983). Species concepts and speciation analysis.
Current Ornithology 1:159–187.
Curran, H. A., and B. White (1995). Introduction: Bahamas
geology. In Terrestrial and Shallow Marine Geology of the
Bahamas and Bermuda (H. A. Curran and B. White, Editors).
Special Paper 300. Geological Society of America, Boulder,
CO, USA.
de Queiroz, K. (2007). Species concepts and species delimitation.
Systematic Biology 56:879–886.
Diaz-Valenzuela, R., N. Z. Lara-Rodriguez, R. Ortiz-Pulido, F.
Gonza
´lez-Garcia, and A. R. Bautista. (2011). Some aspects of
the reproductive biology of the Mexican Sheartail (Doricha
eliza) in central Veracruz. The Condor 113:177–182.
Drummond, A. J., M. A. Suchard, D. Xie, and A. Rambaut (2012).
Bayesian phylogenetics with BEAUti and the BEAST 1.7.
Molecular Biology and Evolution 29:1969–1973.
Feo, T. J., and C. J. Clark (2010). The displays and sonations of the
Black-chinned Hummingbird (Trochilidae: Archilochus alexan-
dri). The Auk 127:787–796.
Fu, Y. X. (1997). Statistical tests of neutrality of mutations against
population growth, hitchhiking and background selection.
Genetics 147:915–925.
Gahr, M. (2000). Neural song control system of hummingbirds:
Comparison to swifts, vocal learning (songbirds) and non-
learning (suboscines) passerines, and vocal learning (bud-
gerigars) and nonlearning (dove, owl, gull, quail, chicken)
nonpasserines. Journal of Comparative Neurology 426:182–
196.
Garrido, O. H., J. W. Wiley, and G. B. Reynard (2009). Taxonomy of
the Loggerhead Kingbird (Tyrannus caudifasciatus) complex
(Aves: Tyrannidae). The Wilson Journal of Ornithology 121:
703–713.
Gill, F. B., and D. Donsker (Editors) (2013). IOC World Bird List,
version 3.5. International Ornithologists’ Union (doi: 10.
14344/IOC.ML.3.5).
Gould, J. (1869). On a new humming-bird from the Bahamas.
Annals and Magazine of Natural History, Zoology, Botany and
Geology 12:12–13.
Gould, J. (1887). A monograph of the Trochilidae, or family of
humming-birds, supplement. Henry Southern, London, UK.
Greenway, J. C. (1936). A name for the hummingbird of the
Caicos Islands. Proceedings of the New England Zoological
Club 15:105–106.
Hayes, W. K., R. X. Barry, Z. McKenzie, and P. Barry (2004). Grand
Bahama’s Brown-headed Nuthatch: A distinct and endan-
gered species. Bahamas Journal of Science 12:21–28.
Hey, J. (1991). The structure of genealogies and the distribution
of fixed differences between DNA sequence samples from
natural populations. Genetics 128:831–840.
Howell, S. N. G. (2002). Hummingbirds of North America: The
Photographic Guide. Academic Press, London, UK.
Klein, N. K., K. J. Burns, S. J. Hackett, and C. S. Griffiths (2004).
Molecular phylogenetic relationships among the wood
warblers (Parulidae) and historical biogeography in the
Caribbean basin. Journal of Caribbean Ornithology 17:3–17.
Klicka, J., and R. M. Zink (1997). The importance of recent ice
ages in speciation: A failed paradigm. Science 277:1666–
1669.
Lanfear, R., B. Calcott, S. Y. W. Ho, and S. Guindon (2012).
PartitionFinder: Combined selection of partitioning schemes
and substitution models for phylogenetic analyses. Molecular
Biology and Evolution 29:1695–1701.
Lanfear, R., B. Calcott, D. Kainer, C. Mayer, and A. Stamatakis
(2014). Selecting optimal partitioning schemes for phyloge-
nomic datasets. BMC Evolutionary Biology 14:82.
Librado, P., and J. Rozas (2009). DnaSP v5: A software for
comprehensive analysis of DNA polymorphism data. Bio-
informatics 25:1451–1452.
Lovette, I. J., E. Bermingham, G. Seutin, and R. E. Ricklefs (1998).
Evolutionary differentiation in three endemic West Indian
warblers. The Auk 115:890–903.
Markland, H. M., and I. J. Lovette (2005). Phylogenetic affinities
and inter-island differentiation in the Vitelline Warbler
Dendroica vitellina, a West Indian endemic. Ibis 147:764–771.
Mayr, E. (1942). Systematics and the Origin of Species from the
Viewpoint of a Zoologist. Columbia University Press, New
York, NY, USA.
McGuire, J. A., C. C. Witt, D. L. Altshuler, and J. V. Remsen, Jr.
(2007). Phylogenetic systematics and biogeography of
hummingbirds: Bayesian and maximum likelihood analyses
of partitioned data and selection of an appropriate parti-
tioning strategy. Systematic Biology 56:837–856.
McGuire, J. A., C. C. Witt, J. V. Remsen, Jr., A. Corl, D. L. Rabosky,
D. L. Altshuler, and R. Dudley (2014). Molecular phylogenetics
and the diversification of hummingbirds. Current Biology 24:
910–916.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
262 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
McKay, B. D., M. B. J. Reynolds, W. K. Hayes, and D. S. Lee (2010).
Evidence for the species status of the Bahama Yellow-
throated Warbler (Dendroica ‘‘dominica’’ flavescens). The Auk
127:932–939.
Mulsant, M. E., and E. Verraux (1866). Essai d’une classification
methodique des trochilides o oiseaux-mouches. Extrait des
M´
emoires de la Soci´
et´
e Imp´
eriale des Sciences Naturelles de
Cherbourg 12:1–98
Nei, M. (1987). Molecular Evolutionary Genetics. Columbia
University Press, New York, NY, USA.
Parra, J. L., J. V. Remsen, Jr., M. Alvarez-Rebolledo, and J. A.
McGuire (2009). Molecular phylogenetics of the humming-
bird genus Coeligena. Molecular Phylogenetics and Evolution
53:425–434.
Peters, J. L. (1945). Check-list of Birds of the World, vol. 5.
Harvard University Press, Cambridge, MA, USA.
Price, M. R., and W. K. Hayes (2009). Conservation taxonomy of
the Greater Antillean Oriole (Icterus dominicensis): Diagnos-
able plumage variation among allopatric populations sup-
ports species status. Journal of Caribbean Ornithology 22:19–
25.
Prychitko, T. M., and W. S. Moore (1997). The utility of DNA
sequences of an intron from the b-fibrinogen gene in
phylogenetic analysis of woodpeckers (Aves: Picidae). Mo-
lecular Phylogenetics and Evolution 8:193–204.
Rambaut, A., M. A. Suchard, D. Xie, and A. J. Drummond (2014).
Tracer, version 1.6. http://beast.bio.ed.ac.uk/Tracer
Reynolds, M. B. J., and W. K. Hayes (2009). Conservation
taxonomy of the Cuban Parrot (Amazona leucocephala):
Variation in morphology and plumage. Journal of Caribbean
Ornithology 22:1–18.
Ridgway, R. (1910). Diagnoses of new forms of Micropodidae
and Trochiliade. Proceedings of the Biological Society of
Washington 23:53–56.
Ridgway, R. (1911). The birds of Middle and North America: A
descriptive catalogue. U.S. National Museum Bulletin 50, part 5.
Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A. Darling,
S. Hohna, B. Larget, L. Liu, M. A. Suchard, and J. P.
Huselsenbeck (2012). MrBayes 3.2: Efficient Bayesian phylo-
genetic inference and model choice across a large model
space. Systematic Biology 61:539–542.
Russello, M. A., C. Stahala, D. Lalonde, K. L. Schmidt, and G.
Amato (2010). Cryptic diversity and conservation units in the
Bahama parrot. Conservation Genetics 11:1809–1821.
Schuchmann, K. L. (1999). Family Trochilidae (Hummingbirds).
In Handbook of the Birds of the World, vol. 5 ( Hoyo, J. del,
A. Elliottand J. Sargatal, Editors). Lynx Edicions, Barcelona,
Spain.
Scott, P. E. (1994). Lucifer Hummingbird (Calothorax lucifer). In
Birds of North America Online (A. Poole, Editor). Cornell Lab
of Ornithology, Ithaca, NY, USA. http://bna.birds.cornell.edu/
bna/species/134
Skutch, A. F. (1973). The Life of the Hummingbird. Vineyard
Books, New York, NY, USA.
Sorenson, M. D., J. C. Ast, D. E. Dimcheff, T. Yuri, and D. P. Mindell
(1999). Primers for a PCR-based approach to mitochondrial
genome sequencing in birds and other vertebrates. Molec-
ular Phylogenetics and Evolution 12:105–114.
Stephens, M., and P. Donnelly (2003). A comparison of Bayesian
methods for haplotype reconstruction from population
genotype data. American Journal of Human Genetics 73:
1162–1169.
Stephens, M., N. J. Smith, and P. Donnelly (2001). A new
statistical method for haplotype reconstruction from popu-
lation data. American Journal of Human Genetics 68:978–989.
Stiles, F. G. (1972). Age and sex determination in Rufous and
Allen hummingbirds. The Condor 74:25–32.
Stiles, F. G. (1983). Systematics of the southern forms of
Selasphorus (Trochilidae). The Auk 100:311–325.
Tajima, F. (1983). Evolutionary relationship of DNA sequences in
finite populations. Genetics 105:437–460.
Tajima, F. (1989). Statistical method for testing the neutral
mutation hypothesis by DNA polymorphism. Genetics 123:
585–595.
Watterson, G. A. (1975). On the number of segregating sites in
genetical models without recombination. Theoretical Popu-
lation Biology 7:256–276.
Zimmerman, D. A. (1973). Range expansion of Anna’s Hum-
mingbird. American Birds 27:827–835.
Zusi, R. L. (2013). Introduction to the skeleton of hummingbirds
(Aves: Apodiformes, Trochilidae) in functional and phyloge-
netic contexts. Ornithological Monographs 77.
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark Species status of Calliphlox e. lyrura 263
APPENDIX
TABLE 4. Specimens for which genetic data were collected in this study.
Specimen no. Tissue no. Species Subspecies Country, province/state/island
YPM 142562 6082 Calliphlox evelynae lyrura Bahamas, Inagua
YPM 142563 6083 C. evelynae lyrura Bahamas, Inagua
YPM 142564 6084 C. evelynae lyrura Bahamas, Inagua
YPM 142565 6085 C. evelynae lyrura Bahamas, Inagua
YPM 142566 6086 C. evelynae lyrura Bahamas, Inagua
YPM 142567 6087 C. evelynae lyrura Bahamas, Inagua
YPM 142568 6088 C. evelynae evelynae Bahamas, New Providence
YPM 142569 6089 C. evelynae evelynae Bahamas, New Providence
YPM 142570 6090 C. evelynae evelynae Bahamas, New Providence
YPM 142571 6091 C. evelynae evelynae Bahamas, New Providence
YPM 142572 6092 C. evelynae evelynae Bahamas, New Providence
YPM 142573 6093 C. evelynae evelynae Bahamas, New Providence
YPM 142574 6094 C. evelynae evelynae Bahamas, New Providence
YPM 141067 5241 Calothorax lucifer USA, Texas
YPM 142508 6043 Doricha enicura Guatemala, Solola
TABLE 5. The PCR primers used in this study.
Locus Primer name Primer sequence (50–30) Source
FGB I7 FIB-B17U GGAGAAAACAGGACAATGACAATTCAC Prychitko and Moore 1997
FGB I7 FIB-B17L TCCCCAGTAGTATCTGCCATTAGGGTT Prychitko and Moore 1997
AK1 I5 AK5b-inset GGCTACCCTCGCGAGGTGAAACAG McGuire et al. 2007
AK1 I5 AK5b-inset TGGTCTCTCCTCGCTTCAG McGuire et al. 2007
MT-ND2 H6313 CTCTTATTTAAGGCTTTGAAGGC Sorenson et al. 1999
MT-ND2 L5219 CCCATACCCCGAAAATGATG Sorenson et al. 1999
MT-ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC Arevalo et al. 1994
MT-ND4 LEU CATTACTTTTACTTGGATTTGCACCA Arevalo et al. 1994
ODC1 ODC2-F GCGTGCAAAAGAACTTGACC Parra et al. 2009
ODC1 ODC2-R AGCCACCACCAATATCAAGC Parra et al. 2009
MUSK I3 MUSKF3 GCTGTACTTCCATGCACTACAATG Benham 2012
MUSK I3 MUSKR3 ATCCTCAAATTTCCCGAATCAAG Benham 2012
TABLE 6. Specimens from McGuire et al. (2014) used in this study.
Institution Tissue no. Species Subspecies Country, province/state/island
LSUMZ 43113 Calothorax lucifer USA, New Mexico
KUNHM 611 Doricha eliza Mexico, Yucatan
UNAM B590 D. eliza Mexico, Yucatan
LSUMZ 21848 Archilochus alexandri USA, Texas
LSUMZ 5270 A. colubris USA, Louisiana
LSUMZ 58890 Calliphlox evelynae evelynae Bahamas, New Providence
LSUMZ 59204 C. evelynae evelynae Bahamas, New Providence
MVZ 183600 Mellisuga minima Jamaica, Portland Parish
MVZ 183602 M. minima Jamaica, Portland Parish
STRI JA-MMI1 M. minima Jamaica, Luana Point
The Auk: Ornithological Advances 132:248–264, Q2015 American Ornithologists’ Union
264 Species status of Calliphlox e. lyrura T. J. Feo, J. M. Musser, J. Berv, and C. J. Clark
