No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Structural Basis for Double-Stranded RNA Processing by Dicer
Abstract
The specialized ribonuclease Dicer initiates RNA interference by cleaving double-stranded RNA (dsRNA) substrates into small fragments about 25 nucleotides in length. In the crystal structure of an intact Dicer enzyme, the PAZ domain, a module that binds the end of dsRNA, is separated from the two catalytic ribonuclease III (RNase III) domains by a flat, positively charged surface. The 65 angstrom distance between the PAZ and RNase III domains matches the length spanned by 25 base pairs of RNA. Thus, Dicer itself is a molecular ruler that recognizes dsRNA and cleaves a specified distance from the helical end.
... It must be emphasized that not all Dicer proteins contain all three helicase subdomains, and some may not contain the helicase domain at all. For example, miRNA-generating Dicer-1 from Drosophila melanogaster has a degenerated HEL1 subdomain, which is not capable of ATP hydrolysis [19], the Dicer-type protein from fungus Magnaporthe oryzae does not have the HEL2i subdomain [20], whereas Giardia intestinalis Dicer does not contain the helicase domain [21]. Moreover, the presence of the DExD/H-box and RIG-I motifs does not guarantee that the protein will have the ability to unwind dsRNA or dsDNA, or to translocate. ...
... However, as indicated in Figure 6, substrates with double-stranded regions are poorly bound by HEL. To further test the hypothesis that HEL can rearrange the structure of interacting RNAs, we performed the HEL binding assay using a substrate that cannot adopt a secondary structure: a 42-mer composed of (CU) 21 repeats. This time, with increased HEL concentration, we noticed clear distinct bands correlating to RNA•HEL complexes, and no appearance of the fast migrating conformers ( Figure 8D). ...
... GCTTATCAGACTGATGTTGAAA f.miR-16-1-5p GCACGTAAATATTGGCGAA (CU) 21 CUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCUCU *R30 serves as a complementary strand to R30_over and R30_blunt to form dsRNAs with a 2-nt 3ʹ overhang or a blunt end, respectively. ** D30 serves as a complementary strand to D30_over and D30_blunt to form dsDNAs with a 2-nt 3ʹ overhang or a blunt end, respectively. ...
Dicer ribonucleases are best known for their important role in microRNA and small interfering RNA biogenesis. They may also be involved in chromatin structure remodeling, apoptotic DNA degradation or production of damage-induced small RNAs, which implies that Dicer proteins can interact with many different RNA and DNA substrates. Most Dicers are multi-domain proteins. The here presented studies focus on the human Dicer (hDicer) helicase domain. The hDicer helicase contributes to recognizing pre-miRNA substrates and is suggested to participate in binding of many different cellular RNAs. However, a comprehensive characterization of the biochemical activities and substrate specificity of the hDicer helicase towards different nucleic acids have never been reported. We demonstrate for the first time that the full-length hDicer, through its helicase domain, is capable of ATP hydrolysis. We also show that the hDicer helicase binds only single-but not double-stranded nucleic acids, and that binding of single-stranded RNAs is accompanied by the rearrangement of their structure. The hDicer helicase does not require ATP hydrolysis for this RNA rearrangement activity. Given the documented importance of the hDicer helicase in antiviral defense, the obtained results may contribute to a better understanding of viral diseases and the role of hDicer in virus-host interactions.
... The rigid core of Dicer-related enzymes ( Fig 1B) is formed by an intramolecular dimer of two RNase III domains, which resembles a bacterial RNase III dimer (Zhang et al, 2004;MacRae et al, 2006). Each RNase III domain of Dicer cleaves one strand of the substrate (also known as "dicing"). ...
... The PAZ domain is an RNA-binding domain found in Dicer and Argonaute proteins (Lingel et al, 2004;Ma et al, 2004). In Dicer, PAZ is a dsRNAbinding element MacRae et al, 2006) that anchors one end of the substrate. The PAZ domain is present in animal and plant Dicers as well as in Dicer of Giardia intestinalis (MacRae et al, 2006), a flagellated unicellular parasite. ...
... In Dicer, PAZ is a dsRNAbinding element MacRae et al, 2006) that anchors one end of the substrate. The PAZ domain is present in animal and plant Dicers as well as in Dicer of Giardia intestinalis (MacRae et al, 2006), a flagellated unicellular parasite. The low sequence conservation of the PAZ domain impedes its recognition by sequence homology analysis with Dicers from the fungi Schizosaccharomyces pombe and Neurospora crassa (Colmenares et al, 2007;Vetukuri et al, 2011;Paturi & Deshmukh, 2021). ...
RNase III Dicer produces small RNAs guiding sequence-specific regulations, with important biological roles in eukaryotes. Major Dicer-dependent mechanisms are RNA interference (RNAi) and microRNA (miRNA) pathways, which employ distinct types of small RNAs. Small interfering RNAs (siRNAs) for RNAi are produced by Dicer from long double-stranded RNA (dsRNA) as a pool of different small RNAs. In contrast, miRNAs have specific sequences because they are precisely cleaved out from small hairpin precursors. Some Dicer homologs efficiently generate both, siRNAs and miRNAs, while others are adapted for biogenesis of one small RNA type. Here, we review the wealth of recent structural analyses of animal and plant Dicers, which have revealed how different domains and their adaptations contribute to substrate recognition and cleavage in different organisms and pathways. These data imply that siRNA generation was Dicer's ancestral role and that miRNA biogenesis relies on derived features. While the key element of functional divergence is a RIG-I-like helicase domain, Dicer-mediated small RNA biogenesis also documents the impressive functional versatility of the dsRNA-binding domain.
... RNA silencing relies on specific and efficient processing of double-stranded RNA by Dicer, which yields microRNAs (miRNAs) and small interfering RNAs (siRNAs) 1,2 . However, our current knowledge of the specificity of Dicer is limited to the secondary structures of its substrates: a double-stranded RNA of approximately 22 base pairs with a 2-nucleotide 3′ overhang and a terminal loop [3][4][5][6][7][8][9][10][11] . Here we found evidence pointing to an additional sequence-dependent determinant beyond these structural properties. ...
... Our analyses revealed a deeply conserved cis-acting element, termed the 'GYM motif' (paired G, paired pyrimidine and mismatched C or A), near the cleavage site. The GYM motif promotes processing at a specific position and can override the previously identified 'ruler'-like counting mechanisms from the 5′ and 3′ ends of pre-miRNA [3][4][5][6] . Consistently, integrating this motif into short hairpin RNA or Dicer-substrate siRNA potentiates RNA interference. ...
... In human, DICER is known to recognize its substrates by relying solely on their secondary structural features, such as the 2-nt 3′ overhang, a dsRNA stem of about 22 base pairs (bp) and a terminal loop [3][4][5][6][7][8][9][10][11] . According to the current model, DICER acts as a 'molecular ruler' that measures 22 nt from the ends of pre-miRNA 3-6 (Extended Data Fig. 1a). ...
RNA silencing relies on specific and efficient processing of double-stranded RNA by Dicer, which yields microRNAs (miRNAs) and small interfering RNAs (siRNAs)1,2. However, our current knowledge of the specificity of Dicer is limited to the secondary structures of its substrates: a double-stranded RNA of approximately 22 base pairs with a 2-nucleotide 3′ overhang and a terminal loop3–11. Here we found evidence pointing to an additional sequence-dependent determinant beyond these structural properties. To systematically interrogate the features of precursor miRNAs (pre-miRNAs), we carried out massively parallel assays with pre-miRNA variants and human DICER (also known as DICER1). Our analyses revealed a deeply conserved cis-acting element, termed the ‘GYM motif’ (paired G, paired pyrimidine and mismatched C or A), near the cleavage site. The GYM motif promotes processing at a specific position and can override the previously identified ‘ruler’-like counting mechanisms from the 5′ and 3′ ends of pre-miRNA3–6. Consistently, integrating this motif into short hairpin RNA or Dicer-substrate siRNA potentiates RNA interference. Furthermore, we find that the C-terminal double-stranded RNA-binding domain (dsRBD) of DICER recognizes the GYM motif. Alterations in the dsRBD reduce processing and change cleavage sites in a motif-dependent fashion, affecting the miRNA repertoire in cells. In particular, the cancer-associated R1855L substitution in the dsRBD strongly impairs GYM motif recognition. This study uncovers an ancient principle of substrate recognition by metazoan Dicer and implicates its potential in the design of RNA therapeutics.
... Dicer homologues are found throughout eukaryotes and show substantial diversity in their substrate specificity and mechanism of action. Some Dicer proteins are specific to long dsRNAs, as observed in structural and biochemical studies on Giardia Dicer, fly Dicer-2 (Dcr-2) and plant Dicer-like proteins [7][8][9][10][11][12] . By contrast, other homologues, such as fly Dicer-1 (Dcr-1), are highly selective to hairpin-shaped pre-miRNAs 13 . ...
... hDICER recognizes several features of its substrates: a dsRNA stem of approximately 22 bp; a 2-nt 3′ overhang; and a flexible loop next to the cleavage site 7,12,13,[16][17][18][19] . The flexible loop is known to be sensed by the helicase domain 13,14 , whereas the 5′ phosphorylated end and the 3′ overhang are recognized by basic pockets in the platform and the PAZ (Piwi-Argonaute-Zwille) domains, respectively 16,17,20 . ...
... The flexible loop is known to be sensed by the helicase domain 13,14 , whereas the 5′ phosphorylated end and the 3′ overhang are recognized by basic pockets in the platform and the PAZ (Piwi-Argonaute-Zwille) domains, respectively 16,17,20 . By anchoring the termini, hDICER can act as a 'molecular ruler' to measure around 22 nt away from the 5′ end ('5′ counting rule') and 3′ end ('3′ counting rule') of the substrate 7,12,16,17 . In addition, the GYM motif at the cleavage site enables the cleavage site to be precisely determined (see the partner paper to this one 3 ). ...
Dicer has a key role in small RNA biogenesis, processing double-stranded RNAs (dsRNAs)1,2. Human DICER (hDICER, also known as DICER1) is specialized for cleaving small hairpin structures such as precursor microRNAs (pre-miRNAs) and has limited activity towards long dsRNAs—unlike its homologues in lower eukaryotes and plants, which cleave long dsRNAs. Although the mechanism by which long dsRNAs are cleaved has been well documented, our understanding of pre-miRNA processing is incomplete because structures of hDICER in a catalytic state are lacking. Here we report the cryo-electron microscopy structure of hDICER bound to pre-miRNA in a dicing state and uncover the structural basis of pre-miRNA processing. hDICER undergoes large conformational changes to attain the active state. The helicase domain becomes flexible, which allows the binding of pre-miRNA to the catalytic valley. The double-stranded RNA-binding domain relocates and anchors pre-miRNA in a specific position through both sequence-independent and sequence-specific recognition of the newly identified ‘GYM motif’³. The DICER-specific PAZ helix is also reoriented to accommodate the RNA. Furthermore, our structure identifies a configuration of the 5′ end of pre-miRNA inserted into a basic pocket. In this pocket, a group of arginine residues recognize the 5′ terminal base (disfavouring guanine) and terminal monophosphate; this explains the specificity of hDICER and how it determines the cleavage site. We identify cancer-associated mutations in the 5′ pocket residues that impair miRNA biogenesis. Our study reveals how hDICER recognizes pre-miRNAs with stringent specificity and enables a mechanistic understanding of hDICER-related diseases.
... After export to the cytoplasm, pre-miRNAs maturation proceeds with DICER cleavage to produce small RNA duplexes, the miRNAs. Like DROSHA, DICER is a member of the RNAse III family and it specifically hydrolyzes phosphodiester bonds found in double-stranded RNAs, generating 21-25 nucleotides long products having 5'-phosphate, 3'-hydroxyl and 2-nt 3'-overhangs (Macrae et al., 2006). ...
... A crystal of full-length mammalian DICER is not yet available and, so far, its structure has been inferred from numerous biochemical studies (E. , comparison with DICER homologous proteins (Macrae et al., 2006) and crystallographic structure analyses of separate domains (Du et al., 2008;J.-B. Ma et al., 2004;Takeshita et al., 2007). ...
... It contains a highly conserved 3' overhang binding pocket to specifically anchor the two-nucleotide 3' overhang of the RNA duplexes and it seems to be involved in the transfer of cleaved RNA to the PAZ domain of Argonaute in the RISC (J.-B. Ma et al., 2004;Macrae et al., 2006) . In particular, it was shown that modification of the 3' overhang structure of the target RNA duplexes leads to significant reduction of DICER cleavage and RNAi efficiency Harborth et al., 2003). ...
Nuclear Factor 90 (NF90) is a double-stranded RNA-binding protein (RBP) found in both the nucleus and the cytoplasm that is involved in a plethora of different cellular processes and pathways, such as transcription, splicing, translation and mRNA stability or degradation. For this reason, NF90 compartmentalization and shuttling from the nucleus to the cytoplasm is a very important and strictly controlled process, guided by several stimuli such as viral infection or hypoxia. With this PhD we analyzed the role of NF90 in the microRNA (miRNA) biogenesis, in the nucleus, and its role in translational control and messenger RNA (mRNA) stability, in the cytoplasm.In the nucleus, NF90 was recently shown to be involved in miRNA biogenesis regulation by negatively affecting the Microprocessor activity. However, this mechanism, which our lab previously linked to ovarian carcinoma progression and metastasis, is not fully understood. Here, we show the extent of NF90-mediated pri-miRNA regulation in hepatocellular carcinoma (HCC), for which NF90 is associated with poor prognosis. Genome-wide approaches revealed that NF90 increases the abundance of 286 miRNAs in HepG2 cell line. Of these, 22 pri-miRNAs are directly associated with NF90 through their stem region, in a manner that is largely exclusive of Microprocessor. NF90-targeted pri-miRNAs are mainly intronic, highly stable and have lower free energy and fewer mismatches compared to all human pri-miRNAs. A group of mRNAs hosting NF90-bound and modulated pri-miRNAs were significantly downregulated after loss of NF90 or showed splicing defects in the introns containing the pri-miRNAs. These findings suggest that NF90 is involved in the biogenesis of a subset of highly stable, intronic miRNAs.In the cytoplasm, NF90 was shown to bind mRNAs, which increases their stability or influences their translation. However, the exact mechanism is still largely unknown. Here, we show that NF90 interacts with RBPs involved in RNA-induced silencing complex (RISC)-mediated silencing, such as Moloney leukemia virus 10 (MOV10) and Argonaute 2 (Ago2), in an RNA-dependent manner. Upon glycerol gradient sedimentation, we found that NF90, MOV10 and Ago2 can be found in the same complex in HEK293T cell line. Using published data of NF90 and MOV10 enhancedcrosslinkingimmunoprecipitation(eCLIP)and individual-nucleotide-resolution UV crosslinking (iCLIP), respectively, we identified a subset of mRNAs that can be bound by both NF90 and MOV10 in the 3’UTR. RNA immunoprecipitation (RIP) analyses suggest that the binding of MOV10 to target mRNAs might prevent or reduce the binding of NF90 on the same targets, and vice versa. Moreover, loss of NF90 increased association of Ago2 to the target mRNAs while reducing their abundance. These findings suggest that NF90 might have a role in RISC-mediated silencing by modulating Ago2 association with mRNAs and thereby enhancing their stability.
... RNAi was initially found in the nematode Caenorhabditis elegans, and subsequent studies demonstrated that the process exists in plants, fungi and metazoans [5][6][7] . External dsRNA is transported into cells and is processed by intracellular Dicer family enzymes into short-interfering RNAs (siRNAs) or microRNAs (miRNAs) [8][9][10] , which guide the sequence-specific recognition of mRNA that leads to mRNA degradation and translation inhibition 11-13 . Intriguingly, RNAi in C. elegans that is triggered by microinjection of dsRNA, feeding on dsRNA-expressing bacteria or soaking in dsRNA-containing solution can systemically spread throughout the worm body and to its progeny 5,14,15 . ...
... After several iterations of manual checking and correcting in COOT v0. 8 ...
RNA uptake by cells is critical for RNA-mediated gene interference (RNAi) and RNA-based therapeutics. In Caenorhabditis elegans, RNAi is systemic as a result of SID-1-mediated double-stranded RNA (dsRNA) across cells. Despite the functional importance, the underlying mechanisms of dsRNA internalization by SID-1 remain elusive. Here we describe cryogenic electron microscopy structures of SID-1, SID-1–dsRNA complex and human SID-1 homologs SIDT1 and SIDT2, elucidating the structural basis of dsRNA recognition and import by SID-1. The homodimeric SID-1 homologs share conserved architecture, but only SID-1 possesses the molecular determinants within its extracellular domains for distinguishing dsRNA from single-stranded RNA and DNA. We show that the removal of the long intracellular loop between transmembrane helix 1 and 2 attenuates dsRNA uptake and systemic RNAi in vivo, suggesting a possible endocytic mechanism of SID-1-mediated dsRNA internalization. Our study provides mechanistic insights into dsRNA internalization by SID-1, which may facilitate the development of dsRNA applications based on SID-1.
... Dicer enzymes originating from different organisms produce siRNAs of slightly different sizes, duplexes of 20-25 bp with 2 nt overhangs at the 3 ′ -ends [64,65]. It was reported that longer siRNAs might be beneficial for RNAi in human cells since these siRNA molecules better interact with the human Dicer enzymes that assist their subsequent loading into the RNAi-induced silencing complex, an effector protein complex in the RNAi pathway [66]. ...
... It was reported that longer siRNAs might be beneficial for RNAi in human cells since these siRNA molecules better interact with the human Dicer enzymes that assist their subsequent loading into the RNAi-induced silencing complex, an effector protein complex in the RNAi pathway [66]. The Dicer enzyme from Giardia intestinalis generates 27 nt long siRNAs [64,67], which are essentially a substrate for cleavage by human Dicer enzymes. We demonstrated that Giardia Dicer-generated siRNAs are safe for mammalian cells and have lower immunostimulatory activity compared to the siRNAs of canonical 22 nt sizes [54] produced with the human Dicer enzymes [68]. ...
Double-stranded RNA (dsRNA) molecules are mediators of RNA interference (RNAi) in eukaryotic cells. RNAi is a conserved mechanism of post-transcriptional silencing of genes cognate to the sequences of the applied dsRNA. RNAi-based therapeutics for the treatment of rare hereditary diseases have recently emerged, and the first sprayable dsRNA biopesticide has been proposed for registration. The range of applications of dsRNA molecules will likely expand in the future. Therefore, cost-effective methods for the efficient large-scale production of high-quality dsRNA are in demand. Conventional approaches to dsRNA production rely on the chemical or enzymatic synthesis of single-stranded (ss)RNA molecules with a subsequent hybridization of complementary strands. However, the yield of properly annealed biologically active dsRNA molecules is low. As an alternative approach, we have developed methods based on components derived from bacteriophage phi6, a dsRNA virus encoding RNA-dependent RNA polymerase (RdRp). Phi6 RdRp can be harnessed for the enzymatic production of high-quality dsRNA molecules. The isolated RdRp efficiently synthesizes dsRNA in vitro on a heterologous ssRNA template of any length and sequence. To scale up dsRNA production, we have developed an in vivo system where phi6 polymerase complexes produce target dsRNA molecules inside Pseudomonas cells.
... DICER acts as a 'dsRNA molecular ruler' in humans, measuring 21-22 nucleotides ( nt ) from the 5 -and 3 -ends of pre-miRNAs using two 'RNA-binding pockets' (12)(13)(14)(15)(16)(17)(18)(19)(20)(21) . DICER cleavage sites are influenced by various RNA elements, including the 5 -and 3 -ends of shRNAs / pre-miRNAs and positions of the apical loop (22)(23)(24)(25) . ...
... DICER is responsible for recognizing the 5 -and 3 -ends of RNA substrates to determine their length; however, this measurement is imprecise and cannot accurately determine whether 21 or 22 nt should be cleaved from the ends (12)(13)(14)(15)(16)(17)(18)(19)(20)(21). As a result, DICER requires multiple RNA elements to fine-tune its cleavage sites. ...
In humans, DICER is a key regulator of gene expression through its production of miRNAs and siRNAs by processing miRNA precursors (pre-miRNAs), short-hairpin RNAs (shRNAs), and long double-stranded RNAs (dsRNAs). To advance our understanding of this process, we employed high-throughput dicing assays using various shRNA variants and both wild-type and mutant DICER. Our analysis revealed that DICER predominantly cleaves shRNAs at two positions, specifically at 21 (DC21) and 22 (DC22) nucleotides from their 5′-end. Our investigation identified two different motifs, mWCU and YCR, that determine whether DICER cleaves at DC21 or DC22, depending on their locations in shRNAs/pre-miRNAs. These motifs can work together or independently to determine the cleavage sites of DICER. Furthermore, our findings indicate that dsRNA-binding domain (dsRBD) of DICER enhances its cleavage, and mWCU strengthens the interaction between dsRBD and RNA, leading to an even greater enhancement of the cleavage. Conversely, YCR functions independently of dsRBD. Our study proposes a two-motif model that sheds light on the intricate regulatory mechanisms involved in gene expression by elucidating how DICER recognizes its substrates, providing valuable insights into this critical biological process.
... Another example is the PAZ and PIWI domain adapted for RNA interference and microRNA processing that recognizes double-strand RNA similarly to DNA recognition by transcription factors [19,26] (Figure 4). These examples show how different recognition and binding methods have evolved to recognize a variety of motifs. ...
... For example, in some cases, the KH domain recognizes an adenine backbone by hydrogen bonded between the protein backbone and the adenines, recreating the Watson-Crick base pairing pa ern [25] (Figure 3). Another example is the PAZ and PIWI domain adapted for RNA interference and microRNA processing that recognizes double-strand RNA similarly to DNA recognition by transcription factors [19,26] (Figure 4). These examples show how different recognition and binding methods have evolved to recognize a variety of motifs. ...
Gene expression is under tight regulation from the chromatin structure that regulates gene accessibility by the transcription machinery to protein degradation. At the transcript level, this regulation falls on RNA-binding proteins (RBPs). RBPs are a large and diverse class of proteins involved in all aspects of a transcript’s lifecycle: splicing and maturation, localization, stability, and translation. In the past few years, our understanding of the role of RBPs in cardiovascular diseases has expanded. Here, we discuss the general structure and function of RBPs and the latest discoveries of their role in pulmonary and systemic cardiovascular diseases.
... Released into the cytoplasm pre-miRNA is then cleaved close to the terminal loop by RNase III-type endonuclease, called Dicer, resulting in the creation of a short RNA duplex [21]. Said enzyme consists of an N-terminal helicase domain, the PIWI-AGO-ZWILLE (PAZ) domain, two double-stranded RNA (ds-RNA) binding domains (DUF283, dsRBD), and a catalytic center formed by two C-terminal RNase III domains [22][23][24][25]. The PAZ domain has two spatial pockets, which can bind simultaneously a 5' end and a two-nucleotide-long overhang at the 3' end of the pre-miRNA [24,25]. ...
... Nevertheless, the 5' end binds to the enzyme only when it is thermodynamically unstable due to the lack of strong guanine and cytidine base pairing [24]. The region between the PAZ and RNase III domains may act as a "molecular ruler" [22,23], which ensures that Dicer cleaves processed RNA 21-25 nucleotides from the 3' end and 22 nucleotides from the 5' end [22,24]. This process generates small dsRNA, which is then loaded to the Argonaute family protein (AGO) in an ATP-dependent process and becomes the RNA-induced silencing complex (RISC) [11]. ...
Head and neck squamous cell carcinoma is one of the most common and fatal cancers worldwide. Lack of appropriate preventive screening tests, late detection, and high heterogeneity of these tumors are the main reasons for the unsatisfactory effects of therapy and, consequently, unfavorable outcomes for patients. An opportunity to improve the quality of diagnostics and treatment of this group of cancers are microRNAs (miRNAs)-molecules with a great potential both as biomarkers and therapeutic targets. This review aims to present the characteristics of these short non-coding RNAs (ncRNAs) and summarize the current reports on their use in oncology focused on medical strategies tailored to patients' needs.
... Initial studies revealed that Dicer uses its PAZ domain to recognize the 3′-dinucleotide overhang and measure ~21-25 nucleotides (depending on the species) to cleave the double-stranded RNA (dsRNA) stem and release the small RNA duplex [47][48][49][50][51] . This so-called 3′-counting rule emphasized 'ruler'-like activity of Dicer to cut at a prescribed distance from the 3′ substrate terminus. ...
... Similarly, the characteristic seed region of miRNAs that is predominantly required for targeting implies specific structural constraints on the ternary Ago-miRNA-target complex. These were inferences from the initial structures of Dicer and Argonaute homologues from protozoan (Giardia intestinalis) and archaeal (Thermus thermophilus and Pyrococcus furiosus) species 18,48,[78][79][80] . Although small RNA silencing was not well studied in these organisms, these structures recapitulated expectations from metazoan research. ...
Ever since microRNAs (miRNAs) were rst recognized as an extensive gene family >20 years ago, a broad community of researchers was drawn to investigate the universe of small regulatory RNAs. Although core features of miRNA biogenesis and function were revealed early on, recent years continue to uncover fundamental information on the structural and molecular dynamics of core miRNA machinery, how miRNA substrates and targets are selected from the transcriptome, new avenues for multilevel regulation of miRNA biogenesis and mechanisms for miRNA turnover. Many of these latest insights were enabled by recent technological advances, including massively parallel assays, cryogenic electron microscopy, single-molecule imaging and CRISPR-Cas9 screening. Here, we summarize the current understanding of miRNA biogenesis, function and regulation, and outline challenges to address in the future. Sections
... In einer Kristallstrukturanalyse von Giardia intestinalis (G. intestinalis) Dicer, das weder eine dsRNA bindende Domäne noch eine DUF283-oder ATPase/Helikase-Domäne enthält, wurde der Abstand der PAZ-Domäne vom katalytischen Zentrum als molekularer Maßstab identifiziert, der die Fragmentgröße bestimmt [50]. Ein enzymatischer Mechanismus der nukleophilen Substitution, an dem zwei Metallionen beteiligt sind, wird sowohl für RNase III als auch für Dicer vorgeschlagen [38,40,50]. ...
... intestinalis) Dicer, das weder eine dsRNA bindende Domäne noch eine DUF283-oder ATPase/Helikase-Domäne enthält, wurde der Abstand der PAZ-Domäne vom katalytischen Zentrum als molekularer Maßstab identifiziert, der die Fragmentgröße bestimmt [50]. Ein enzymatischer Mechanismus der nukleophilen Substitution, an dem zwei Metallionen beteiligt sind, wird sowohl für RNase III als auch für Dicer vorgeschlagen [38,40,50]. ...
The RNase III-enzyme Dicer is involved in the posttranscriptional and translational regulation of gene expression.The human RNase Dicer shows, when purified, very low activity. Therefore, in this work, human Dicer was enzymatically characterized in cytosolic cell extracts in the presence of cytosolic cofactors. An enzyme assay based on changes of diffusion time was developed with fluorescence correlation spectroscopy (FCS). The enzyme substrate (ES)-complex did show a significantly higher diffusion time than product and substrate, and could therefore be distinguished from the two diffusion species. The dependence of enzyme activity on substrate concentration of human Dicer
was further investigated in cytosolic HEK293-cell extracts. The enzyme attained the half maximum enzyme activity at a substrate concentration of 76 nM. The pico- to femtomolar ES-complex concentration increased after Dicer overexpression and showed a similar dependence on substrate concentration as did enzyme activity. ES-complex concentration remained relatively constant during linear product formation. The analysis of the ES-complex
with respect to enzyme kinetic theory reveals the accuracy of the experimental data.
In a second project, the sulforhodamine B binding RNA aptamer SRB2m was analyzed by FCS. In this work it was demonstrated, that photophysical properties of the fluorophore as well as mobility and molecular size of the RNA in fluorophor-aptamer-complexes could be simultaneously measured by FCS. The sulforhodamine B-SRB2m complex showed a 4-fold
increased diffusion time compared to unbound sulforhodamine B. A second fluorophore, patent blue V (PBV), gave no autocorrelation function. The 36-fold increased molecular
brightness of the complex of PBV and SRB2m enabled FCS measurements with excellent signal-to-noise-ratio. The hydrodynamic radius rH of the PBV- and Sulforhodamin B-SRB2m
complex was 1.9 nm and 2.9 nm, respectively. The
hypothesis that a reduction of the molecular size of SRB2m by PBV due to a separation into monomers occurred, was verified by small angle X-ray scattering experiments.
... Transcriptional and translational "knockdown" approaches to assess protein function RNA interference (RNAi) is a powerful tool for gene silencing in many parasites, yet RNAi is not efficient in Giardia, despite the presence of conserved components of RNAi machinery (Macrae et al. 2006). Alternative transcriptional repression methods such as the overexpression of long double-stranded RNAs (Rivero et al. 2010) or the Giardiavirus-mediated expression of hammerhead ribozymes (HRZs) have also been used for transcriptional knockdowns (Dan et al. 2000), yet neither has had widespread use or reproducibility. ...
Giardia is a prevalent single-celled microaerophilic intestinal parasite causing diarrheal disease and significantly impacting global health. Double diploid (essentially tetraploid) Giardia trophozoites have presented a formidable challenge to the development of molecular genetic tools to interrogate gene function. High sequence divergence and the high percentage of hypothetical proteins lacking homology to proteins in other eukaryotes have limited our understanding of Giardia protein function, slowing drug target validation and development. For more than 25 years, Giardia A and B assemblages have been readily amenable to transfection with plasmids or linear DNA templates. Here, we highlight the utility and power of genetic approaches developed to assess protein function in Giardia, with particular emphasis on the more recent clustered regularly interspaced palindromic repeats/Cas9-based methods for knockdowns and knockouts. Robust and reliable molecular genetic approaches are fundamental toward the interrogation of Giardia protein function and evaluation of druggable targets. New genetic approaches tailored for the double diploid Giardia are imperative for understanding Giardia's unique biology and pathogenesis.
... Binding the pre-miRNA is achieved through different domains in the Dicer molecule; the helicase domain binds the terminal loop (Tsutsumi et al., 2011), a pocket in the PAZ domain anchors the 2-nt 3′overhang and a pocket in the platform domain binds the 5′phosphate (Park et al., 2011). To produce a mature miRNA of appropriate length, Dicer acts as a 'molecular ruler', resulting in cleavage of the terminal loop, approximately 22 nt from the 3′end (Vermeulen et al., 2005;MacRae et al., 2006). Additionally, in mammals, Dicer also measures the cleavage site 22 nt from the 5′end to which it is bound (Park et al., 2011). ...
MicroRNAs (miRNAs) are small non-coding RNAs that silence gene expression through their interaction with complementary sequences in the 3′ untranslated regions (UTR) of target mRNAs. miRNAs undergo a series of steps during their processing and maturation, which are tightly regulated to fine-tune their abundance and ability to function in post-transcriptional gene silencing. miRNA biogenesis typically involves core catalytic proteins, namely, Drosha and Dicer, and several other RNA-binding proteins (RBPs) that recognize and interact with miRNA precursors and/or their intermediates, and mature miRNAs along with their interacting proteins. The series of RNA-protein and protein-protein interactions are critical to maintaining miRNA expression levels and their function, underlying a variety of cellular processes. Throughout this article, we review RBPs that play a role in miRNA biogenesis and focus on their association with components of the miRNA pathway with functional consequences in the processing and generation of mature miRNAs.
... The predicted DEAD-box and helicase domain may stimulate date palm to produce secondary siRNAs [96,97]. The anticipated PAZ and RNase III domains may operate as an indication, creating miRNAs with comparable sizes [98]. The predicted PIWI and PAZ may recognize and cleave the target mRNA [99][100][101]. ...
... The predicted DEAD-box and helicase domain may stimulate date palm to produce secondary siRNAs [96,97]. The anticipated PAZ and RNase III domains may operate as an indication, creating miRNAs with comparable sizes [98]. The predicted PIWI and PAZ may recognize and cleave the target mRNA [99][100][101]. ...
Background
Dates contain various minerals that are essential for good health. The major RNA interference (RNAi) gene families play a vital role in plant growth and development by controlling the expression of protein-coding genes against different biotic and abiotic stresses. However, these gene families for date palm are not yet studied. Therefore, this study has explored major RNAi genes and their characteristics in date palm.
Results
We have identified 4 PdDCLs, 7 PdAGOs, and 3 PdRDRs as RNAi proteins from the date palm genome by using AtRNAi genes as query sequences in BLASTp search. Domain analysis of predicted RNAi genes has revealed the Helicase_C, Dicer_dimer, PAZ, RNase III, and Piwi domains that are associated with the gene silencing mechanisms. Most PdRNAi proteins have been found in the nucleus and cytosol associated with the gene silencing actions. The gene ontology (GO) enrichment analysis has revealed some important GO terms including RNA interference, dsRNA fragmentation, and ribonuclease_III activity that are related to the protein-coding gene silencing mechanisms. Gene regulatory network (GRN) analysis has identified PAZ and SNF2 as the transcriptional regulators of PdRNAi genes. Top-ranked 10 microRNAs including Pda-miR156b, Pda-miR396a, Pda-miR166a, Pda-miR167d, and Pda-miR529a have been identified as the key post-transcriptional regulators of PdRNAi genes that are associated with different biotic/abiotic stresses. The cis -acting regulatory element analysis of PdRNAi genes has detected some vital cis -acting elements including ABRE, MBS, MYB, MYC, Box-4, G-box, I-box, and STRE that are linked with different abiotic stresses.
Conclusion
The results of this study might be valuable resources for the improvement of different characteristics in date palm by further studies in wet-lab.
... The predicted DEAD-box and helicase domain may stimulate date palm to produce secondary siRNAs [96,97]. The anticipated PAZ and RNase III domains may operate as an indication, creating miRNAs with comparable sizes [98]. The predicted PIWI and PAZ may recognize and cleave the target mRNA [99][100][101]. ...
Background Dates contain various minerals that are essential for good health. The major RNA interference (RNAi) gene families play a vital role in plant growth and development by controlling the expression of protein-coding genes against different biotic and abiotic stresses. However, these gene families for date palm are not yet studied. Therefore, this study has explored major RNAi genes and their characteristics in date palm. Results We have identified 4 PdDCLs, 7 PdAGOs, and 3 PdRDRs as RNAi proteins from the date palm genome by using AtRNAi genes as query sequences in BLASTp search. Domain analysis of predicted RNAi genes has revealed the Helicase_C, Dicer_dimer, PAZ, RNase III, and Piwi domains that are associated with the gene silencing mechanisms. Most PdRNAi proteins have been found in the nucleus and cytosol associated with the gene silencing actions. The gene ontology (GO) enrichment analysis has revealed some important GO terms including RNA interference, dsRNA fragmentation, and ribonuclease_III activity that are related to the protein-coding gene silencing mechanisms. Gene regulatory network (GRN) analysis has identified PAZ and SNF2 as the transcriptional regulators of PdRNAi genes. Top-ranked 10 microRNAs including Pda-miR156b, Pda-miR396a, Pda-miR166a, Pda-miR167d, and Pda-miR529a have been identified as the key post-transcriptional regulators of PdRNAi genes that are associated with different biotic/abiotic stresses. The cis-acting regulatory element analysis of PdRNAi genes has detected some vital cis-acting elements including ABRE, MBS, MYB, MYC, Box-4, G-box, I-box, and STRE that are linked with different abiotic stresses. Conclusion The results of this study might be valuable resources for the improvement of different characteristics in date palm by further studies in wet-lab.
... Dicer is a major endoribonuclease that cleaves double-stranded RNA into small RNA duplexes, playing an essential role in both RNAi and miRNA biogenesis pathways. 10,11,31 Cardiac-specific knockout of Dicer leads to impaired miRNA processing, heart failure, and premature death in mice; 16,17 therefore, supporting its essential role in cardiac physiology. Nevertheless, the use of genetic approaches causing Dicer gene deletion restricts our understanding of major dynamic mechanisms that fine-tune Dicer synthesis, degradation, conformational state, and activity; therefore, limiting the development of effective therapeutic strategies that regulate Dicer function. ...
Background and Aims
Developing novel therapies to battle the global public health burden of heart failure remains challenging. This study investigates the underlying mechanisms and potential treatment for 4-hydroxynonenal (4-HNE) deleterious effects in heart failure.
Methods
Biochemical, functional, and histochemical measurements were applied to identify 4-HNE adducts in rat and human failing hearts. In vitro studies were performed to validate 4-HNE targets.
Results
4-HNE, a reactive aldehyde by-product of mitochondrial dysfunction in heart failure, covalently inhibits Dicer, an RNase III endonuclease essential for microRNA (miRNA) biogenesis. 4-HNE inhibition of Dicer impairs miRNA processing. Mechanistically, 4-HNE binds to recombinant human Dicer through an intermolecular interaction that disrupts both activity and stability of Dicer in a concentration- and time-dependent manner. Dithiothreitol neutralization of 4-HNE or replacing 4-HNE-targeted residues in Dicer prevents 4-HNE inhibition of Dicer in vitro. Interestingly, end-stage human failing hearts from three different heart failure aetiologies display defective 4-HNE clearance, decreased Dicer activity, and miRNA biogenesis impairment. Notably, boosting 4-HNE clearance through pharmacological re-activation of mitochondrial aldehyde dehydrogenase 2 (ALDH2) using Alda-1 or its improved orally bioavailable derivative AD-9308 restores Dicer activity. ALDH2 is a major enzyme responsible for 4-HNE removal. Importantly, this response is accompanied by improved miRNA maturation and cardiac function/remodelling in a pre-clinical model of heart failure.
Conclusions
4-HNE inhibition of Dicer directly impairs miRNA biogenesis in heart failure. Strikingly, decreasing cardiac 4-HNE levels through pharmacological ALDH2 activation is sufficient to re-establish Dicer activity and miRNA biogenesis; thereby representing potential treatment for patients with heart failure.
... Regardless of genomic context, following pri-miRNA processing, the 60-70 bp precursor pre-miRNA is transported from the nucleus by Exportin 5 to the cytoplasm [12,13]. In the cytoplasm, a second RNase III endonuclease, Dicer, cleaves the pre-miRNA to produce a ~22 nucleotide doublestranded RNA molecule in which one strand, termed the guide strand, is transferred to the RISC (RNA-induced silencing complex) that contains Argonaute 2 (Ago2) and the RNA binding protein TARBP2 (TAR RNA binding protein 2); the non-guide strand is subject to degradation [14]. Guide strand switching is a more recently discussed biological phenomenon which can modulate gene expression because each strand has a unique seed sequence and thus target genes [15]. ...
Satellite cells are bona fide muscle stem cells that are indispensable for successful post-natal muscle growth and regeneration after severe injury. These cells also participate in adult muscle adaptation in several capacities. microRNA (miRNA) are post-transcriptional regulators of mRNA that are implicated in several aspects of stem cell function. There is evidence to suggest that miRNAs affect satellite cell behavior in vivo and myogenic progenitor behavior in vitro, but the role of miRNAs in adult skeletal muscle satellite cells is less studied. In this review, we provide evidence for how miRNAs control satellite cell behavior with emphasis on satellite cells of adult muscle in vivo. We first outline how miRNAs are indispensable for satellite cell viability and control the phases of myogenesis. Next, we discuss the interplay between miRNAs and myogenic cell redox status, senescence, and communication to other muscle-resident cells during muscle adaptation. Results from recent satellite cell miRNA profiling studies are also summarized. In vitro experiments in primary myogenic cells and cell lines have been invaluable for exploring the influence of miRNAs, but we identify a need for novel genetic tools to further interrogate how miRNAs control satellite cell behavior in adult skeletal muscle in vivo.
... The inhibitory RNA (RNAi) approach is a popular technique in genetic engineering research, both in cell culture and in living organisms. This technique is sometimes referred to as a "knockdown", to distinguish it from "knockout" procedures in which the expression of a gene is entirely eliminated (Meins, 2000;Macrae et al., 2006). The knockdown process of RNAi reduces specific target mRNA levels without damage to the gene structure . ...
... However, excavates either lack homologs of Dicer or possess Dicer-like proteins that lack either the helicase component or the tandem RNase III portion. As a result, the existence of RNAi in most excavates is uncertain [168]. However, it is believed that a functional RNAi system containing these three proteins may have been present before the most recent common ancestor of existing eukaryotes, based on the "starphylogeny" of the five supergroups [169,170]. ...
For a significant period, conventional breeding and genetic modification were the key techniques that were effective in managing biotic and abiotic stresses in crops and adding desirable traits. However, the recent appearance of novel diseases and unexpected climatic changes that have substantial implications for agriculture worldwide have urged scientists to look for alternative methods to quickly manage seasonal crises. The primary emphasis of this chapter is on the obstacles and diverse biotechnological methods employed to enhance crop resilience against a range of biotic and abiotic stressors in plants. Furthermore, we consider gene transformation, omics techniques, genome editing, and other sophisticated biotechnological tools that utilize transcriptomic, proteomic, metabolomic, phenomics, RNA interference, and epigenome modifications for enhancing plant resilience. Lastly, we examine the potential of merging these eco-friendly and innovative methods with conventional breeding to promote modern agriculture and aid in enhancing tolerance to different biotic, abiotic stresses and growth promotion.
... Post-transcriptional gene silencing (PTGS) by miRNAs in the cytoplasm is regarded as one of the classical functions accomplished by miRISC. In the cytoplasm, pre-miRNAs are recognized and processed by a RNase III enzyme, Dicer [28,30,31]. This leads to the formation of approximately 22-nt duplex RNAs loaded onto one of the AGO family members in a coupling process [32,33]. ...
Being an integral part of the eukaryotic transcriptome, miRNAs are regarded as vital regulators of diverse developmental and physiological processes. Clearly, miRNA activity is kept in check by various regulatory mechanisms that control their biogenesis and decay pathways. With the increasing technical depth of RNA profiling technologies, novel insights have unravelled the spatial diversity exhibited by miRNAs inside a cell. Compartmentalization of miRNAs adds complexity to the regulatory circuits of miRNA expression, thereby providing superior control over the miRNA function. This review provides a bird’s eye view of miRNAs expressed in different subcellular locations, thus affecting the gene regulatory pathways therein. Occurrence of miRNAs in diverse intra-cellular locales also reveals various unconventional roles played by miRNAs in different cellular organelles and expands the scope of miRNA functions beyond their traditionally known repressive activities.
... TAR-derived reads came from both arms of the TAR hairpin (Fig. S1B). In the hairpin, the two read clusters detected are juxtaposed with 39 overhangs, which would have predicted processing by Dicer and loading into the RISC (64,65), and, consequently, miR-TAR processing has been reported to be dependent on Dicer in infected 293T cells (45). The majority of the HIV-derived R-sRNAs in our analyses aligned with the HIV UTR and the TAR loop, the location of the putative v-miRNA miR-TAR (46) (Fig. 2D to F, red reads). ...
HIV-1 (HIV) infects CD4+ T cells, the gradual depletion of which can lead to AIDS in the absence of antiretroviral therapy (ART). Some cells, however, survive HIV infection and persist as part of the latently infected reservoir that causes recurrent viremia after ART cessation. Improved understanding of the mechanisms of HIV-mediated cell death could lead to a way to clear the latent reservoir. Death induced by survival gene elimination (DISE), an RNA interference (RNAi)-based mechanism, kills cells through short RNAs (sRNAs) with toxic 6-mer seeds (positions 2 to 7 of sRNA). These toxic seeds target the 3' untranslated region (UTR) of mRNAs, decreasing the expression of hundreds of genes critical for cell survival. In most cells under normal conditions, highly expressed cell-encoded nontoxic microRNAs (miRNAs) block access of toxic sRNAs to the RNA-induced silencing complex (RISC) that mediates RNAi, promoting cell survival. HIV has been shown to inhibit the biogenesis of host miRNAs in multiple ways. We now report that HIV infection of cells deficient in miRNA expression or function results in enhanced RISC loading of an HIV-encoded miRNA HIV-miR-TAR-3p, which can kill cells by DISE through a noncanonical (positions 3 to 8) 6-mer seed. In addition, cellular RISC-bound sRNAs shift to lower seed viability. This also occurs after latent HIV provirus reactivation in J-Lat cells, suggesting independence of permissiveness of cells to viral infection. More precise targeting of the balance between protective and cytotoxic sRNAs could provide new avenues to explore novel cell death mechanisms that could be used to kill latent HIV. IMPORTANCE Several mechanisms by which initial HIV infection is cytotoxic to infected cells have been reported and involve various forms of cell death. Characterizing the mechanisms underlying the long-term survival of certain T cells that become persistent provirus reservoirs is critical to developing a cure. We recently discovered death induced by survival gene elimination (DISE), an RNAi-based mechanism of cell death whereby toxic short RNAs (sRNAs) containing 6-mer seed sequences (exerting 6-mer seed toxicity) targeting essential survival genes are loaded into RNA-induced silencing complex (RISC) complexes, resulting in inescapable cell death. We now report that HIV infection in cells with low miRNA expression causes a shift of mostly cellular RISC-bound sRNAs to more toxic seeds. This could prime cells to DISE and is further enhanced by the viral microRNA (miRNA) HIV-miR-TAR-3p, which carries a toxic noncanonical 6-mer seed. Our data provide multiple new avenues to explore novel cell death mechanisms that could be used to kill latent HIV.
... In the cytoplasm, pre-miRNA has undergone cleavage near the terminal loop by another RNase III enzyme known as Dicer [52,53]. The activity of Dicer is aided by the cofactor protein called transactivation response RNA binding protein (TRBP) to generate a 20-nucleotides long mature miRNA/miRNA* duplex [53][54][55][56][57]. ...
MicroRNAs (miRNAs) are a family of small, single-stranded, and non-protein coding RNAs about 19 to 22 nucleotides in length, that have been reported to have important roles in the control of bone development. MiRNAs have a strong influence on osteoblast differentiation through stages of lineage commitment and maturation, as well as via controlling the activities of osteogenic signal transduction pathways. Generally, miRNAs may modulate cell stemness, proliferation, differentiation, and apoptosis by binding the 3′-untranslated regions (3′-UTRs) of the target genes, which then can subsequently undergo messenger RNA (mRNA) degradation or protein translational repression. MiRNAs manage the gene expression in osteogenic differentiation by regulating multiple signalling cascades and essential transcription factors, including the transforming growth factor-beta (TGF-β)/bone morphogenic protein (BMP), Wingless/Int-1(Wnt)/β-catenin, Notch, and Hedgehog signalling pathways; the Runt-related transcription factor 2 (RUNX2); and osterix (Osx). This shows that miRNAs are essential in regulating diverse osteoblast cell functions. TGF-βs and BMPs transduce signals and exert diverse functions in osteoblastogenesis, skeletal development and bone formation, bone homeostasis, and diseases. Herein, we highlighted the current state of in vitro and in vivo research describing miRNA regulation on the canonical TGF-β/BMP signalling, their effects on osteoblast linage, and understand their mechanism of action for the development of possible therapeutics. In this review, particular attention and comprehensive database searches are focused on related works published between the years 2000 to 2022, using the resources from PubMed, Google Scholar, Scopus, and Web of Science.
... Pri-miRNAs are initially processed within the nucleus by the ribonuclease Drosha to form pre-miRNAs (Lee et al., 2003), which are then exported to the cytoplasm via exportin-5 (Yi et al., 2003). Pre-miRNAs are further cleaved by the cytoplasmic endonuclease Dicer (MacRae, 2006), leaving a mature double-stranded miRNA duplex. The breakdown of this duplex gives rise to the '−3p' and '−5p' forms of each miRNA. ...
MicroRNAs are non‐coding RNAs, approximately 22 nt in length, which serve to negatively regulate gene expression through binding to complementary sequences in the 3′ untranslated region (3′UTR) of target mRNA. The microRNA–target interaction does not require perfect complementarity, meaning that an individual microRNA often has a pool of hundreds of gene targets. Equally, one 3′UTR can contain target sites for many different microRNAs. This gives rise to a complex web of molecular interactions. An emerging concept is that microRNAs have a role as ‘master’ regulators of certain cellular properties, simultaneously mediating the subtle repression of multiple related genes within a pathway or system, thereby achieving a common phenotypic output. One such example is regulation of brain excitability. There are numerous examples of microRNAs which can target ion channels, ion transporters and genes associated with synaptic transmission. Often, the expression of the microRNA itself is regulated in an activity‐dependent manner, thereby forming homeostatic loops. Limitations in our understanding arise from the sheer complexity of microRNA–target interactions, which are difficult to capture experimentally and computationally. Further, many microRNA studies rely on animal model systems, but many microRNAs (and mRNA targets) have sequences which are either not conserved or are entirely unique in the human brain. This leaves many exciting and challenging opportunities to further progress the field in an attempt to fully understand the roles of microRNAs in brain function. image
... It has been shown that for effective miRNA processing by Drosha [23] and Dicer [24] the terminal loop region is very essential and the mutations in this region affect mature miRNA production [25]. Figure 1 shows a miRBase entry for a human miRNA which is supposed to have a mature miRNA located partially within the terminal loop, something not supported by the current understanding of miRNAs. ...
Experimental detection and validation of miRNAs is a tedious, time-consuming, and expensive process. Computational methods for miRNA gene detection are being developed so that the number of candidates that need experimental validation can be reduced to a manageable amount. Computational methods involve homology-based and ab inito algorithms. Both approaches are dependent on positive and negative training examples. Positive examples are usually derived from miRBase, the main resource for experimentally validated miRNAs. We encountered some problems with miRBase which we would like to report here. Some problems, among others, we encountered are that folds presented in miRBase are not always the fold with the minimum free energy; some entries do not seem to conform to expectations of miRNAs, and some external accession numbers are not valid. In addition, we compared the prediction accuracy for the same negative dataset when the positive data came from miRBase or miRTarBase and found that the latter led to more precise prediction models. We suggest that miRBase should introduce some automated facilities for ensuring data quality to overcome these problems.
MicroRNAs (miRNAs) that share identical or near-identical sequences constitute miRNA families and are predicted to act redundantly. Yet recent evidence suggests that members of the same miRNA family with high sequence similarity might have different roles and that this functional divergence might be rooted in their precursors' sequence. Current knock-down strategies such as antisense oligonucleotides (ASOs) or miRNA sponges cannot distinguish between identical or near identical miRNAs originating from different precursors to allow exploring unique functions of these miRNAs. We here develop a novel strategy based on short 2′-OMe/LNA-modified oligonucleotides to selectively target specific precursor molecules and ablate the production of individual members of miRNA families in vitro and in vivo. Leveraging the highly conserved Xenopus miR-181a family as proof-of-concept, we demonstrate that 2′-OMe/LNA-ASOs targeting the apical region of pre-miRNAs achieve precursor-selective inhibition of mature miRNA-5p production. Furthermore, we extend the applicability of our approach to the human miR-16 family, illustrating its universality in targeting precursors generating identical miRNAs. Overall, our strategy enables efficient manipulation of miRNA expression, offering a powerful tool to dissect the functions of identical or highly similar miRNAs derived from different precursors within miRNA families.
Plants are prone to diseases caused by diverse pathogens. They respond through the modulation of molecular mechanisms at different levels. Alteration of gene expression is a major demonstration of plant defense machinery at the molecular level. In recent years, advancements in high-throughput sequencing and bioinformatic tools lead to the identification of various regulatory ncRNAs such as miRNAs, lncRNAs, and circRNAs. These ncRNAs emerged as direct or indirect regulators of gene expression through chromatin remodeling, transcriptional, and post-transcriptional regulation. Till date, studies revealed the extensive role of miRNAs and lncRNAs in providing disease resistance to plants. miRNAs target various defense-related genes and lncRNAs. Interestingly, both lncRNAs and circRNAs can also act as sponges for miRNAs and inhibit their action. Moreover, lncRNAs also act as precursors of various miRNAs. In brief, ncRNAs make complex and intermingled networks that can be exploited to enhance disease resistance in plants. However, exploration of more such networks is still needed. In this chapter, we discuss about features, discovery, and biogenesis, mechanism of action, and role of miRNAs, lncRNAs, and circRNAs in providing disease resistance to the plants.
Flowering plant genomes encode four or five DICER-LIKE (DCL) enzymes that produce small interfering RNAs (siRNAs) and microRNAs which function in RNA interference (RNAi). Different RNAi pathways in plants effect transposon silencing, antiviral defense and endogenous gene regulation. DCL2 acts genetically redundantly with DCL4 to confer basal antiviral defense. However, DCL2 may also counteract DCL4, since knockout of DCL4 causes growth defects that are suppressed by DCL2 inactivation. Current models maintain that RNAi via DCL2-dependent siRNAs is the biochemical basis of both effects. Here, we report that DCL2-mediated antiviral resistance and growth defects cannot be explained by the silencing effects of DCL2-dependent siRNAs. Both functions are defective in genetic backgrounds that maintain high levels of DCL2-dependent siRNAs, either with specific point mutations in DCL2 or with reduced DCL2 dosage because of heterozygosity for dcl2 knockout alleles. Intriguingly, all DCL2 functions require its catalytic activity, and the penetrance of DCL2-dependent growth phenotypes in dcl4 mutants correlates with DCL2 protein levels, but not with levels of major DCL2-dependent siRNAs. We discuss this requirement and correlation with catalytic activity, but not with resulting siRNAs, in light of other findings that reveal a DCL2 function in innate immunity activation triggered by cytoplasmic double-stranded RNA.
Insect pests rank among the major limiting factors in agricultural production worldwide. In addition to direct effect on crops, some phytophagous insects are efficient vectors for plant disease transmission. Large amounts of conventional insecticides are required to secure food production worldwide, with a high impact on the economy and environment, particularly when beneficial insects are also affected by chemicals that frequently lack the desired specificity. RNA interference (RNAi) is a natural mechanism gene expression regulation and protection against exogenous and endogenous genetic elements present in most eukaryotes, including insects. Molecules of double-stranded RNA (dsRNA) or highly structured RNA are the substrates of cellular enzymes to produce several types of small RNAs (sRNAs), which play a crucial role in targeting sequences for transcriptional or post-transcriptional gene silencing. The relatively simple rules that underlie RNAi regulation, mainly based in Watson–Crick complementarity, have facilitated biotechnological applications based on these cellular mechanisms. This includes the promise of using engineered dsRNA molecules, either endogenously produced in crop plants or exogenously synthesized and applied onto crops, as a new generation of highly specific, sustainable, and environmentally friendly insecticides. Fueled on this expectation, this article reviews current knowledge about the RNAi pathways in insects, and some other applied questions such as production and delivery of recombinant RNA, which are critical to establish RNAi as a reliable technology for insect control in crop plants.
Dicer, a multi‐domain ribonuclease III (RNase III) protein, is crucial for gene regulation via RNA interference. It processes hairpin‐like precursors into microRNAs (miRNAs) and long double‐stranded RNAs (dsRNAs) into small interfering RNAs (siRNAs). During the "dicing" process, the miRNA or siRNA substrate is stably anchored and cleaved by Dicer's RNase III domain. Although numerous studies have investigated long dsRNA cleavage by Dicer, the specific mechanism by which human Dicer (hDICER) processes pre‐miRNA remains unelucidated. This review introduces the recently revealed hDICER structure bound to pre‐miRNA uncovered through cryo‐electron microscopy and compares it with previous reports describing Dicer. The domain‐wise movements of the helicase and dsRNA‐binding domain (dsRBD) and specific residues involved in substrate sequence recognition have been identified. During RNA substrate binding, the hDICER apical domains and dsRBD recognize the pre‐miRNA termini and cleavage site, respectively. Residue rearrangements in positively charged pockets within the apical domain influence substrate recognition and cleavage site determination. The specific interactions between dsRBD positively charged residues and nucleotide bases near the cleavage site emphasize the significance of cis‐acting elements in the hDICER processing mechanism. These findings provide valuable insights for understanding hDICER‐related diseases.
The central dogma is suggested that deoxyribonucleic acid is translated into ribonucleic acid (RNA) and then into protein. It is considered that 2–3% of the genomic DNA in a functionally active cell, is transcribed to protein-coding RNA. The presence of noncoding transcripts has been neglected many a time as cellular DNA and transcript noises, however, increasing proof proposes that a very important part of these non-coding transcripts is functionally effective as RNA molecules. The non-coding transcripts of up to 100 bases are known as small non-coding RNA that comprises tRNA, miRNA, snoRNA, piwi-interacting RNA (pi-RNA), etc. Interestingly, rRNA features about 6.9 kb, though these are not considered long-non-coding RNAs. However, RNA molecules that are over 200 bases long (ranging between 0.8 to 10 kb) are known as long non-coding RNA (lncRNA). It does not have open reading frames (with some exceptions), 3`- untranslated regions (3’-UTRs), and these RNAs are devoid of any translation-termination regions. However, these may be capped, spliced, and polyadenylated as RNA molecules and play a major role in factor regulation, neoplastic cell invasion, chromatin granule transforming, and cell differentiation. Downregulation of lncRNA is responsible for numerous diseases in mammals. miRNAs are mature transcripts of 22 nt in length and function as antisense regulators of other RNAs. They play role in post-transcriptional factors and are involved in differentiation, proliferation, immune response, cell growth, and caspase-mediated cell death. Downregulation in miRNA expression has a necessary role in many diseases, together with cancers.
Diatoms are eukaryotic microalgae responsible for nearly half of the marine productivity. RNA interference (RNAi) is a mechanism of regulation of gene expression mediated by small RNAs (sRNAs) processed by the endoribonuclease Dicer (DCR). To date, the mechanism and physiological role of RNAi in diatoms are unknown.
We mined diatom genomes and transcriptomes for key RNAi effectors and retraced their phylogenetic history. We generated DCR knockout lines in the model diatom species Phaeodactylum tricornutum and analyzed their mRNA and sRNA populations, repression‐associated histone marks, and acclimatory response to nitrogen starvation.
Diatoms presented a diversification of key RNAi effectors whose distribution across species suggests the presence of distinct RNAi pathways. P. tricornutum DCR was found to process 26–31‐nt‐long double‐stranded sRNAs originating mostly from transposons covered by repression‐associated epigenetic marks. In parallel, P. tricornutum DCR was necessary for the maintenance of the repression‐associated histone marks H3K9me2/3 and H3K27me3. Finally, PtDCR‐KO lines presented a compromised recovery post nitrogen starvation suggesting a role for P. tricornutum DCR in the acclimation to nutrient stress.
Our study characterized the molecular function of the single DCR homolog of P. tricornutum suggesting an association between RNAi and heterochromatin maintenance in this model diatom species.
Simple Summary
Mutational hotspots have gained importance as oncological biomarkers in recent years because of their potential as predictors of clinical outcomes and/or therapeutic targets. In addition, they are easily detectable in clinical samples via Sanger or next-generation sequencing (NGS). The role of these genetic defects is less clear in pituitary neuroendocrine tumors (PitNETs), even though the most common genetic drivers of these neoplasms are located within mutational hotspots. Indeed, hotspots in six different genes are of particular importance in this context. Two of them, USP48 and SF3B1, represent very recent and infrequent genetic associations; thus, their clinical relevance remains unclear. For two other genes, GNAS and USP8, discrepancies exist among studies regarding their associated phenotypes. Finally, the phenotypes associated with BRAF and DICER1 are well defined in other settings, but not yet in sporadic PitNETs. Additional studies are required to assess the potential of these molecular alterations as druggable targets in PitNETs.
Abstract
The most common genetic drivers of pituitary neuroendocrine tumors (PitNETs) lie within mutational hotspots, which are genomic regions where variants tend to cluster. Some of these hotspot defects are unique to PitNETs, while others are associated with additional neoplasms. Hotspot variants in GNAS and USP8 are the most common genetic causes of acromegaly and Cushing’s disease, respectively. Although it has been proposed that these genetic defects could define specific clinical phenotypes, results are highly variable among studies. In contrast, DICER1 hotspot variants are associated with a familial syndrome of cancer predisposition, and only exceptionally occur as somatic changes. A small number of non-USP8-driven corticotropinomas are due to somatic hotspot variants in USP48 or BRAF; the latter is a well-known mutational hotspot in cancer. Finally, somatic variants affecting a hotspot in SF3B1 have been associated with multiple cancers and, more recently, with prolactinomas. Since the associations of BRAF, USP48, and SF3B1 hotspot variants with PitNETs are very recent, their effects on clinical phenotypes are still unknown. Further research is required to fully define the role of these genetic defects as disease biomarkers and therapeutic targets.
Background
Okra is a plant farmed for its pods, leaves, and stems all of which are edible. It is famous for its ability to tolerate long desiccation periods. It belongs to the Malvaceae family and is a sister species to hibiscus, cotton, and cacao plants.
Methods
In the current study, okra plants were used as a model to sequence, assemble, and analyze the evolutionary and functional characteristics of the Dicer-like protein gene family (DCL) based on DNAseq and qPCR techniques.
Results
Four Dicer-like (DCL) single-copy genes of the okra plant Abelmoschus esculentus (L.) Moench (AeDCL) were successfully assembled. The lengths of the AeDCL copies were 8,494, 5,214, 4,731, and 9,329 bp. The detected exons in these samples ranged from a single exon in AeDCL3 to 24 exons in AeDCL4 . AeDCLs had five functional domains of two DEAD-like helicase superfamilies, N and C; one Dicer domain; one ribonuclease III domain (a and b); and one double-stranded RNA-binding domain. The PAZ domain was completely annotated only for AeDCL1 and AeDCL3 . All AeDCLs were up-regulated under drought conditions, with leaves showing more extensive fold changes than roots. The study focused on a comprehensive genome-wide identification and analysis of the DCL gene family in naturally drought-tolerant okra plants, an orphan crop that can be used as a model for further genomic and transcriptomic studies on drought-tolerance mechanisms in plants.
Hantaviruses are a significant and emerging global public health threat, impacting more than 200,000 individuals worldwide each year. The single-stranded RNA viruses belong to the Hantaviridae family and are responsible for causing two acute febrile diseases in humans: Hantavirus pulmonary syndrome (HPS) and hemorrhagic fever with renal syndrome (HFRS). Currently, there are no licensed treatments or vaccines available globally for HTNV infection. Various candidate drugs have shown efficacy in increasing survival rates during the early stages of HTNV infection. Some of these drugs include lactoferrin, ribavirin, ETAR, favipiravir and vandetanib. Immunotherapy utilizing neutralizing antibodies (NAbs) generated from Hantavirus convalescent patients show efficacy against HTNV. Monoclonal antibodies such as MIB22 and JL16 have demonstrated effectiveness in protecting against HTNV infection. The development of vaccines and antivirals, used independently and/or in combination, is critical for elucidating hantaviral infections and the impact on public health. RNA interference (RNAi) arised as an emerging antiviral therapy, is a highly specific degrades RNA, with post-transcriptional mechanism using eukaryotic cells platform. That has demonstrated efficacy against a wide range of viruses, both in vitro and in vivo . Recent antiviral methods involve using small interfering RNA (siRNA) and other, immune-based therapies to target specific gene segments (S, M, or L) of the Hantavirus. This therapeutic approach enhances viral RNA clearance through the RNA interference process in Vero E6 cells or human lung microvascular endothelial cells. However, the use of siRNAs faces challenges due to their low biological stability and limited in vivo targeting ability. Despite their successful inhibition of Hantavirus replication in host cells, their antiviral efficacy may be hindered. In the current review, we focus on advances in therapeutic strategies, as antiviral medications, immune-based therapies and vaccine candidates aimed at enhancing the body’s ability to control the progression of Hantavirus infections, with the potential to reduce the risk of severe disease.
Plants are sessile organisms which demands a subtle regulation to thrive in variable conditions. This regulation occurs by hormones and miRNAs. In this chapter we go through the concept of micro-RNA, nomenclature, and action mechanism, specifically plant miRNAs, and review the outstanding knowledge of those miRNA involving in phytohormones pathways. Relevant information is presented about each hormone biosynthesis factors, signaling and receptors. Thence, which miRNAs target those elements around each phytohormone, spawning the crosstalk among them. miRNAs involved in several hormones pathway receive deserved attention and are presented as key elements into the plant breeding research environment.
The endoribonuclease DICER1 plays an essential role in the microRNA (miRNA) biogenesis pathway, cleaving precursor miRNA (pre-miRNA) stem-loops to generate mature single-stranded miRNAs. Germline pathogenic variants (GPVs) in DICER1 result in DICER1 tumor predisposition syndrome (DTPS), a mainly childhood-onset tumor susceptibility disorder. Most DTPS-causing GPVs are nonsense or frameshifting, with tumor development requiring a second somatic missense hit that impairs the DICER1 RNase IIIb domain. Interestingly, germline DICER1 missense variants that cluster in the DICER1 Platform domain have been identified in some persons affected by tumors that also associate with DTPS. Here, we demonstrate that four of these Platform domain variants prevent DICER1 from producing mature miRNAs and as a result impair miRNA-mediated gene silencing. Importantly, we show that in contrast to canonical somatic missense variants that alter DICER1 cleavage activity, DICER1 proteins harboring these Platform variants fail to bind to pre-miRNA stem-loops. Taken together, this work sheds light upon a unique subset of GPVs causing DTPS and provides new insights into how alterations in the DICER1 Platform domain can impact miRNA biogenesis.
Bombyx mori silkworm is an important economic insect which has a significant contribution to the improvement of the economy. Bombyx mori nucleopolyhedrovirus (BmNPV) is a vitally significant purulent virus that impedes the sustainable and stable development of the silkworm industry, resulting in substantial economic losses. In recent years, with the development of biotechnology, transcriptomics, proteomics, metabolomics, and the related techniques have been used to select BmNPV-resistant genes, proteins, and metabolites. The regulatory networks between viruses and hosts have been gradually clarified with the discovery of ncRNAs, such as miRNA, lncRNA, and circRNA in cells. Thus, this paper aims to highlight the results of current multi-omics and ncRNA studies on BmNPV resistance in the silkworm, providing some references for resistant strategies in the silkworm to BmNPV.
Body size and silk protein synthesis ability are two crucial aspects of artificial selection in silkworm breeding; however, the role of genes in both pathways remains unknown. To determine whether let-7 microRNA could regulate larval development and silk gland growth simultaneously, we designed a guide RNA to edit let-7 using the CRISPR/Cas9 system. The indels predominantly appeared in the let-7 seed region, and the vast majority of the mutations were small-fragment deletions. Loss of let-7 function prolonged the fifth larval period, and substantially increased body weight during the wandering stage, but it resulted in developmental arrest during the pupal-moth transition. let-7 systemic knock down promoted silk gland growth and increased silk yield by >50 %, with efficiency significantly higher than in tissue-specific edited individuals. Hormone signaling and cell cycle pathway genes were activated in different patterns in the body and silk gland, implying that let-7 may regulate different target genes to play role in tissue growth. In summary, we first report that conditional knock down let-7 promoting the simultaneous growth of body and silk gland, greatly improve silk yield in the silkworm.
Dicer is an RNase III enzyme that is responsible for the maturation of small RNAs such as microRNAs. As Dicer's cleavage products play key roles in promoting cellular homeostasis through the fine-tuning of gene expression, dysregulation of Dicer activity can lead to several human diseases, including cancers. Mutations in Dicer have been found to induce tumorigenesis and lead to the development of a rare pleiotropic tumor predisposition syndrome found in children and young adults called DICER1 syndrome. These patients harbor germline and somatic mutations in Dicer that lead to defective microRNA processing and activity. While most mutations occur within Dicer's catalytic RNase III domains, alterations within the Platform-PAZ (Piwi-Argonaute-Zwille) domain also cause loss of microRNA production. Using a combination of in vitro biochemical and cellular studies, we characterized the effect of disease-relevant Platform-PAZ-associated mutations on the processing of a well-studied oncogenic microRNA, pre-microRNA-21. We then compared these results to those of a representative from another Dicer substrate class, the small nucleolar RNA, snord37. From this analysis, we provide evidence that mutations within the Platform-PAZ domain result in differential impacts on RNA binding and processing, adding new insights into the complexities of Dicer processing of small RNA substrates.
DICER1 syndrome is a tumor predisposition syndrome that is associated with up to 30 different neoplastic lesions, usually affecting children and adolescents. Here we identify a group of mesenchymal tumors which is highly associated with DICER1 syndrome, and molecularly distinct from other DICER1-associated tumors. This group of DICER1-associated mesenchymal tumors encompasses multiple well-established clinicopathological tumor entities and can be further divided into three clinically meaningful classes designated “low-grade mesenchymal tumor with DICER1 alteration” (LGMT DICER1), “sarcoma with DICER1 alteration” (SARC DICER1), and primary intracranial sarcoma with DICER1 alteration (PIS DICER1). Our study not only provides a combined approach to classify DICER1-associated neoplasms for improved clinical management but also suggests a role for global hypomethylation and other recurrent molecular events in sarcomatous differentiation in mesenchymal tumors with DICER1 alteration. Our results will facilitate future investigations into prognostication and therapeutic approaches for affected patients.
RNA interference is a highly conserved mechanism wherein several types of non-coding small RNAs regulate gene expression at the transcriptional or post-transcriptional level, modulating plant growth, development, antiviral defence, and stress responses. Argonaute (AGO), DCL (Dicer-like), and RNA-dependent RNA polymerase (RDR) are key proteins in this process. Here, these three protein families were identified in Chenopodium quinoa. Further, their phylogenetic relationships with Arabidopsis, their domains, three-dimensional structure modelling, subcellular localization, and functional annotation and expression were analysed. Whole-genome sequence analysis predicted 21 CqAGO, eight CqDCL, and 11 CqRDR genes in quinoa. All three protein families clustered into phylogenetic clades corresponding to those of Arabidopsis, including three AGO clades, four DCL clades, and four RDR clades, suggesting evolutionary conservation. Domain and protein structure analyses of the three gene families showed almost complete homogeneity among members of the same group. Gene ontology annotation revealed that the predicted gene families might be directly involved in RNAi and other important pathways. Largely, these gene families showed significant tissue-specific expression patterns, RNA-sequencing (RNA-seq) data revealed that 20 CqAGO, seven CqDCL, and ten CqRDR genes tended to have preferential expression in inflorescences. Most of them being downregulated in response to drought, cold, salt and low phosphate stress. To our knowledge, this is the first study to elucidate these key protein families involved in the RNAi pathway in quinoa, which are significant for understanding the mechanisms underlying stress responses in this plant.
Lung cancer is the most common cause of cancer-related deaths in the world. One of the reasons of poor prognosis and high mortality of lung cancer patients is the diagnosis of the disease in its advanced stage. Despite innovative diagnostic methods and multiple completed and ongoing clinical trials aiming at therapy improvement, no significant increase in patients' long-term survival has been noted over last decades. Patients would certainly benefit from early detection of lung cancer. Therefore, it is crucial to find new biomarkers that can help predict outcomes and tumor responses in order to maximize therapy effectiveness and avoid over- or under-treating patients with lung cancer. Nowadays, scientists' attention is mainly dedicated to so-called liquid biopsy, which is fully non-invasive and easily available method based on simple blood draw. Among common liquid biopsy elements, circulating tumor nucleic acids are worth mentioning. Epigenetic biomarkers, particularly miRNA expression, have several distinct features that make them promising prognostic markers. In this review, we described miRNA's involvement in tumorigenesis and present it as a predictor of cancer development and progression, potential indicator of treatment efficacy, and most importantly promising therapeutic target.
Dicer is a highly conserved ribonuclease in evolution. It belongs to the RNase III family and can specifically recognize and cleave double-stranded RNA (dsRNA). In this study, the genome and transcriptome of Chilo suppressalis were analyzed, and it was found that there were two members in the Dicer family, named Dcr1 and Dcr2. The dsRNAs of Dcr1 and Dcr2 genes were synthesized and fed to C. suppressalis larvae. The C-factor of C. suppressalis was selected as the marker gene. The results showed that both Dcr1 and Dcr2 genes were significantly knocked down. The larval mortality was significantly reduced by 43.50% (p < 0.05) after feeding on dsC-factor and dsDcr1. The transcription levels of C-factor genes were significantly increased by 33.95% (p < 0.05) and 32.94% (p < 0.05) when the larvae fed with dsDcr2 + dsC-factor for 72 h and 96 h, respectively. Furthermore, the mortality was significantly decreased by 79% (p < 0.05) after feeding dsC-factor and dsDcr2. These findings imply that Dcr1 can decrease the lethal effect of C-factor gene but cannot affect its RNAi efficiency and Dcr2 can decrease the lethal effect of C-factor gene by inhibiting RNAi efficiency.
In plants, microRNAs (miRNAs) associate with ARGONAUTE (AGO) proteins and act as sequence-specific repressors of target gene expression, at the post-transcriptional level through target transcript cleavage and/or translational inhibition. MiRNAs are mainly transcribed by DNA-dependent RNA polymerase II (POL II) and processed by DICER LIKE1 (DCL1) complex into 21∼22 nucleotide (nt) long. Although the main molecular framework of miRNA biogenesis and modes of action have been established, there are still new requirements continually emerging in the recent years. The studies on the involvement factors in miRNA biogenesis indicate that miRNA biogenesis is not accomplished separately step by step, but is closely linked and dynamically regulated with each other. In this article, we will summarize the current knowledge on miRNA biogenesis, including MIR gene transcription, primary miRNA (pri-miRNA) processing, miRNA AGO1 loading and nuclear export; and miRNA metabolism including methylation, uridylation and turnover. We will describe how miRNAs are produced and how the different steps are regulated. We hope to raise awareness that the linkage between different steps and the subcellular regulation are becoming important for the understanding of plant miRNA biogenesis and modes of action.
The RNase III endoribonuclease Dicer was discovered to be associated with cleavage of double-stranded RNA in 2001. Since then, many advances in our understanding of Dicer function have revealed that the enzyme plays a major role not only in microRNA biology but also in multiple RNA interference-related pathways. Yet, there is still much to be learned regarding Dicer structure-function in relation to how Dicer and Dicer-like enzymes initiate their cleavage reaction and release the desired RNA product. This Perspective describes the latest advances in Dicer structural studies, expands on what we have learned from this data, and outlines key gaps in knowledge that remain to be addressed. More specifically, we focus on human Dicer and highlight the intermediate processing steps where there is a lack of structural data to understand how the enzyme traverses from pre-cleavage to cleavage-competent states. Understanding these details is necessary to model Dicer's function as well as develop more specific microRNA-targeted therapeutics for the treatment of human diseases.
Retroviral integrases (INs) contain two known metal binding domains. The N-terminal domain includes a zinc finger motif and has been shown to bind Zn2+, whereas the central catalytic core domain includes a triad of acidic amino acids that bind Mn2+ or Mg2+, the metal cofactors required for enzymatic activity. The integration reaction occurs in two distinct steps; the first is a specific endonucleolytic cleavage step called "processing," and the second is a polynucleotide transfer or "joining" step. Our previous results showed that the metal preference for in vitro activity of avian sarcoma virus IN is Mn2+ > Mg2+ and that a single cation of either metal is coordinated by two of the three critical active site residues (Asp-64 and Asp-121) in crystals of the isolated catalytic domain. Here, we report that Ca2+, Zn2+, and Cd2+ can also bind in the active site of the catalytic domain. Furthermore, two zinc and cadmium cations are bound at the active site, with all three residues of the active site triad (Asp-64, Asp-121, and Glu-157) contributing to their coordination. These results are consistent with a two-metal mechanism for catalysis by retroviral integrases. We also show that Zn2+ can serve as a cofactor for the endonucleolytic reactions catalyzed by either the full-length protein, a derivative lacking the N-terminal domain, or the isolated catalytic domain of avian sarcoma virus IN. However, polynucleotidyl transferase activities are severely impaired or undetectable in the presence of Zn2+. Thus, although the processing and joining steps of integrase employ a similar mechanism and the same active site triad, they can be clearly distinguished by their metal preferences.
In a diverse group of organisms that includes Caenorhabditis elegans, Drosophila, planaria, hydra, trypanosomes, fungi and plants, the introduction of double-stranded RNAs inhibits gene expression in a sequence-specific manner. These responses, called RNA interference or post-transcriptional gene silencing, may provide anti-viral defence, modulate transposition or regulate gene expression. We have taken a biochemical approach towards elucidating the mechanisms underlying this genetic phenomenon. Here we show that 'loss-of-function' phenotypes can be created in cultured Drosophila cells by transfection with specific double-stranded RNAs. This coincides with a marked reduction in the level of cognate cellular messenger RNAs. Extracts of transfected cells contain a nuclease activity that specifically degrades exogenous transcripts homologous to transfected double-stranded RNA. This enzyme contains an essential RNA component. After partial purification, the sequence-specific nuclease co-fractionates with a discrete, approximately 25-nucleotide RNA species which may confer specificity to the enzyme through homology to the substrate mRNAs.
RNA interference (RNAi) is the mechanism through which double-stranded RNAs silence cognate genes. In plants, this can occur at both the transcriptional and the post-transcriptional levels; however, in animals, only post-transcriptional RNAi has been reported to date. In both plants and animals, RNAi is characterized by the presence of RNAs of about 22 nucleotides in length that are homologous to the gene that is being suppressed. These 22-nucleotide sequences serve as guide sequences that instruct a multicomponent nuclease, RISC, to destroy specific messenger RNAs. Here we identify an enzyme, Dicer, which can produce putative guide RNAs. Dicer is a member of the RNase III family of nucleases that specifically cleave double-stranded RNAs, and is evolutionarily conserved in worms, flies, plants, fungi and mammals. The enzyme has a distinctive structure, which includes a helicase domain and dual RNase III motifs. Dicer also contains a region of homology to the RDE1/QDE2/ARGONAUTE family that has been genetically linked to RNAi.
The 21-nucleotide small temporal RNA (stRNA) let-7regulates developmental timing in Caenorhabditis elegans and probably in other bilateral animals. We present in vivo and in vitro evidence that in Drosophila melanogaster a developmentally regulated precursor RNA is cleaved by an RNA interference-like mechanism to produce mature let-7 stRNA. Targeted destruction in cultured human cells of the messenger RNA encoding the enzyme Dicer, which acts in the RNA
interference pathway, leads to accumulation of the let-7 precursor. Thus, the RNA interference and stRNA pathways intersect. Both pathways require the RNA-processing enzyme Dicer
to produce the active small-RNA component that represses gene expression.
Eukaryotic heterochromatin is characterized by a high density of repeats and transposons, as well as by modified histones,
and influences both gene expression and chromosome segregation. In the fission yeast Schizosaccharomyces pombe, we deleted the argonaute, dicer, and RNA-dependent RNA polymerase gene homologs, which encode part of the machinery responsible
for RNA interference (RNAi). Deletion results in the aberrant accumulation of complementary transcripts from centromeric heterochromatic
repeats. This is accompanied by transcriptional de-repression of transgenes integrated at the centromere, loss of histone
H3 lysine-9 methylation, and impairment of centromere function. We propose that double-stranded RNA arising from centromeric
repeats targets formation and maintenance of heterochromatin through RNAi.
This new package will provide easy-to-use access to crystallographic structure solution, model building and structure analysis. It will be possible for any developer to integrate scientific software into the system.
Dicer is a multi-domain RNase III-related endonuclease responsible for processing double-stranded RNA (dsRNA) to small interfering RNAs (siRNAs) during a process of RNA interference (RNAi). It also catalyses excision of the regulatory microRNAs from their precursors. In this work, we describe the purification and properties of a recombinant human Dicer. The protein cleaves dsRNAs into approximately 22 nucleotide siRNAs. Accumulation of processing intermediates of discrete sizes, and experiments performed with substrates containing modified ends, indicate that Dicer preferentially cleaves dsRNAs at their termini. Binding of the enzyme to the substrate can be uncoupled from the cleavage step by omitting Mg(2+) or performing the reaction at 4 degrees C. Activity of the recombinant Dicer, and of the endogenous protein present in mammalian cell extracts, is stimulated by limited proteolysis, and the proteolysed enzyme becomes active at 4 degrees C. Cleavage of dsRNA by purifed Dicer and the endogenous enzyme is ATP independent. Additional experiments suggest that if ATP participates in the Dicer reaction in mammalian cells, it might be involved in product release needed for the multiple turnover of the enzyme.
The RNA interference (RNAi) pathway is initiated by processing long double-stranded RNA into small interfering RNA (siRNA).
The siRNA-generating enzyme was purified from Drosophila S2cells and consists of two stoichiometric subunits: Dicer-2(DCR-2) and a previously unknown protein that we named R2D2.
R2D2 is homologous to the Caenorhabditis elegans RNAi protein RDE-4. Association with R2D2 does not affect the enzymatic activity of DCR-2. Rather, the DCR-2/R2D2 complex,
but not DCR-2 alone, binds to siRNA and enhances sequence-specific messenger RNA degradation mediated by the RNA-initiated
silencing complex (RISC). These results indicate that R2D2 bridges the initiation and effector steps of the Drosophila RNAi pathway by facilitating siRNA passage from Dicer to RISC.
This paper accompanies a lecture given at the 2003 CCP4 Study Weekend on experimental phasing. The first part is an overview of the fundamentals of Patterson methods and direct methods with the audience of the CCP4 Study Weekend in mind. In the second part, a new hybrid substructure search is outlined.
The endonuclease dicer cleaves RNAs that are 100% double stranded and certain RNAs with extensive but <100% pairing to release
∼21-nucleotide (nt) fragments. Circular 1,679-nt genomic and antigenomic RNAs of human hepatitis delta virus (HDV) can fold
into a rod-like structure with 74% pairing. However, during HDV replication in hepatocytes of human, woodchuck, and mouse
origin, no ∼21-nt RNAs were detected. Likewise, in vitro, purified recombinant dicer gave <0.2% cleavage of unit-length HDV
RNAs. Similarly, rod-like RNAs of potato spindle tuber viroid (PSTVd) and avocado sunblotch viroid (ASBVd) were only 0.5%
cleaved. Furthermore, when a 66-nt hairpin RNA with 79% pairing, the putative precursor to miR-122, which is an abundant liver
micro-RNA, replaced one end of HDV genomic RNA, it was poorly cleaved, both in vivo and in vitro. In contrast, this 66-nt
hairpin, in the absence of appended HDV sequences, was >80% cleaved in vitro. Other 66-nt hairpins derived from one end of
genomic HDV, PSTVd, or ASBVd RNAs were also cleaved. Apparently, for unit-length RNAs of HDV, PSTVd, and ASBVd, it is the
extended structure with <100% base pairing that confers significant resistance to dicer action.
RISC, the RNA-induced silencing complex, uses short interfering RNAs (siRNAs) or micro RNAs (miRNAs) to select its targets in a sequence-dependent manner. Key RISC components are Argonaute proteins, which contain two characteristic domains, PAZ and PIWI. PAZ is highly conserved and is found only in Argonaute proteins and Dicer. We have solved the crystal structure of the PAZ domain of Drosophila Argonaute2. The PAZ domain contains a variant of the OB fold, a module that often binds single-stranded nucleic acids. PAZ domains show low-affinity nucleic acid binding, probably interacting with the 3' ends of single-stranded regions of RNA. PAZ can bind the characteristic two-base 3' overhangs of siRNAs, indicating that although PAZ may not be a primary nucleic acid binding site in Dicer or RISC, it may contribute to the specific and productive incorporation of siRNAs and miRNAs into the RNAi pathway.
RNA interference (RNAi) is a widespread silencing mechanism that acts at both the posttranscriptional and transcriptional
levels. Here, we describe the purification of an RNAi effector complex termed RITS (RNA-induced initiation of transcriptional
gene silencing) that is required for heterochromatin assembly in fission yeast. The RITS complex contains Ago1 (the fission
yeast Argonaute homolog), Chp1 (a heterochromatin-associated chromodomain protein), and Tas3 (a novel protein). In addition, the complex
contains small RNAs that require the Dicer ribonuclease for their production. These small RNAs are homologous to centromeric
repeats and are required for the localization of RITS to heterochromatic domains. The results suggest a mechanism for the
role of the RNAi machinery and small RNAs in targeting of heterochromatin complexes and epigenetic gene silencing at specific
chromosomal loci.
Multicellular eukaryotes produce small RNA molecules (approximately 21-24 nucleotides) of two general types, microRNA (miRNA) and short interfering RNA (siRNA). They collectively function as sequence-specific guides to silence or regulate genes, transposons, and viruses and to modify chromatin and genome structure. Formation or activity of small RNAs requires factors belonging to gene families that encode DICER (or DICER-LIKE [DCL]) and ARGONAUTE proteins and, in the case of some siRNAs, RNA-dependent RNA polymerase (RDR) proteins. Unlike many animals, plants encode multiple DCL and RDR proteins. Using a series of insertion mutants of Arabidopsis thaliana, unique functions for three DCL proteins in miRNA (DCL1), endogenous siRNA (DCL3), and viral siRNA (DCL2) biogenesis were identified. One RDR protein (RDR2) was required for all endogenous siRNAs analyzed. The loss of endogenous siRNA in dcl3 and rdr2 mutants was associated with loss of heterochromatic marks and increased transcript accumulation at some loci. Defects in siRNA-generation activity in response to turnip crinkle virus in dcl2 mutant plants correlated with increased virus susceptibility. We conclude that proliferation and diversification of DCL and RDR genes during evolution of plants contributed to specialization of small RNA-directed pathways for development, chromatin structure, and defense.
Escherichia coli ribonuclease III (RNase III; EC 3.1.24) is a double-stranded(ds)-RNA-specific endonuclease with key roles in diverse RNA
maturation and decay pathways. E.coli RNase III is a member of a structurally distinct superfamily that includes Dicer, a central enzyme in the mechanism of RNA
interference. E.coli RNase III requires a divalent metal ion for activity, with Mg2+ as the preferred species. However, neither the function(s) nor the number of metal ions involved in catalysis is known. To
gain information on metal ion involvement in catalysis, the rate of cleavage of the model substrate R1.1 RNA was determined
as a function of Mg2+ concentration. Single-turnover conditions were applied, wherein phosphodiester cleavage was the rate-limiting event. The
measured Hill coefficient (n H) is 2.0 ± 0.1, indicative of the involvement of two Mg2+ ions in phosphodiester hydrolysis. It is also shown that 2-hydroxy-4H-isoquinoline-1,3-dione—an inhibitor of ribonucleases
that employ two divalent metal ions in their catalytic sites—inhibits E.coli RNase III cleavage of R1.1 RNA. The IC50 for the compound is 14 μM for the Mg2+-supported reaction, and 8 μM for the Mn2+-supported reaction. The compound exhibits noncompetitive inhibitory kinetics, indicating that it does not perturb substrate
binding. Neither the O-methylated version of the compound nor the unsubstituted imide inhibit substrate cleavage, which is
consistent with a specific interaction of the N-hydroxyimide with two closely positioned divalent metal ions. A preliminary model is presented for functional roles of two
divalent metal ions in the RNase III catalytic mechanism.
MicroRNAs (miRNAs) are small RNAs that regulate gene expression posttranscriptionally. To block all miRNA formation in zebrafish,
we generated maternal-zygotic dicer (MZdicer) mutants that disrupt the Dicer ribonuclease III and double-stranded RNA-binding domains. Mutant embryos do not process precursor
miRNAs into mature miRNAs, but injection of preprocessed miRNAs restores gene silencing, indicating that the disrupted domains
are dispensable for later steps in silencing. MZdicer mutants undergo axis formation and differentiate multiple cell types but display abnormal morphogenesis during gastrulation,
brain formation, somitogenesis, and heart development. Injection of miR-430 miRNAs rescues the brain defects in MZdicer mutants, revealing essential roles for miRNAs during morphogenesis.
One of the key characteristics of stem cells is their capacity to divide for long periods of time in an environment where most of the cells are quiescent. Therefore, a critical question in stem cell biology is how stem cells escape cell division stop signals. Here, we report the necessity of the microRNA (miRNA) pathway for proper control of germline stem cell (GSC) division in Drosophila melanogaster. Analysis of GSCs mutant for dicer-1 (dcr-1), the double-stranded RNaseIII essential for miRNA biogenesis, revealed a marked reduction in the rate of germline cyst production. These dcr-1 mutant GSCs exhibit normal identity but are defective in cell cycle control. On the basis of cell cycle markers and genetic interactions, we conclude that dcr-1 mutant GSCs are delayed in the G1 to S transition, which is dependent on the cyclin-dependent kinase inhibitor Dacapo, suggesting that miRNAs are required for stem cells to bypass the normal G1/S checkpoint. Hence, the miRNA pathway might be part of a mechanism that makes stem cells insensitive to environmental signals that normally stop the cell cycle at the G1/S transition.
MicroRNAs (miRNAs) are ∼21-nucleotide-long RNA molecules regulating gene expression in multicellular eukaryotes. In metazoa,
miRNAs act by imperfectly base-pairing with the 3′ untranslated region of target messenger RNAs (mRNAs) and repressing protein
accumulation by an unknown mechanism. We demonstrate that endogenous let-7 microribonucleoproteins (miRNPs) or the tethering
of Argonaute (Ago) proteins to reporter mRNAs in human cells inhibit translation initiation. M7G-cap-independent translation is not subject to repression, suggesting that miRNPs interfere with recognition of the cap.
Repressed mRNAs, Ago proteins, and miRNAs were all found to accumulate in processing bodies. We propose that localization
of mRNAs to these structures is a consequence of translational repression.
Abundant ∼28-nucleotide RNAs that are thought to direct histone H3 lysine 9 (H3K9) methylation and promote the elimination
of nearly 15 Mbp of DNA from the developing somatic genome are generated during Tetrahymena thermophila conjugation. To identify the protein(s) that generates these small RNAs, we studied three Dicer-related genes encoded within
the Tetrahymena genome, two that contain both RNase III and RNA helicase motifs, Dicer 1 (DCR1) and DCR2, and a third that lacks the helicase
domain, Dicer-like 1 (DCL1). DCL1 is expressed upon the initiation of conjugation, and the protein localizes to meiotic micronuclei when bidirectional germ
line transcription occurs and small RNAs begin to accumulate. Cells in which we disrupted the DCL1 gene (ΔDCL1) grew normally and initiated conjugation as wild-type cells but arrested near the end of development and eventually died,
unable to resume vegetative growth. These ΔDCL1 cells failed to generate the abundant small RNAs but instead accumulated germ line-limited transcripts. Together, our findings
demonstrate that these transcripts are the precursors of the small RNAs and that DCL1 performs RNA processing within the micronucleus. Postconjugation ΔDCL1 cells die without eliminating the germ line-limited DNA sequences from their newly formed somatic macronuclei, a result that
shows that this Dicer-related gene is required for programmed DNA rearrangements. Surprisingly, ΔDCL1 cells were not deficient in overall H3K9 methylation, but this modification was not enriched on germ line-limited sequences
as it is in wild-type cells, which clearly demonstrates that these small RNAs are essential for its targeting to specific
loci.
Structures of two restriction endonucleases, BamHI and PvuII, were reported in the past year. This doubles the number of restriction endonuclease structures now known from two to four, and enables a comparative analysis of their structures and modes of DNA recognition. Despite a lack of sequence homology between the enzymes, BamHI turns out to resemble EcoRI, and PvuII turns out to resemble EcoRV. The active-site regions are structurally similar in all four enzymes, but their mechanisms of cleavage may differ.
Restriction enzymes cannot cleave DNA without a metal ion cofactor. The specificities of the EcoRV and EcoRI endonucleases for metals were studied by measuring DNA cleavage rates with several metal ions and with combinations of metal ions. Both EcoRV and EcoRI had optimal activities with Mg2+, were less active with several other ions including Mn2+, and had virtually no activity with Ca2+. But the activities of EcoRV and EcoRI with either Mg2+ or Mn2+ were perturbed by Ca2+. For EcoRI, both Mg2+- and Mn(2+)-dependent activities, at both cognate and noncognate sites, were all inhibited by Ca2+. The activity of EcoRV at its recognition site with Mg2+ was also inhibited by Ca2+. But the Mn(2+)-dependent reaction at the EcoRV recognition site was stimulated by Ca2+. EcoRV activities at noncognate sites with either Mg2+ or Mn2+ displayed a biphasic response to Ca2+: stimulation at low concentrations of Ca2+ and inhibition at high concentrations. These observations, together with the known structures of the proteins, indicate that EcoRI needs only one metal ion per active site and is inactive when Mg2+ is displaced by Ca2+, while EcoRV needs two and that the displacement of one by Ca2+ can enhance activity. We propose a mechanism for phosphodiester hydrolysis by EcoRV that involves two metal ions.
Double-stranded RNA (dsRNA) induces sequence-specific posttranscriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a Drosophila in vitro system, we demonstrate that 21- and 22-nt RNA fragments are the sequence-specific mediators of RNAi. The short interfering RNAs (siRNAs) are generated by an RNase III-like processing reaction from long dsRNA. Chemically synthesized siRNA duplexes with overhanging 3' ends mediate efficient target RNA cleavage in the lysate, and the cleavage site is located near the center of the region spanned by the guiding siRNA. Furthermore, we provide evidence that the direction of dsRNA processing determines whether sense or antisense target RNA can be cleaved by the siRNA-protein complex.
RNAi is a gene-silencing phenomenon triggered by double-stranded (ds) RNA and involves the generation of 21 to 26 nt RNA segments that guide mRNA destruction. In Caenorhabditis elegans, lin-4 and let-7 encode small temporal RNAs (stRNAs) of 22 nt that regulate stage-specific development. Here we show that inactivation of genes related to RNAi pathway genes, a homolog of Drosophila Dicer (dcr-1), and two homologs of rde-1 (alg-1 and alg-2), cause heterochronic phenotypes similar to lin-4 and let-7 mutations. Further we show that dcr-1, alg-1, and alg-2 are necessary for the maturation and activity of the lin-4 and let-7 stRNAs. Our findings suggest that a common processing machinery generates guide RNAs that mediate both RNAi and endogenous gene regulation.
The ribonuclease III superfamily represents a structurally related group of double-strand (ds) specific endoribonucleases which play key roles in diverse prokaryotic and eukaryotic RNA maturation and degradation pathways. A dsRNA-binding domain (dsRBD) is a conserved feature of the superfamily and is important for substrate recognition. RNase III family members also exhibit a "catalytic" domain, in part defined by a set of highly conserved amino acids, of which at least one (a glutamic acid) is important for cleavage but not for substrate binding. However, it is not known whether the catalytic domain requires the dsRBD for activity. This report shows that a truncated form of Escherichia coli RNase III lacking the dsRBD (RNase III[DeltadsRBD]) can accurately cleave small processing substrates in vitro. Optimal activity of RNase III[DeltadsRBD] is observed at low salt concentrations (<60 mM Na(+)), either in the presence of Mg(2+) (>25 mM) or Mn(2+) ( approximately 5 mM). At 60 mM Na(+) and 5 mM Mn(2+) the catalytic efficiency of RNase III[DeltadsRBD] is similar to that of RNase III at physiological salt concentrations and Mg(2+). In the presence of Mg(2+) RNase III[DeltadsRBD] is less efficient than the wild-type enzyme, due to a higher K(m). Similar to RNase III, RNase III[DeltadsRBD] is inhibited by high concentrations of Mn(2+), which is due to metal ion occupancy of an inhibitory site on the enzyme. RNase III[DeltadsRBD] retains strict specificity for dsRNA, as indicated by its inability to cleave (rA)(25), (rU)(25), or (rC)(25). Moreover, dsDNA, ssDNA, or an RNA-DNA hybrid are not cleaved. Low (micromolar) concentrations of ethidium bromide block RNase III[DeltadsRBD] cleavage of substrate, which is similar to the inhibition seen with RNase III and is indicative of an intercalative mode of inhibition. Finally, RNase III[DeltadsRBD] is sensitive to specific Watson-Crick base-pair substitutions which also inhibit RNase III. These findings support an RNase III mechanism of action in which the catalytic domain (i) can function independently of the dsRBD, (ii) is dsRNA-specific, and (iii) participates in cleavage site selection.
Aquifex aeolicus Ribonuclease III (Aa-RNase III) belongs to the family of Mg(2+)-dependent endonucleases that show specificity for double-stranded RNA (dsRNA). RNase III is conserved in all known bacteria and eukaryotes and has 1-2 copies of a 9-residue consensus sequence, known as the RNase III signature motif. The bacterial RNase III proteins are the simplest, consisting of two domains: an N-terminal endonuclease domain, followed by a double-stranded RNA binding domain (dsRBD). The three-dimensional structure of the dsRBD in Escherichia coli RNase III has been elucidated; no structural information is available for the endonuclease domain of any RNase III.
We present the crystal structures of the Aa-RNase III endonuclease domain in its ligand-free form and in complex with Mn(2+). The structures reveal a novel protein fold and suggest a mechanism for dsRNA cleavage. On the basis of structural, genetic, and biological data, we have constructed a hypothetical model of Aa-RNase III in complex with dsRNA and Mg(2+) ion, which provides the first glimpse of RNase III in action.
The functional Aa-RNase III dimer is formed via mainly hydrophobic interactions, including a "ball-and-socket" junction that ensures accurate alignment of the two monomers. The fold of the polypeptide chain and its dimerization create a valley with two compound active centers at each end of the valley. The valley can accommodate a dsRNA substrate. Mn(2+) binding has significant impact on crystal packing, intermolecular interactions, thermal stability, and the formation of two RNA-cutting sites within each compound active center.
RNase III endonucleases cleave double-stranded RNA, transforming precursor RNAs into mature RNAs that act in pre-mRNA splicing, RNA modification, translation, gene silencing, and the regulation of developmental timing. The recently solved structure of an RNase III endonuclease domain provides a hint at how this family of ribonucleases functions.
RNA silencing in plants is a form of antiviral defense that was originally discovered from the anomalous effects of transgenes. The process is associated with a systemic signal, presumed to be RNA, and is suppressed by plant virus-encoded proteins. One of these proteins, the 2b protein of cucumber mosaic virus, prevents systemic spread of the signal molecule but, curiously, is located in the nucleus of infected cells. The antiviral role of silencing might also apply in animals because a suppressor of silencing encoded by an insect virus was identified recently.
During development of the somatic macronucleus from the germline micronucleus in ciliates, chromosome rearrangements occur in which specific regions of DNA are eliminated and flanking regions are healed, either by religation or construction of telomeres. We identified a gene, TWI1, in Tetrahymena thermophila that is homologous to piwi and is required for DNA elimination. We also found that small RNAs were specifically expressed prior to chromosome rearrangement during conjugation. These RNAs were not observed in TWI1 knockout cells and required PDD1, another gene required for rearrangement, for expression. We propose that these small RNAs function to specify sequences to be eliminated by a mechanism similar to RNA-mediated gene silencing.
The regulation of higher-order chromosome structure is central to cell division and sexual reproduction. Heterochromatin assembly at the centromeres facilitates both kinetochore formation and sister chromatid cohesion, and the formation of specialized chromatin structures at telomeres serves to maintain the length of telomeric repeats, to suppress recombination, and to aid in formation of a bouquet-like structure that facilitates homologous chromosome pairing during meiosis. In fission yeast, genes encoding the Argonaute, Dicer, and RNA-dependent RNA polymerase factors involved in RNA interference (RNAi) are required for heterochromatin formation at the centromeres and mating type region. In this study, we examine the effects of deletions of the fission yeast RNAi machinery on chromosome dynamics during mitosis and meiosis. We find that the RNAi machinery is required for the accurate segregation of chromosomes. Defects in mitotic chromosome segregation are correlated with loss of cohesin at centromeres. Although the telomeres of RNAi mutants maintain silencing, length, and localization of the heterochromatin protein Swi6, we discovered defects in the proper clustering of telomeres in interphase mitotic cells. Furthermore, a small proportion of RNAi mutant cells display aberrant telomere clustering during meiotic prophase. This study demonstrates that the fission yeast RNAi machinery is required for the proper regulation of chromosome architecture during mitosis and meiosis.
The discovery of RNA-mediated gene-silencing pathways, including RNA interference, highlights a fundamental role of short RNAs in eukaryotic gene regulation and antiviral defence. Members of the Dicer and Argonaute protein families are essential components of these RNA-silencing pathways. Notably, these two families possess an evolutionarily conserved PAZ (Piwi/Argonaute/Zwille) domain whose biochemical function is unknown. Here we report the nuclear magnetic resonance solution structure of the PAZ domain from Drosophila melanogaster Argonaute 1 (Ago1). The structure consists of a left-handed, six-stranded beta-barrel capped at one end by two alpha-helices and wrapped on one side by a distinctive appendage, which comprises a long beta-hairpin and a short alpha-helix. Using structural and biochemical analyses, we demonstrate that the PAZ domain binds a 5-nucleotide RNA with 1:1 stoichiometry. We map the RNA-binding surface to the open face of the beta-barrel, which contains amino acids conserved within the PAZ domain family, and we define the 5'-to-3' orientation of single-stranded RNA bound within that site. Furthermore, we show that PAZ domains from different human Argonaute proteins also bind RNA, establishing a conserved function for this domain.
RNA interference is a conserved mechanism that regulates gene expression in response to the presence of double-stranded (ds)RNAs. The RNase III-like enzyme Dicer first cleaves dsRNA into 21-23-nucleotide small interfering RNAs (siRNAs). In the effector step, the multimeric RNA-induced silencing complex (RISC) identifies messenger RNAs homologous to the siRNAs and promotes their degradation. The Argonaute 2 protein (Ago2) is a critical component of RISC. Both Argonaute and Dicer family proteins contain a common PAZ domain whose function is unknown. Here we present the three-dimensional nuclear magnetic resonance structure of the Drosophila melanogaster Ago2 PAZ domain. This domain adopts a nucleic-acid-binding fold that is stabilized by conserved hydrophobic residues. The nucleic-acid-binding patch is located in a cleft between the surface of a central beta-barrel and a conserved module comprising strands beta3, beta4 and helix alpha3. Because critical structural residues and the binding surface are conserved, we suggest that PAZ domains in all members of the Argonaute and Dicer families adopt a similar fold with nucleic-acid binding function, and that this plays an important part in gene silencing.
Our understanding of RNA interference has been enhanced by new data concerning RNase III molecules. The role of Dicer has previously been established in RNAi as the originator of 22-mers characteristic of silencing phenomena. Recently, a related RNAse III enzyme, Drosha, has surfaced as another component of the RNAi pathway. In addition to biochemistry, protein structures have proven to be helpful in deciphering the enzymology of RNase III molecules.
Short RNAs mediate gene silencing, a process associated with virus resistance, developmental control and heterochromatin formation in eukaryotes. RNA silencing is initiated through Dicer-mediated processing of double-stranded RNA into small interfering RNA (siRNA). The siRNA guide strand associates with the Argonaute protein in silencing effector complexes, recognizes complementary sequences and targets them for silencing. The PAZ domain is an RNA-binding module found in Argonaute and some Dicer proteins and its structure has been determined in the free state. Here, we report the 2.6 A crystal structure of the PAZ domain from human Argonaute eIF2c1 bound to both ends of a 9-mer siRNA-like duplex. In a sequence-independent manner, PAZ anchors the 2-nucleotide 3' overhang of the siRNA-like duplex within a highly conserved binding pocket, and secures the duplex by binding the 7-nucleotide phosphodiester backbone of the overhang-containing strand and capping the 5'-terminal residue of the complementary strand. On the basis of the structure and on binding assays, we propose that PAZ might serve as an siRNA-end-binding module for siRNA transfer in the RNA silencing pathway, and as an anchoring site for the 3' end of guide RNA within silencing effector complexes.
Dicer is a multidomain ribonuclease that processes double-stranded RNAs (dsRNAs) to 21 nt small interfering RNAs (siRNAs) during RNA interference, and excises microRNAs from precursor hairpins. Dicer contains two domains related to the bacterial dsRNA-specific endonuclease, RNase III, which is known to function as a homodimer. Based on an X-ray structure of the Aquifex aeolicus RNase III, models of the enzyme interaction with dsRNA, and its cleavage at two composite catalytic centers, have been proposed. We have generated mutations in human Dicer and Escherichia coli RNase III residues implicated in the catalysis, and studied their effect on RNA processing. Our results indicate that both enzymes have only one processing center, containing two RNA cleavage sites and generating products with 2 nt 3' overhangs. Based on these and other data, we propose that Dicer functions through intramolecular dimerization of its two RNase III domains, assisted by the flanking RNA binding domains, PAZ and dsRBD.
Manganese peroxidase (MnP) is an extracellular heme enzyme that catalyzes the peroxide-dependent oxidation of Mn(II) to Mn(III). The Mn(III) is released from the enzyme in complex with oxalate. One heme propionate and the side chains of Glu35, Glu39, and Asp179 were identified as Mn(II) ligands in the 2.0 A resolution crystal structure. The new 1.45 A crystal structure of MnP complexed with Mn(II) provides a more accurate view of the Mn-binding site. New features include possible partial protonation of Glu39 in the Mn-binding site and glycosylation at Ser336. This is also the first report of MnP-inhibitor complex structures. At the Mn-binding site, divalent Cd(II) exhibits octahedral, hexacoordinate ligation geometry similar to that of Mn(II). Cd(II) also binds to a putative second weak metal-binding site with tetrahedral geometry at the C-terminus of the protein. Unlike that for Mn(II) and Cd(II), coordination of trivalent Sm(III) at the Mn-binding site is octacoordinate. Sm(III) was removed from a MnP-Sm(III) crystal by soaking the crystal in oxalate and then reintroduced into the binding site. Thus, direct comparisons of Sm(III)-bound and metal-free structures were made using the same crystal. No ternary complex was observed upon incubation with oxalate. The reversible binding of Sm(III) may be a useful model for the reversible binding of Mn(III) to the enzyme, which is too unstable to allow similar examination.
RNase H belongs to a nucleotidyl-transferase superfamily, which includes transposase, retroviral integrase, Holliday junction resolvase, and RISC nuclease Argonaute. We report the crystal structures of RNase H complexed with an RNA/DNA hybrid and a mechanism for substrate recognition and two-metal-ion-dependent catalysis. RNase H specifically recognizes the A form RNA strand and the B form DNA strand. Structure comparisons lead us to predict the catalytic residues of Argonaute and conclude that two-metal-ion catalysis is a general feature of the superfamily. In nucleases, the two metal ions are asymmetrically coordinated and have distinct roles in activating the nucleophile and stabilizing the transition state. In transposases, they are symmetrically coordinated and exchange roles to alternately activate a water and a 3'-OH for successive strand cleavage and transfer by a ping-pong mechanism.
We report the 3.4 angstrom crystal structure of a catalytically active group I intron splicing intermediate containing the
complete intron, both exons, the scissile phosphate, and all of the functional groups implicated in catalytic metal ion coordination,
including the 2′-OH of the terminal guanosine. This structure suggests that, like protein phosphoryltransferases, an RNA phosphoryltransferase
can use a two-metal-ion mechanism. Two Mg2+ ions are positioned 3.9 angstroms apart and are directly coordinated by all six of the biochemically predicted ligands. The
evolutionary convergence of RNA and protein active sites on the same inorganic architecture highlights the intrinsic chemical
capacity of the two-metal-ion catalytic mechanism for phosphoryl transfer.
RNase III enzymes are a highly conserved family of proteins that specifically cleave double-stranded (ds)RNA. These proteins are involved in a diverse group of functions, including ribosomal RNA processing, mRNA maturation and decay, snRNA and snoRNA processing, and RNA interference. Here we report the crystal structure of the nuclease domain of RNase III from the pathogen Mycobacterium tuberculosis. Although globally similar to other RNase III folds, this structure has some features not observed in previously reported models. These include the presence of an additional metal ion near the catalytic site, as well as conserved secondary structural elements that are proposed to have functional roles in the recognition of dsRNAs.
Endoribonuclease III (RNase III) plays an important role in the processing of rRNA and mRNAs. It is timely to summarize the most relevant insights obtained during the last years stemming from RNase III. With this aim, the present mini-review provides a wealth of new information focusing on the distribution and architecture of RNase III, substrate recognition, cleavage mechanisms and regulation of gene expression.
- . Z Xie
@BULLET 18. Z. Xie et al., PLoS Biol. 2, E104 (2004). [CrossRef] [Medline][UC-eLinks]
- . G Hutvagner
@BULLET 9. G. Hutvagner et al., Science 293, 834 (2001).[Abstract/Free Full Text]
- . A J Giraldez
@BULLET 5. A. J. Giraldez et al., Science 308, 833 (2005).[Abstract/Free Full Text]
- . P D Zamore
@BULLET 15. P. D. Zamore, Mol. Cell 8, 1158 (2001). [CrossRef] [Web of Science] [Medline][UC-eLinks]
- . G Bujacz
@BULLET 25. G. Bujacz et al., J. Biol. Chem. 272, 18161 (1997).[Abstract/Free Full Text]
- . A Verdel
@BULLET 13. A. Verdel et al., Science 303, 672 (2004).[Abstract/Free Full Text]
- . K S Yan
@BULLET 31. K. S. Yan et al., Nature 426, 468 (2003). [CrossRef] [Medline][UC-eLinks]
- . A Grishok
@BULLET 4. A. Grishok et al., Cell 106, 23 (2001). [CrossRef] [Web of Science] [Medline][UC-eLinks]
- . R S Pillai
@BULLET 12. R. S. Pillai et al., Science 309, 1573 (2005).[Abstract/Free Full Text]
[Abstract/Free Full Text] @BULLET 36
- . J Chang
- P Provost
- J M Taylor
@BULLET 35. J. Chang, P. Provost, J. M. Taylor, J. Virol. 77, 11910 (2003).[Abstract/Free Full Text]
@BULLET 36. I. M. Hall, K. Noma, S. I. Grewal, Proc. Natl. Acad. Sci. U.S.A. 100, 193
(2003).[Abstract/Free Full Text]
- . T A Volpe
@BULLET 2. T. A. Volpe et al., Science 297, 1833 (2002).[Abstract/Free Full Text]
- . S D Hatfield
@BULLET 6. S. D. Hatfield et al., Nature 435, 974 (2005). [CrossRef] [Medline][UC-eLinks]