Content uploaded by Alberto Gomez
Author content
All content in this area was uploaded by Alberto Gomez on Nov 13, 2014
Content may be subject to copyright.
Phytologia (December 2011) 93(3)
388
PHYLOGENETIC RELATIONSHIPS AMONG GENERA OF
THE SUBTRIBE ONCIDIINAE (EPIDENDROIDEAE:
ORCHIDACEAE) AND A NEW GENUS: SANTANDERELLA
Sonia Quintanilla-Quintero
Instituto de Genética Humana, Facultad de Medicina, Pontificia
Universidad Javeriana, Bogotá, Colombia.
Cra 7 # 40-62, edificio 32, Bogotá D. C., 110231, Colombia
Pedro Ortiz
Iniciativa Genómica Javeriana, Pontificia Universidad Javeriana,
Bogotá, Colombia, Cra 7 # 40-62, edificio 32, Bogotá D. C., 110231,
and Asociación Bogotana de Orquideología, Avenida calle 63 # 68-95,
Bogotá D. C., Colombia. porval@gmail.com
Jaime E. Bernal and Alberto Gómez
Instituto de Genética Humana, Facultad de Medicina, Pontificia
Universidad Javeriana, Bogotá, Colombia.
Cra 7 # 40-62, edificio 32, Bogotá D. C., 110231, Colombia
ABSTRACT
Santanderella, a new genus of orchids from Colombia with the
type species, Santanderella amado-rinconiana, related to Macroclinium
and Notylia, is analyzed both at the phenotypic and genotypic levels.
Phylogenetic trees related to genomic matK-trnK and ITS1-5.8S-ITS2
sequences are presented to support the proposal of a new genus.
Phytologia 93(3):388-406 (December 1, 2011).
KEY WORDS: Orchidaceae, Oncidiinae, Santanderella, Colombia,
matK-trnK, ITS1-5.8S-ITS2.
An orchid plant belonging to the subtribe Oncidiinae (sensu R.
Dressler, 1981) and showing affinity with the genera Notylia Lindl. and
Macroclinium Barb. Rodr., was collected by Jonathan Amado in
Floridablanca, Santander, Colombia, and reported by Orlando Rincón in
2009 (Figure 1A).
Phytologia (December 2011) 93(3) 389
Figure 1A. Santanderella amado-rinconiana P. Ortiz. Comparison of
the columns of the three related genera: Notylia, Macroclinium and
Santanderella. Notice the peculiar shape of the column and the pollinia
of Santanderella.
A number of characters of this specimen showed affinity with
species of Notylia: the epiphytic, caespitose plant with unifoliate
pseudobulbs and conduplicate leaves, the many-flowered racemose
inflorescence, the rather large dorsal anther, the two pollinia with a thin
and elongated stipe, and the ventral stigma as a narrow, longitudinal
slit. Many of these characters are also found in the genus
Macroclinium. But at the same time, the structure of the column and the
pollinia, in addition to the characters of the sepals and petals, and
especially of the lip, presented marked differences when compared to
those of the close genera.
The plant we are dealing with has flowers that do not open
fully (which seems to be a general condition of all the plants of this
species seen by the collectors), with narrow sepals and petals, and a lip
Phytologia (December 2011) 93(3)
390
Figure 1B. Santanderella amado-rinconiana: a- Plant; b- Anther; c-
two elongated, laminar, concave and yellow pollinia, affixed to a stipe
with a triangular apex, then thin, 4 mm long; d- column, side and
ventral views; e- Flower; f- Sepals, petals and lip.
Phytologia (December 2011) 93(3) 391
that is different from all the “notyliiform” lips so far seen. It is very
narrow, with a pair of small rounded lobules at the base, then turns
narrow again, and then widens a little, with a subacute apex. There is no
callus. It reminds the flowers of Macroclinium. The column is relatively
short, with a basal part terete, and it widens apically into two obtuse,
irregular wings, which ventrally merge together forming an acute angle.
There is a clinandrium with rather high walls and inside the cavity the
rostellum stands out, which is thick and high at the base and extends
forward into a sharp point. The column does not bend backwards as in
most Notylia species, but is rather straight. On the ventral part of the
rostellum the stigma can be seen as a narrow slit. The anther is similar
to those of Notylia and Macroclinium. But the pollinia are most
remarkable. There are two pollinia, as in all of the Oncidiinae, but
unlike the pollinia of Notylia and Macroclinium, they are quite large
and elongated, flattened and concave. This type of pollinia, as far as we
know, is not found in any species of Notylia or Macroclinium. The
Oncidiinae genera close to Notylia have been defined and characterized
in different ways, as can be seen in the study published by Pupulin
(1997), to which we refer for further information. According to his
study, the main difference between Notylia and Macroclinium lies in the
shape of the leaves: dorso-ventrally flattened (Notylia) vs. laterally
flattened (Macrocliniuum). The leaves of Santanderella are dorso-
ventrally flattened, but are V-shaped.
We came to the conclusion that a new genus had to be
established to accomodate this new species and so, on the basis of the
phenotypic analysis, it was published in Orquideología (Medellín)
27(2): 167-178, 2011 (sub 2010) (Ortiz, 2011). Although establishing
monotypic genera is not ideal, we cannot stretch out the limits of the
genera to force incongruous elements into established genera. On the
other side, this is not the only monotypic genus within this group
(equally monotypic are Notyliopsis, Sarmenticola, Chelyorchis,
Hintonella, Hofmeisterella, and Schunkea).
We then proceeded to a molecular analysis to determine the
phylogenetic affinities of this eventual new genus with different
orchids, which have already been reported by us and others in GenBank
including: Santanderella amado-rinconiana, Macroclinium
xiphophorum, Notylia incurva, Notyliopsis beatricis, Oncidium
Phytologia (December 2011) 93(3)
392
(Trichocentrum) lanceanum, Oncidium ornithorhynchum, Oncidium
cultratum, Oncidium (Otoglossum) globuliferum, Oncidium fuscatum,
Brassia sp., Macradenia brassavolae, Trichocentrum pulchrum,
Oliveriana ortizii, Telipogon nervosus, Oncidium (Trichocentrum)
carthagenense.1
In the present study, we present the phylogeny of the new
genus Santanderella amado-rinconiana using plastid and nuclear
markers (matK-trnK and ITS1-5.8S-ITS2 sequences) and evaluate the
classification systems previously proposed by Ortiz (2011), based on
morphological characters.
MATERIALS AND METHODS
Taxon sampling
We first sampled 15 currently recognized species of the
subtribe Oncidiinae (Pridgeon, 2009) available on local crops that were
not previously reported in GenBank and performed phylogenetic
analysis comparing these genera with Santanderella amado-rinconiana
(Table 1). We only included matK-trnK and ITS1-5.8S-ITS2 sequences
of the closest taxa, according to the most recent classification of the
family (Chase et al, 2005), as can be seen on Table 2. The comparing
genera thus included the following: Macroclinium, Notylia and
Macradenia. Notyliopsis was selected as an outgroup, following the
principles stated by Felsenstein (1985) and Swofford (2002).
DNA extraction
Plant tissues were dried using silica gel and stored at 70°C
(Chase and Hills, 1991). DNA was extracted using a modified CTAB
protocol (Doyle and Doyle, 1987). Approximately 0.25 g of green
tissue was ground under a mortar and was transferred to a 1.5ml
eppendorf tube. Seven hundred microliters (µl) of hot (65°C) CTAB
buffer (0.02 M EDTA, 1.4M NaCl, 0.1 M Tris pH 8.0, 2% CTAB, 0.7%
1For an alternative nomenclature used recently by other authors
(included here in parenthesis), refer to the Kew webpage “World
Checklist of Selected Plant Families”, in: apps.kew.org/wcsp/home.do
Phytologia (December 2011) 93(3) 393
v/v DTT, 2% soluble PVP) was added. The slurry was incubated at
65°C for 30 min with occasional shaking, followed by extraction with
an equal volume of chloroform-isoamyl alcohol (24:1). Phases were
separated by centrifugation for 10 min at 16,000g. The aqueous phase
was removed and reextracted with chloroform-isoamyl alcohol. The
aqueous phase was removed again and two hundred ninety one µl of
isopropanol and forty µl of ammonium acetate 7.5 M were added,
gently mixed, and incubated at -20ºC overnight. The DNA was pelleted
at 20,000g for 5min. The pellet was washed briefly in 76% ethanol/
0.01 M sodium acetate and then centrifuged for 5 min. The supernatant
was removed; the pellet was air-dried and resuspended in100 µl of TE
Buffer (10m MTris, pH 8, 0,1 mM EDTA).
DNA amplification
When necessary, DNA was cleaned using a Pure Link PCR®
purification kit (Invitrogen, USA) according to manufacturer´s
instructions. A 1482 bp fragment from the 30 end of the matK-trnK
gene was amplified using primers 19F and 556R (Table 3) in the PCR.
Each PCR had a final volume of 100 µl and contained 10–20 ng of
genomic DNA, 200uM each dATP, dCTP, dTTP and dGTP, 2.5 mM
MgCl2, 0.5 uM forward (19F - 390F) and reverse (556R and 1326R)
primers, 1.25 U Taq DNA polymerase GO (Promega, USA) and 5 X of
buffer green of Taq DNA polymerase GO buffer (Promega, USA).
Cycling conditions were: initial melting at 94 °C for 5 min; 39 cycles of
94°C for 1min, 48.6°C for 1min, 72°C for 2 min; final extension was
set at 72 °C for 15 min.
The amplification of the nuclear internal transcribed spacer
(ITS) region sequences (also defined as ITS1-5.8S-ITS2) on the
following species was reported by ourselves on GeneBank: Notylia
incurva, Notyliopsis beatricis, Santanderella amado-rinconiana and
Macroclinium xiphophorum. Fifteen additional ITS sequences (7
Macroclinium sp. and 8 Notylia sp.) were included in our phylogenetic
analysis. The amplification of the ITS1-5.8S-ITS2 region was conducted
in a polymerase chain reaction (PCR) with the primer sequences
proposed by Sun (1994) (Table 4). The reagent PCR volume of 100μl
reactions contained: 5x Go taq Promega Buffer, 10 μl of bovine serum
albumine (BSA), 25mM MgCl2, 10 mM of each primer, 2 μl of
Promega Go Taq (5U/µl), 10mM of dNTPs, 4 μl of dimethyl sulfoxide
Phytologia (December 2011) 93(3)
394
(DMSO), genomic DNA (20 ng/µl) and 58 μl of water. The PCR
protocol included: one first step of initial denaturation 5 minutes
(95ºC), 30 cycles of 1 min denaturation (94ºC), 1 min annealing (54ºC),
and 2 min, 30 s elongation (72ºC), with two additional seconds
elongation per cycle and a final elongation step of 7 minutes (72ºC).
DNA sequencing
PCR products were purified using a QIAquick DNA Cleanup
System® (Qiagen, Germany) and sequenced using an ABI Prism
BigDye Terminator Cycle Sequencing Ready Reaction Kit® (Applied
Biosystems, USA), following the recommendations of the
manufacturer. The sequencing products were analyzed by an ABI 3100
Avant Sequencer® (Applied Biosystems, USA). The sequences were
assembled in Sequencher 3.0 (Gene Codes, Ann Arbor, Michigan,
USA) and aligned manually in MacClade v. 4.08 (Maddison &
Maddison, 2005). Gaps were coded separately and excluded from the
analyses. Regions with ambiguous alignments were also excluded.
Phylogenetic analysis
Maximum parsimony (MP) and maximum likelihood (ML)
analyses were performed in PAUP*, version 4.0b10 (Swofford, 2002).
MP and ML heuristic searches used 1,000 replicates of random taxon
stepwise-addition (retaining 20 trees at each replicate), tree bisection
reconnection (TBR) branch swapping, and equal weighting of all
characters. For ML searches, the best-fit model of nucleotide
substitution and model parameters were determined for matK-trnK and
for ITS using ModelTest 3.04 (Posada & Crandall, 1998); F81+I+G and
K81uf+I+G were respectively identified as the most appropriate models
of evolution for each of these data sets. Support was accessed with non-
parametric bootstrapping; heuristic searches with 1000 replicates for
MP and 100 replicates for ML were conducted using the same
parameters as described above. Clades with bootstrap support of 50–
74% were considered weakly supported, 75–89%, moderately
supported, and 90–100%, strongly supported.
Phytologia (December 2011) 93(3) 395
RESULTS
The data sets for ITS and matK-trnK sequences presented
different levels of variation and contained varied amounts of indels, as
can be seen on Table 5. Specific matK-trnK gene sequences were
generated for the new genus Santanderella amado-rinconiana, and for
Macroclinium xiphophorum, Notylia incurva, Notyliopsis beatricis,
Oncidium (Trichocentrum) lanceanum, Oncidium ornithorhynchum,
Oncidium cultratum, Oncidium (Otoglossum) globuliferum, Oncidium
fuscatum, Brassia sp, Macradenia brassavolae, Trichocentrum
pulchrum, Oliveriana ortizii, Telipogon nervosus, Oncidium
(Trichocentrum) carthagenense. Sequences are available in GenBank
(accession numbers provided in Table 1). Data in the combined data set
(ITS and matK-trnK) contained several small gaps (up to 20 bp in
length) and an aligned matrix with 1611 characters. MP analysis for this
marker resulted in 6478 trees of 749 steps with a CI of 0.52 and a RI of
0.73; overall, 17.9% of the sites included in the analyses were
informative (Table 5).
ITS sequences were obtained for Santanderella amado-
rinconiana, Notyliopsis beatricis, Macroclinium xiphophorum and
Notylia incurva. The corresponding MP search resulted in 3,414 trees
of 179 steps (CI=0.65; RI=0.75). The aligned matrix resulted in 558
characters of which 7.9% were parsimony informative (Table 5). The
ML search led to a single tree with -lnL = 1807.26573. The topologies
obtained through the MP and ML analyses were congruent with respect
to all strongly supported clades. The ILD (P=0.001) and Templeton
tests (rival tree ITS, p<0.0001; rival tree plastid, p=0.34) suggested that
the matK-trnK data set is incongruent with ITS. Furthermore, several
contradictory relationships were found between the matK-trnK and ITS
topologies (data not shown). Hence, ITS data sets were analyzed in
combination with matK-trnK data sets through MP and ML analyses.
Phylogenetic relationships among species were consistent in both ML
and MP phylograms (Figures 2 and 3).
In the first step, matK-trnK and ITS sequences were used to
perform a broader analysis on representatives of all Orchidaceae to test
the monophyly of Oncidiinae, and also to explore their position within
Phytologia (December 2011) 93(3)
396
Figure 2. Maximum likelihood phylogram based on combined matK-
trnK and ITS data.
Phytologia (December 2011) 93(3) 397
Figure 3. Maximum parsimony (MP) strict consensus topologies,
combined analysis between matK-trnK and ITS sequences in the genera
of the subtribe Oncidiinae close to Santanderella. Maximum parsimony
bootstrap values are shown above branches.
Phytologia (December 2011) 93(3)
398
the family performed on all the genera included in the phylogenetic
three published by Chase (2005) (Table 1, Figures 2 and 3).
Subsequently, more restricted analyses were performed in order to
compare separately Macroclinium, Notylia, Macradenia, Notyliopsis
and Santanderella based on their ITS 1-2 and matK-trnK sequences,
then Santanderella amado-riconiana and Notylia were compared on
their ITS and matK-trnK sequences and, finally, Santanderella amado-
riconiana was compared to Macroclinium based on their ITS1-ITS2 and
matK-trnK sequences (data not shown). Every phylogram confirmed
the monophyly of the new genus Santanderella amado-riconiana.
Restricted analyses of both matK-trnK and ITS sequences were
performed in order to compare separately Santanderella amado-
rinconiana with each taxonomic subgroup. When matK-trnK sequences
were compared within the genus Notylia, we found that Notyliopsis
beatricis, Notylia venezuelana and Santanderella amado-rinconiana
appear as outgroups. In contrast, when matK-trnK sequences were
compared within the genus Macroclinium, only Santanderella amado-
rinconiana appears as an outgroup (data not shown).
When only matK-trnK sequences of Santanderella were
compared within a wider sample population which included
Macroclinium, Notylia, Macradenia and Notyliopsis, no clear-cut
distinction was found between species belonging to those genera.
However, four species, namely Santanderella amado-rinconiana,
Notyliopsis beatricis, Macradenia brassavolae and Notylia sp. appeared
to correspond to outgroups in this phylogeny. In the central clades a
Macradenia species appeared to be closely related to Macroclinium
chasei and Macroclinium alleniorum (data not shown).
Moreover, when ITS sequences from Santanderella were
compared within Macroclinium, Notylia, Macradenia and Notyliopsis,
both Santanderella amado-rinconiana and Notyliopsis beatricis
appeared as outgroups. When nuclear genetic markers were compared,
a clearer distinction was found between species belonging to the genera
Notylia and Macroclinium which now appear clearly monophyletic
(data not shown).
Phytologia (December 2011) 93(3) 399
Furthermore, we incorporated additional analysis with a
combined sequences (ITS and matK-trnK) in a pooled analysis with
the most related genera that were included in the phylogenetic three
published by Chase (2005) based on matK-trnK sequences. We then
selected Maxilaria aciantha as an outgroup, and we confirmed the
particularity of two specific genera, namely Santanderella amado-
rinconiana and Notyliopsis beatricis, as compared to the other species
of the subtribe Oncidiinae belonging to Macroclinium, Macradenia and
Notylia. These two apparently monophyletic genera appeared on an
outside cluster in relation to other monophyletic genera in this
phylogeny both by the ML and MP approaches (Figures 2 and 3).
DISCUSSION
In this study, we used one plastid molecular marker (matK-trnK) and a
nuclear data set (ITS) to investigate phylogenetic relationships within
the subtribe Oncidiinae and genera more closely associated to the new
genus proposed as Santanderella (Ortiz, 2011). The ITS1-5.8S-ITS2
markers produced congruent topologies while matK-trnK topologies
suggested a slightly different scenario than the one recovered with the
nuclear data. In the following paragraphs, we discuss the results from
phylogenetic analyses, differences between the ITS and plastid
topologies, and the implications of this results for the systematics of the
new genus Santanderella.
Literature of molecular systematics of orchids is growing as
can be seen in previously published reports (Pridgeon et al, 2001;
Salazar et al, 2009) and also on GenBank databases, where 4710
sequences belonging to Oncidiinae have been reported on 793 species
belonging to 73 genera, including 15 new species reported by
ourselves. The results revealed that neither Macroclinium, Macradenia,
Notylia and Notyliopsis show molecular phylogenetic affinity with
Santanderella amado-rinconiana. However, as we consider that
molecular phylogenetic affinity to determine a taxonomic category has
to include phenotypic considerations, we combined phenotypic and
genotypic criteria for the description and classification of this new
genus.
Phytologia (December 2011) 93(3)
400
The molecular approach confirms our first impression based
on phenotypic characters, as the specimen proposed as a new genus
(Ortiz, 2011) appears indeed isolated on a different branch both by
matK-trnK and ITS maximum parsimony strict consensus topologies,
with bootstrap values over 90 and posterior probability values over
0.90. On this grounds, lumping Santanderella amado-rinconiana, and
also Macroclinium chasei and Macroclinium alleniorium, or even the
genera Notylia, Notyliopsis, Macroclinium and Macradenia as has been
suggested as an ultimate option (F. Pupulin and M. Chase, personal
communications), would seem inappropriate, specially if the studies
based in morphological characters such as the one reported by Pupulin
(1997) on the phylogeny of Macroclinum are taken into consideration.
In this case, Macroclinium chasei appears linked only by a doted line to
the main branch of this taxonomic group. Other genera in Oncidiinae
are being subjected to taxonomic transfers (Chase and Whitten, 2011),
while a word of caution has been proposed on further studies of
phylogenetic delimitation in plants before a world-wide consensus is
reached (Vanderpoorten and Shaw, 2010).
Nevertheless, our results strongly support our hypothesis of a
new genus for Santanderella amado-rinconiana, as an option to clarify
the diversity of orchids within the Oncidiinae subgroup, both at the
phenotypic and genotypic levels. We have demonstrated a clear
genotypic and phenotypic separation of Santanderella against both
Notylia and Macroclinium, further supporting the validity and
specificity of Santanderella as based on its long branch (reflecting its
clear morphological identity) compared to the other segregate genera
sampled.
As stated in the introduction, establishing monotypic genera is
not ideal. However, as we cannot stretch out the limits of the genera to
force incongruous phenotypic elements into established genera, we also
conclude that the presence of monotypic genus within this group
(Notyliopsis, Sarmenticola, Chelyorchis, Hintonella, Hofmeisterella,
Schunkea and Santanderella) implicates the existence of multiple
segregate (most likely oligospecific) genera in the vicinity of the
Notylia and Macroclinium “clade”. The need to accept a new genus is
thus based on its clear genetic differentiation from these segregate
genera, but also because of its discrete and patent morphological
Phytologia (December 2011) 93(3) 401
identity, worthy of constituting a new generic entity. As stated by some
researchers (Santiago Madriñán, personal communication), this is the
case of numerous examples in systematics, where speciose
monophyletic groups characterized by clear autoapomorphies are
accompanied by a grade of oligospecific groups –each with its own
autoapomorphy–, which cannot be included in the larger groups
diluting their identity as to the characters that allow their recognition,
and which cannot be placed within a single entity due to their non
monophyly.
ACKNOWLEDGEMENTS
This research was supported by the Instituto de Genética
Humana (IGH) from the Pontificia Universidad Javeriana (Bogotá,
Colombia) with resources from the project “Expedición Botánica
Molecular: Fase I” and the “Iniciativa Genómica Javeriana”. We would
like to acknowledge particularly helpful discussions with Mark Chase,
Franco Pupulin and Santiago Madriñán on preliminary versions of our
work, as well as the administrative assistance of Marisol Machetá at the
IGH.
LITERATURE CITED
Chase, M., Hanson, L., Albert, V. A., Whitten, W. M. and Williams, N.
H. 2005. Life history and genome size in subtribe Oncidiinae
(Orchidaceae). Annals of Botany 95(1):191-199.
Chase, M. and Hills, H. 1991. Silica gel: an ideal material for field
preservation of leaf samples for DNA studies. Taxon 40: 215-220.
Chase, M. and Whitten, M. 2011. Further taxonomic transfers in
Oncidiinae (Orchidaceae). Phytotaxa 20: 26-32.
Doyle, J. A. and Doyle, J. L. 1987. A rapid DNA isolation procedure for
small quantities of fresh leaf tissue. Phytochemistry 19: 11-15.
Dressler, R. L. 1981. The Orchids. Natural history and classification.
Cambridge, Massachussetts, Harvard University Press, p. 211-225.
Farris, J. S., Källersjö, M., Kluge, A. G. and Bult, C. 1994. Testing the
significance of incongruence. Cladistics 10: 315-319.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39: 783-791
Phytologia (December 2011) 93(3)
402
GenBank. In: www.ncbi.nlm.nih.gov/genbank. Consulted on 23-03-
2011.
Huelsenbeck, J. P. and Ronquist, F. R., 2001. MRBAYES: Bayesian
inference of phylogeny. Bioinformatics 17, 751-755.
Jukes, T. H. and Cantor, C. R. 1969 Evolution of protein molecules. In:
Munro H. N. Mammalian Protein Metabolism, pp. 21-132,
Academic Press, New York.
Kimura, M. 1981.Estimation of evolutionary distances between
homologous nucleotide sequences. Proceedings of the National
Academy of Sciences. USA 78, 454-458.
Maddison, D. R. and Maddison, W. P. 2005. MacClade 4: Analysis of
Phylogeny and Character Evolution, Version 4.08. Sinauer
Associates, Sunderland, Massachusetts.
Nei, M. and Kumar, S. 2000. Molecular Evolution and Phylogenetics.
Oxford University Press, New York.
Ortiz V., P. 2011 (sub 2010). Santanderella, a Colombian new genus in
the Oncidiinae (Orchidaceae). Orquideología XXVII (2): 167-178.
Posada, D. and Crandall, K. A. 1998. Modeltest: testing the model of
DNA substitution. Bioinformatics 14: 817-818.
Pridgeon, A. M., Solano, R., and Chase, M. 2001. Phylogenetic
relationships of Pleurothallidinae (Orchidaceae): combined
evidence from nuclear and plastid DNA sequences. American
Journal of Botany 88: 2286-2308
Pridgeon, A. M., Cribb, P. J., Chase M. W. and Rasmussen F. N. 2009.
Genera Orchidacearum 5, Part 2. Oxford University Press, Oxford,
UK.
Pupulin, F. 1997. Una sinossi del genere Macroclinium (Orchidaceae:
Oncidiinae) Caesiana 9: 1-20.
Quintanilla, S. R., Ortiz, P., Bernal, J. E. and Gómez, A. 2010.
Molecular characterization and phylogenetic relationships among
genera of the subtribe Oncidiinae (Epidendroideae: Orchidaceae)
and a new genus tentatively called "Santanderella". Botany
Conference 2010. Providence, Rhode Island, USA, July 31-August
4.
Ronquist, F. and Huelsenbeck, J. P. 2003. MRBAYES3: Bayesian
phylogenetic inferenceunder mixed models. Bioinformatics 19:
1572-1574.
Salazar G. A., Cabrera L. I., Madriñán S. and Chase M. 2009.
Phylogenetic relationships of Cranichidinae and Prescottiinae
Phytologia (December 2011) 93(3) 403
(Orchidaceae, Cranichideae) inferred from plastid and nuclear
DNA sequences. Annals of Botany 104(3): 403-416.
Senghas, K. 1996. Subtribus: Notyliinae in R. Schlechter, Die
Orchideen, I/C, 3rded. (Berlin, PareyBuchverlag). pp. 1977-1944;
Nachträge: 73. Notyliinae: pp. 2794-2797.
Sun, Y., Skinner, D. Z, Liang G. H. and Hulbert, S. H. 1994.
Phylogenetic analysis of Sorghum and related taxa using internal
transcribed spacers of nuclear ribosomal DNA. Theoretical and
Applied Genetics 89: 26-32.
Swofford, D. 2002 PAUP*. Phylogenetic Analysis Using Parsimony
(*and Other Methods). Version 4.0. Sinauer Associates,
Sunderland, Massachussetts.
Thompson, D., Gibson, J., Plewniak, F., Jeanmougin, F. and Higgins, G.
1997. The CLUSTAL X windows interface: flexible strategies for
multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 25: 4876-4882.
Vanderpoorten, A. and Shaw, J. 2010. The application of molecular data
to the phylogenetic delimitation of species in briophytes: A note of
caution. Phytotaxa 9: 229-237.
Phytologia (December 2011) 93(3)
404
Table 1. Sampling of taxa to Oncidiinae used in this study available on
local crops that were not previously reported in GenBank. Voucher
numbers cited correspond to specimens with which our specimens
were compared and validated.
Taxon GenBank
accession
number Source; locality Voucher
Oncidiinae sp
[Santanderella amado-
rinconiana] HQ219251.1
Orlando Rincon (isotype)
- Floridablanca
(Santander)
P. Ortiz 1335
(HPUJ)
Macrocliniumxiphophorum HQ219252.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz 4358
(HPUJ)
Notylia incurva HQ219253.1 Arturo José Carrillo -
Villeta (Cundinamarca)
G. Misas 214b
(HPUJ)
Notyliopsisbeatricis HQ219254.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz 1061
(HPUJ)
Oncidium (Trichocentrum)
lanceanum HQ219255.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz s.n.
(HPUJ)
Oncidiumornithorhynchum HQ219256.1 Roberto Carrascal -
Bogotá D.C.
P. Ortiz 110
(HPUJ)
Oncidiumcultratum HQ219257.1 Roberto Carrascal -
Bogotá D.C.
P. Ortiz 187
(HPUJ)
Oncidium (Otoglossum)
globuliferum HQ219258.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz 54
(HPUJ)
Oncidiumfuscatum HQ219259.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz 436
(HPUJ)
Brassia sp HQ219260.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz 4210
(HPUJ)
Macradeniabrassavolae HQ219250.1 Arturo José Carrillo -
Villeta (Cundinamarca)
P. Ortiz 895
(HPUJ)
Trichocentrumpulchrum HQ219261.1 Roberto Carrascal -
Bogotá D.C.
P. Ortiz 702
(HPUJ)
Oliverianaortizii HQ219262.1 Luis Eduardo Alvarez -
Arcabuco (Boyacá)
P. Ortiz 101
(COL)
Telipogonnervosus HQ219263.1
Luis Eduardo Álvarez -
Guatavita
(Cundinamarca)
P. Ortiz 970
(HPUJ)
Oncidium (Trichocentrum)
carthagenense HQ219264.1 SócratesForero - Silvania
(Cundinamarca)
P. Ortiz 143
(HPUJ)
Phytologia (December 2011) 93(3) 405
Tab le 2. Oncidiinae taxa used in the phylogenetic analysis of matK-
trnK and ITS1-5.8S-ITS2 sequence data. N. A.: Not available.
Taxon matK-trnK ITS1-5.8S-
ITS2
Macroclinium aurorae Whitten 3005 FJ565118.1 FJ565626.1
Macroclinium dalstroemii Whitten 2509 FJ565072.1 FJ565585.1
Macroclinium sp. Dressler 6349. FJ565437.1 FJ564931.1
Macroclinium xiphophorum isolate P.
Ortiz HQ219252.1 JN189789
Macroclinium bicolor AF350629.1 AF350550.1
Macroclinium robustum Gerlach 93/3019
M FJ563935.1 FJ565344.1
Macroclinium alleniorum EF079188.1 EF079399.1
Notylia sp. Whitten 1530 FJ564966.1 FJ565482.1
Notylia pittieri FJ565181.1 FJ564701.1
Notylia ecuadorensis Whitten FJ565477.1 FJ564961.1
Notylia sp. Trujillo 427 FJ564752.1 FJ565240.1
Notylia incurva isolate G. Misas 214b HQ219253.1 JN189790
Santanderella amado-rinconiana P. Ortiz
1335 HQ219251.1
JN189792
Notyliopsis beatricis P.Ortiz 1061 HQ219254.1 JN189791
Notylia sp. Whitten 1544 FJ564966.1 FJ565482.1
Notylia barkeri Whitten 3445 FJ565300.1 AF350624.1
Notylia albida Whitten 2823 FJ565613.1 FJ565105.1
Notylia venezuelana EF079193.1 EF079397.1
Macradenia tridentata Hirtz 8 FJ565405.1 FJ564896.1
Macradenia rubescens Gerlach FJ564839.1 FJ565345.1
Macradenia brassavolae Chase O-166 K FJ563854.1 FJ565220.1
Gomesa sp. Pansarin 968 FJ564919.1 FJ565426.1
Maxillaria aciantha DQ209876.1 DQ210296.1
Schunkea vierlingii Gerlach 0-21958 M FJ563933.1 FJ565340.1
Warmingia eugenii Williams N192 FJ563905.1 FJ565285.1
Warmingia zamorana Hirtz 7291 FJ563944.1 FJ565369.1
Seegeriella pinifolia Gerlach 0-22556 M FJ564829.1 FJ565339.1
Sutrina garayi Gerlach 0-22308 M FJ564828.1 FJ565338.1
Ionopsis utricularioides Whitten 2346 FJ565042.1 FJ565557.1
Comparettia falcata Whitten 2688 FJ565090.1 FJ565601.1
Scelochilus sp. Luis Mendoza s.n. EF079192.1 EF079394.1
Rodriguezia batemanii Whitten 1615 FJ564975.1 FJ565491.1
Phytologia (December 2011) 93(3)
406
Tab le 3. matK-trnK forward and reverse primer sequences, fragment
length sequenced, and location within matK-trnK.
for/rev matK-trnK
primers sequence length location
390F/ CGATCTATTCATTCAATATTTC
1326R TCTAGCACACGAAAGTCGAAGT 936 bp 2962-3897
19F/ CGTTCTGACCATATTGCACTATG
556R GAAGAAACATCTTTGATCCA 614
bp 2488-3101
Tab le 4. ITS1-5.8S-ITS2 forward and reverse primer sequences,
fragment length sequenced, and location within ITS.
ITS
primers sequence length location
17SE/ ACGAATTCATGGTCCGGTGAAGTGTTCG
26SE TAGAATTCCCCGGTTCGCTCGCCGTTAC 724 bp 18S-26S
rRNA
Table 5. Characterization of DNA sequences and parsimony analyses
conducted for each molecular marker used in this study.
Marker comparisons:
Informative sites
Marker bp excl. gaps no. % total % excl. gaps
ITS 724 558 44 6 7.9
matK-trnK 1436 1194 119 7.9 10
combined 2180 1611 163 13.9 17.9
Tree analyses:
Best # most Consistency
tree parsimonious index (excl. un- Retention
Marker length trees informative) index
ITS 179 3141 0.65 0.82
matK-trnK 412 9543 0.43 0.75
combined 749 7678 0.52 0.73
