No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
C3H/HeN mouse model for the evaluation of antiviral agents for the treatment of Venezuelan equine encephalitis virus infection
Abstract
The TC-83 vaccine strain of Venezuelan equine encephalitis virus (VEEV) causes encephalitis and death in C3H/HeN mice infected by intranasal (i.n.) instillation. Since TC-83 is exempt as a select agent, this mouse model was used in the evaluation of antiviral therapies. Virus titers in the brains of infected mice peaked on 4 dpi and persisted at high levels until death at 9.4+/-0.5 dpi. Mouse brains appeared histologically normal on 2 dpi, but developed meningoencephalitis, neuropil vacuolation, and gliosis by 8 dpi. Results from a protein cytokine array showed significant elevations over time in interleukin (IL)-1alpha, IL-1beta, IL-6, IL-12, MCP-1, IFNgamma, TNFalpha, MIP-1alpha, and RANTES in homogenized brain samples of infected mice. Immunohistochemical staining showed a colocalization of viral antigen with neuron markers. Treatment with interferon-alpha B/D or ampligen significantly improved survival, brain virus titer and cytokine levels, mean day-to-death, and weight change in infected mice. The time-course of infection and disease parameters of mice infected with TC-83 VEEV were similar in many ways to disease parameters in mice infected with other VEEV strains. Thus, infection of C3H/HeN mice with TC-83 VEEV may serve as a suitable model for the evaluation of antiviral compounds for the treatment of this viral disease.
... However, at +48 h post infection (hpi), the hF5-LALA group exhibited a significant reduction in survival compared to the hF5-WT group, demonstrating that adequate protection and clearance requires intact Fc effector function in the context of an established VEEV infection. 40,41 Results ...
... hF5-WT, hF5-LALA, or human isotype control Abs were used in a series of pre-and post-exposure treatment studies using VEEV-TC83 intranasal infection in C3H/HeN mice 41 to understand the importance of Fc effector function in the context of VEEV infection ( Figure 6). Animals dosed with hF5-WT at −24 h, +24 h, and + 48 hpi exhibited little or no severe neurological symptoms and had a consistently high survival rate, across experiments (90% n = 20, 70% n = 20 and 85.7% n = 35, respectively: Figure 6b-d). ...
... TC83 challenge in C3H/HeN mice represents an acute lethal infection via intranasal inoculation, with 90-100% of animals succumbing to overwhelming meningoencephalitis within 7-10 days ( Figure 6). 41 Although viral replication kinetics and ensuing neurovirulence are delayed in the VEEV-TC83 infection model compared with WT VEEV-TrD infection, we can draw parallels between disease progression parameters, neuropathology, and lethality, that reenforce VEEV-TC83 as a highly informative model of VEEV infection. ...
The development of specific, safe, and potent monoclonal antibodies (Abs) has led to novel therapeutic options for infectious disease. In addition to preventing viral infection through neutralization, Abs can clear infected cells and induce immunomodulatory functions through engagement of their crystallizable fragment (Fc) with complement proteins and Fc receptors on immune cells. Little is known about the role of Fc effector functions of neutralizing Abs in the context of encephalitic alphavirus infection. To determine the role of Fc effector function in therapeutic efficacy against Venezuelan equine encephalitis virus (VEEV), we compared the potently neutralizing anti-VEEV human IgG F5 (hF5) Ab with intact Fc function (hF5-WT) or containing the loss of function Fc mutations L234A and L235A (hF5-LALA) in the context of VEEV infection. We observed significantly reduced binding to complement and Fc receptors, as well as differential in vitro kinetics of Fc-mediated cytotoxicity for hF5-LALA compared to hF5-WT. The in vivo efficacy of hF5-LALA was comparable to hF5-WT at −24 and + 24 h post infection, with both Abs providing high levels of protection. However, when hF5-WT and hF5-LALA were administered + 48 h post infection, there was a significant decrease in the therapeutic efficacy of hF5-LALA. Together these results demonstrate that optimal therapeutic Ab treatment of VEEV, and possibly other encephalitic alphaviruses, requires neutralization paired with engagement of immune effectors via the Fc region.
... NGS of VEEV TC-83 in brains from a lethal mouse model treated with ML336 did not detect resistance variants. Next, we aimed to examine the potential of ML336 resistance in vivo, using the mouse strain C3H/HeN, in which TC-83 can cause a lethal infection at 1 ϫ 10 7 PFU (7,24). Previously, we reported that intraperitoneal (i.p.) administration of ML336 at 25 mg/kg/day, twice per day (BID), gave complete prophylactic protection (n ϭ 8) when challenged with VEEV TC83 (24). ...
... Next, we aimed to examine the potential of ML336 resistance in vivo, using the mouse strain C3H/HeN, in which TC-83 can cause a lethal infection at 1 ϫ 10 7 PFU (7,24). Previously, we reported that intraperitoneal (i.p.) administration of ML336 at 25 mg/kg/day, twice per day (BID), gave complete prophylactic protection (n ϭ 8) when challenged with VEEV TC83 (24). Based on these data, we selected time points at days 4, 7, 8, and 14 to examine brains for the presence of viral Mice were monitored for survival and weight change ( Fig. 6A and B). ...
... Based on these data, we selected time points at days 4, 7, 8, and 14 to examine brains for the presence of viral Mice were monitored for survival and weight change ( Fig. 6A and B). As shown previously, treatment of mice with ML336 at 24 mg/kg/day over 8 days provided protection (n ϭ 7/8) through day 14, with only a single mouse succumbing to disease at 8 dpi (Fig. 6A) (6,24). In the group with VEEV TC83, a sharp decline in body weight was observed beginning at 5 dpi, whereas the ML336-treated mice continued to have a similar level of weight gain as the noninfected mice (Fig. 6B). ...
RNA viruses, including Venezuelan equine encephalitis virus (VEEV), have high mutation rates that allow for rapid adaptation to selective pressures in their environment. Antiviral compounds exert one such pressure on virus populations during infections. Next-generation sequencing allows for examination of viruses at the population level, which enables tracking of low levels of single-nucleotide polymorphisms in the population over time. Therefore, the timing and extent of the emergence of resistance to antivirals can be tracked and assessed. We show here that in VEEV, the trajectory and penetration of antiviral resistance reflected the microenvironment in which the virus population replicates. In summary, we show the diversity of VEEV within a single population under antiviral pressure and two distinct cell types, and we show that population dynamics in these viruses can be examined to better understand how they evolve over time.
... Angiotensin II (Ang II), a pro-inflammatory molecule, has been reported to induce inflammatory events after binding to its AT1 receptor and via NF-jB signaling [8][9][10], and its presence in the rat brain has been reported [11], suggesting an inflammatory role of Ang II in the brain. In the mouse model, expression of adhesion molecules and cytokine production have been reported [3,6,12]. Those events have been associated with AT1 receptor activation by Ang II [8,9]; however, the presence of this molecule associated with inflammatory molecules in the brains of mice or rats during VEE infection has not been reported. ...
... In addition to ICAM-1 and ED-1 expression, rat brain inflammation was accompanied by increased concentrations of IL-1a, IL-6, IL-10 and MCP-1 in homogenized brain samples. These cytokines have also been found to be increased in the brain of a C3H/HeN mouse infected with the TC-83 vaccine strain of VEEV [12]. However, our results were obtained in rats using a highly pathogenic strain of VEEV (Goajira strain), suggesting a similar inducer cytokine effect of attenuated and highly virulent virus in different types of rodents. ...
... IL-10 can act as an antiinflammatory molecule, since is capable of inhibiting the NF-jB, and its gene expression has been reported to be increased in VEEV-infected mice [27,28]. IL-1a has proinflammatory, proliferative and wound-healing effects, and it has been shown to be increased in the brain in both the rat and mouse models [6,12,29]. Monocyte chemoattractant protein-1 (MCP-1/CCL2) has been reported in the brain of mice infected with VEEV, and to our knowledge, this is the first report of increased brain MCP-1 in rats with VEE, which could be involved in brain ED-1 infiltration in this study [12,30]. Interleukin-6 is a cytokine that has also been reported to be increased in the mouse model of VEE [12,28]. ...
Venezuelan equine encephalitis (VEE) is a viral disease transmitted by mosquitoes. The inflammation induced by the VEE virus is associated with a high mortality rate in mice. Angiotensin II (Ang II), a pro-inflammatory molecule, is produced in the normal rat brain. There is no information about the role of this molecule in the inflammatory events occurring during VEE and the effect of inflammation on the mortality rate in VEE-virus-infected rats. This study was designed to determine the role of Ang II in VEE and to analyze the effect of inflammation on mortality in infected rats. Two groups of rats were studied: 1) Virus-infected animals and controls (n = 60) were treated with losartan (a blocker of the Ang II-AT1 receptor) or with pyrrolidine dithiocarbamate (PDTC, an inhibitor of NF-κB) or left untreated and analyzed for morbidity and mortality. 2) Animals treated using the same protocol (n = 30) were sacrificed at day 4 postinfection and analyzed by immunohistochemistry and histopathology and for cytokine production. Increased expression of Ang II, ICAM-1, ED-1 and cytokines (IL-1α, MCP-1, IL-6 and IL-10) in infected animals was observed. The main histopathology findings were dilated capillaries and capillaries with endothelial detachment. Losartan and PDTC reduced the expression of IL-1α, MCP-1, and IL-10, and the number of dilated capillaries and capillaries with endothelial detachment. Survival analysis showed that 100 % mortality was reached earlier in infected rats treated with losartan (day 14) or PDTC (day 11) than in untreated animals (day 19). These findings suggest that Ang II plays a role in VEE and that brain inflammation is protective against viral infection.
... Of particular interest to this study is the unusual virulence of TC83 in C3H/HeN (C3H) mice [3,4]. Primary aerosol or intranasal infection of C3H mice with TC83 results in high levels of mortality not seen in other inbred strains [4,5]. Intranasal administration of TC83 in C3H mice closely mimics virulent VEEV encephalitis in murine models and has been used as a model to evaluate antivirals for alphavirus infection [5,6]. ...
... Primary aerosol or intranasal infection of C3H mice with TC83 results in high levels of mortality not seen in other inbred strains [4,5]. Intranasal administration of TC83 in C3H mice closely mimics virulent VEEV encephalitis in murine models and has been used as a model to evaluate antivirals for alphavirus infection [5,6]. A clearer understanding of the host response to TC83 inoculation, given the strain's IND status, is crucial to furthering future vaccine development efforts as well as validating TC83 as the current vaccine. ...
... Previous in vivo studies demonstrated variable susceptibility of different mouse strains to TC83-induced encephalitic disease. C3H mice are highly susceptible to disease development after intranasal infection unlike other inbred strains (BALB/c and C57BL/6), which become infected but do not develop encephalitic disease [3][4][5]. To determine the basis for susceptibility in C3H mice, we examined the host response in the brain following intranasal infection with TC83. ...
... TC-83 RNA was amplified (1 cycle-50uC for 30 min, 1 cycle 95uC for 2 min and 40 cycles-95uC for 15 sec and 61uC for 60 sec) using the ABI Prism 7000. Primer-pairs (forward TCTGACAAGACGTTCCCAATCA, reverse GAA- TAACTTCCCTCCGACCACA) and Taq-man probe (59 6- carboxyfluorescein-TGTTGGAAGGGAAGATAAACGGC- TACGC-6-carboxy-N,N,N9,N9-tetramethylrhodamine-39) were originally described by Julander et al. [36]. Q-RT-PCR assays were performed using Invitrogen's RNA UltraSense TM One-Step Quantitative RT-PCR System. ...
... A higher dose of BIO (50 mg/kg) was chosen due to less potent inhibition of VEEV and BIO being previously utilized in vivo at 50 mg/kg [43]. To determine if BIO or BIOder could protect against VEEV, the VEEV TC-83 mouse model was utilized [36]. Groups of 10 mice were treated subcutaneously with vehicle, BIO (50 mg/kg) or BIOder (20 mg/kg) on Days 21, 1, 3, and 5 and monitored for 14 days. ...
... Additional studies will be critical to determine the mechanism by which GSK-3b influences replication and if these results will also translate to TrD VEEV replication. Along these lines, mouse model studies with TC-83 have indicated that mice generally display disease progression similar to those observed with VEEV TrD, including cytokine production, high titer virus in the brain, and disease symptoms such as hunching of the animals, weight loss, and ruffling of the fur [36]. Some notable differences between the models include reduced duration of viremia and lower frequency of tissue infection outside the CNS [36,71]. ...
Alphaviruses, including Venezuelan Equine Encephalitis Virus (VEEV), cause disease in both equine and humans that exhibit overt encephalitis in a significant percentage of cases. Features of the host immune response and tissue-specific responses may contribute to fatal outcomes as well as the development of encephalitis. It has previously been shown that VEEV infection of mice induces transcription of pro-inflammatory cytokines genes (e.g., IFN-γ, IL-6, IL-12, iNOS and TNF-α) within 6 h. GSK-3β is a host protein that is known to modulate pro-inflammatory gene expression and has been a therapeutic target in neurodegenerative disorders such as Alzheimer's. Hence inhibition of GSK-3β in the context of encephalitic viral infections has been useful in a neuroprotective capacity. Small molecule GSK-3β inhibitors and GSK-3β siRNA experiments indicated that GSK-3β was important for VEEV replication. Thirty-eight second generation BIO derivatives were tested and BIOder was found to be the most potent inhibitor, with an IC(50) of ∼0.5 µM and a CC(50) of >100 µM. BIOder was a more potent inhibitor of GSK-3β than BIO, as demonstrated through in vitro kinase assays from uninfected and infected cells. Size exclusion chromatography experiments demonstrated that GSK-3β is found in three distinct complexes in VEEV infected cells, whereas GSK-3β is only present in one complex in uninfected cells. Cells treated with BIOder demonstrated an increase in the anti-apoptotic gene, survivin, and a decrease in the pro-apoptotic gene, BID, suggesting that modulation of pro- and anti-apoptotic genes contributes to the protective effect of BIOder treatment. Finally, BIOder partially protected mice from VEEV induced mortality. Our studies demonstrate the utility of GSK-3β inhibitors for modulating VEEV infection.
... Quick and accurate identification of disease progression are key factors in testing novel vaccines and antivirals. Preclinical efficacy and viral pathogenesis studies utilize a large number of animals123. These studies involve distinct endpoints, primarily mortality or largely decreased body weight to identify severe illness that is often lethal [3]. ...
... The large numbers are needed to statistically confirm viral replication sites, time points of organ infection, and overall timeline for disease progression. During many studies for viral pathogens the animals develop illnesses in which anorexia and hyperthermia or hypothermia followed by paralysis are a few of the morbidity indicators [1]. These viral studies also pose increased risk to researchers due to increasing disease development in the animals. ...
... In addition to identification of viral replication we were able to accurately identify the movement of viral replication from the nasal region to the fore region of the CNS through 3-Dimensional IVIS. To demonstrate the usefulness of this technology in preclinical research, we tested the efficacy of Ampligen, a TLR-3 agonist [1], in preventing CNS invasion. ...
Rapid and accurate identification of disease progression are key factors in testing novel vaccines and antivirals against encephalitic alphaviruses. Typical efficacy studies utilize a large number of animals and severe morbidity or mortality as an endpoint. New technologies provide a means to reduce and refine the animal use as proposed in Hume's 3Rs (replacement, reduction, refinement) described by Russel and Burch. In vivo imaging systems (IVIS) and bioluminescent enzyme technologies accomplish the reduction of animal requirements while shortening the experimental time and improving the accuracy in localizing active virus replication. In the case of murine models of viral encephalitis in which central nervous system (CNS) viral invasion occurs rapidly but the disease development is relatively slow, we visualized the initial brain infection and enhance the data collection process required for efficacy studies on antivirals or vaccines that are aimed at preventing brain infection. Accordingly, we infected mice through intranasal inoculation with the genetically modified pathogen, Venezuelan equine encephalitis, which expresses a luciferase gene. In this study, we were able to identify the invasion of the CNS at least 3 days before any clinical signs of disease, allowing for reduction of animal morbidity providing a humane means of disease and vaccine research while obtaining scientific data accurately and more rapidly. Based on our data from the imaging model, we confirmed the usefulness of this technology in preclinical research by demonstrating the efficacy of Ampligen, a TLR-3 agonist, in preventing CNS invasion.
... In less than 1% of cases, VEE progresses to neurologi cal disease with edema, meningitis, and congestion from mononuclear inflammatory infiltrates (3)(4)(5). The most common clinical signs of infection with VEEV TC-83 in the mouse strain, C3H/HeN, include weight loss, hunching, alertness/lethargy, and mice eventually reach a moribund state requiring humane euthanasia at 7 dpi or greater depending on dose of infection (33,36). One of the main clinical signs was that the mice were unresponsive to stimulation. ...
... This may reflect continued replication in motor cortex, striatum, and sensory cortex in contrast to other areas with fewer viable neurons and increased cell death. The distribution of the viral antigen matches well with published data on the distribution of viral antigen in this mouse model, in which the time points for the appearance of virus in the piriform cortex, caudate putamen, thalamus, and hippocampus were the same (33,36). The most notable finding from these studies was the expansion of Ns mutations throughout the brain. ...
Venezuelan equine encephalitis virus (VEEV) causes a febrile illness that can progress to neurological disease with the possibility of death in human cases. The evaluation and optimization of therapeutics that target brain infections demands knowledge of the host’s response to VEEV, the dynamics of infection, and the potential for within-host evolution of the virus. We hypothesized that selective pressures during infection of the brain may differ temporally and spatially and so we investigated the dynamics of the host response, viral transcript levels, and genetic variation of VEEV TC-83 in eight areas of the brain in mice over 7 days post-infection (dpi). Viral replication increased throughout the brain until 5–6 dpi and decreased thereafter with neurons as the main site of viral replication. Low levels of genetic diversity were noted on 1 dpi and were followed by an expansion in the genetic diversity of VEEV and nonsynonymous (Ns) mutations that peaked by 5 dpi. The pro-inflammatory response and the influx of immune cells mirrored the levels of virus and correlated with substantial damage to neurons by 5 dpi and increased activation of microglial cells and astrocytes. The prevalence and dynamics of Ns mutations suggest that the VEEV is under selection within the brain and that progressive neuroinflammation may play a role in acting as a selective pressure.
IMPORTANCE
Treatment of encephalitis in humans caused by Venezuelan equine encephalitis virus (VEEV) from natural or aerosol exposure is not available, and hence, there is a great interest to address this gap. In contrast to natural infections, therapeutic treatment of infections from aerosol exposure will require fast-acting drugs that rapidly penetrate the blood-brain barrier, engage sites of infection in the brain and mitigate the emergence of drug resistance. Therefore, it is important to understand not only VEEV pathogenesis, but the trafficking of the viral population within the brain, the potential for within-host evolution of the virus, and how VEEV might evolve resistance.
... In addition, MMP-9 is upregulated in a number of neurologic diseases [12,14,17,[19][20][21][22]24], which can be mediated by TLR4 [16,25]. Moreover, C3H/HeN (TLR4 WT ) mice are susceptible to intranasal exposure of VEEV TC-83 and develop encephalitic disease [11,29,30], unlike other inbred mouse strains. Conveniently, the C3H/HeJ substrain (TLR4 mut ) of C3H mice, which was characterized as LPS hyporesponsive, has a single point mutation in the Tlr4 gene that results in a defective TLR4 protein [31]. ...
... This model was used because VEEV TC-83 infection in TLR4 WT mice results in increased BBB permeability [36] as does wild-type VEEV infection in mice [12]. In addition, the brain pathology in this model is similar to the brain pathology seen in mice infected with other VEEV strains, including meningoencephalitis, gliosis and multifocal neuropil vacuolation [29,[37][38][39]. However, VEEV TC-83 infection is limited to the brain with minimal spread outside the CNS after aerosol or intranasal exposure, thus limiting the effects of systemic inflammation on the BBB, in contrast to VEEV TrD infection. ...
Venezuelan equine encephalitis virus (VEEV) is an encephalitic alphavirus that can cause debilitating, acute febrile illness and potentially result in encephalitis. Currently, there are no FDA-licensed vaccines or specific therapeutics for VEEV. Previous studies have demonstrated that VEEV infection results in increased blood-brain barrier (BBB) permeability that is mediated by matrix metalloproteinases (MMPs). Furthermore, after subarachnoid hemorrhage in mice, MMP-9 is upregulated in the brain and mediates BBB permeability in a toll-like receptor 4 (TLR4)-dependent manner. Here, we demonstrate that disease in C3H mice during VEEV TC-83 infection is dependent on TLR4 because intranasal infection of C3H/HeN (TLR4 WT ) mice with VEEV TC-83 resulted in mortality as opposed to survival of TLR4-defective C3H/HeJ (TLR4 mut ) mice. In addition, BBB permeability was induced to a lesser extent in TLR4 mut mice compared with TLR4 WT mice during VEEV TC-83 infection as determined by sodium fluorescein and fluorescently-conjugated dextran extravasation. Moreover, MMP-9, MMP-2, ICAM-1, CCL2 and IFN-γ were all induced to significantly lower levels in the brains of infected TLR4 mut mice compared with infected TLR4 WT mice despite the absence of significantly different viral titers or immune cell populations in the brains of infected TLR4 WT and TLR4 mut mice. These data demonstrate the critical role of TLR4 in mediating BBB permeability and disease in C3H mice during VEEV TC-83 infection, which suggests that TLR4 is a potential target for the development of therapeutics for VEEV.
... C3H/HeN mice are a cross of Dilute Brown Non-Agouti (DBA) and Bagg albino mice, and are homozygous for the retinal degeneration 1 (Pde6b rd1 ) gene mutation, which causes spontaneous retinal degeneration in these mice. Infection of C3H/HeN mice with TC-83 via aerosol and intranasal routes is lethal and the cytokine profile in the brain tissue suggests NK-cell activity [29,30]. Depletion of NK-cells in these mice improved the survivability after intranasal TC-83 infection, suggesting a pathogenicity-enhancing role of NK-cells in the CNS. ...
... However, the protective effect of IFN is observed only with the endogenous production of IFN as mice treated with exogenous IFN do not show increased protection or survival, except in C3H/HeN mice. In C3H/HeN mice treatment with IFN-α induces a dose-dependent protection against intranasal infection with TC-83, and this could be because of the low pathogenic potential of TC-83 compared to the virulent wild-type VEEV [29,42,43]. Although endogenous IFN is produced in response to VEEV infection, VEEV inhibits IFN signaling by inhibiting signal transducer and activator of transcription 1 (STAT1) and Janus kinase (Jak)1/2 phosphorylation, and nuclear localization of STAT1 [44]. ...
Dedication
This review is dedicated in the memory of Dr Radha K. Maheshwari, a great mentor and colleague, whose passion for research and student training has left a lasting effect on this manuscript and many other works.
Abstract
Venezuelan equine encephalitis virus (VEEV) is an alphavirus in the family Togaviridae. VEEV is highly infectious in aerosol form and a known bio-warfare agent that can cause severe encephalitis in humans. Periodic outbreaks of VEEV occur predominantly in Central and South America. Increased interest in VEEV has resulted in a more thorough understanding of the pathogenesis of this disease. Inflammation plays a paradoxical role of antiviral response as well as development of lethal encephalitis through an interplay between the host and viral factors that dictate virus replication. VEEV has efficient replication machinery that adapts to overcome deleterious mutations in the viral genome or improve interactions with host factors. In the last few decades there has been ongoing development of various VEEV vaccine candidates addressing the shortcomings of the current investigational new drugs or approved vaccines. We review the current understanding of the molecular basis of VEEV pathogenesis and discuss various types of vaccine candidates.
... The pre-cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher AB4101C) manufacturer's instructions: 1 cycle at 50°C for 20 min, 1 cycle at 95°C for 15 min, 40 cycles at 95°C for 15 s and at 51°C for 1 min using StepOnePlus™ Real Time PCR system. Primers and probes for VEEV TC-83 targeted nucleotides 7931-8005, which encode the capsid, as originally described by Julander et al. (2008): forward primer (TCTGA CAAGACGTTCCCAATCA) and reverse primer (GAATAACTTCCCTCCG ACCACA) (Julander et al., 2008). However, the probe utilized different tags (5ʹ6-FAM/TGTTGGAAG/ZEN/GGAAGATAAACGGCTACGC/ 3ʹIABkFQ) to improve sensitivity. ...
... The pre-cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher AB4101C) manufacturer's instructions: 1 cycle at 50°C for 20 min, 1 cycle at 95°C for 15 min, 40 cycles at 95°C for 15 s and at 51°C for 1 min using StepOnePlus™ Real Time PCR system. Primers and probes for VEEV TC-83 targeted nucleotides 7931-8005, which encode the capsid, as originally described by Julander et al. (2008): forward primer (TCTGA CAAGACGTTCCCAATCA) and reverse primer (GAATAACTTCCCTCCG ACCACA) (Julander et al., 2008). However, the probe utilized different tags (5ʹ6-FAM/TGTTGGAAG/ZEN/GGAAGATAAACGGCTACGC/ 3ʹIABkFQ) to improve sensitivity. ...
Venezuelan equine encephalitis virus (VEEV), a new world alphavirus belonging to the Togaviridae family, causes periodic disease outbreaks in humans and equines with high associated mortality and morbidity. VEEV is highly infectious via the aerosol route and so has been developed as a biological weapon (Hawley and Eitzen, 2001). Despite its current classification as a category B select agent, there are no FDA approved vaccines or therapeutics to counter VEEV infections. Here we utilize a naturally occurring host defense peptide, LL-37, as a therapeutic strategy to inhibit VEEV multiplication in infected cells. LL-37 has previously demonstrated activity against several viruses by directly interacting with viral particles and indirectly by establishing an antiviral state in the host cell. We show that LL-37 exhibited potent antiviral activity against VEEV by inhibiting viral replication. Genomic RNA copies of the TC-83 strain of VEEV and viral titers were significantly reduced compared to non-treated controls. LL-37 also inhibited the virulent Trinidad Donkey (TrD) strain of VEEV. Entry assays revealed a robust reduction of viral RNA copies at the early stages of TC-83 infection. Pre-incubation of cells with LL-37 and TC-83 resulted in a strong inhibitory response, indicating that LL-37 impacts early stages of the infectious process. Confocal and electron microscopy images confirmed the aggregation of viral particles, which potentially accounts for entry prevention and hence reduced viral infection. LL-37 treatment also modulated type I interferon (IFN) expression in infected cells. LL-37 treatment dramatically increased IFNβ1 expression in treated cells in a time-dependent manner. Our results establish LL-37 as a relevant and novel potential therapeutic strategy for the treatment of VEEV infections.
... No FDA approved therapeutics are available for VEEV 3,4 , though several studies have highlighted the ability of small molecules to inhibit VEEV both in vitro and in vivo [6][7][8][9][10][11] . Several small molecule inhibitors of VEEV have shown moderate success, though drug toxicity has remained an issue 7,10 . ...
... An established C3H/HeN murine model of VEEV infection was used to assess the ability of ML336-loaded LC-MSNs to inhibit viral infection 8 . In the first study, animals were divided into four groups of ten mice each: ML336-loaded LC-MSNs, unloaded LC-MSNs, free drug, and PBS groups. ...
Venezuelan equine encephalitis virus (VEEV) poses a major public health risk due to its amenability for use as a bioterrorism agent and its severe health consequences in humans. ML336 is a recently developed chemical inhibitor of VEEV, shown to effectively reduce VEEV infection in vitro and in vivo. However, its limited solubility and stability could hinder its clinical translation. To overcome these limitations, lipid-coated mesoporous silica nanoparticles (LC-MSNs) were employed. The large surface area of the MSN core promotes hydrophobic drug loading while the liposome coating retains the drug and enables enhanced circulation time and biocompatibility, providing an ideal ML336 delivery platform. LC-MSNs loaded 20 ± 3.4 μg ML336/mg LC-MSN and released 6.6 ± 1.3 μg/mg ML336 over 24 hours. ML336-loaded LC-MSNs significantly inhibited VEEV in vitro in a dose-dependent manner as compared to unloaded LC-MSNs controls. Moreover, cell-based studies suggested that additional release of ML336 occurs after endocytosis. In vivo safety studies were conducted in mice, and LC-MSNs were not toxic when dosed at 0.11 g LC-MSNs/kg/day for four days. ML336-loaded LC-MSNs showed significant reduction of brain viral titer in VEEV infected mice compared to PBS controls. Overall, these results highlight the utility of LC-MSNs as drug delivery vehicles to treat VEEV.
... In order to assess the ability of ACF to mitigate VEEV infection in vivo, C3H/HeN mice were infected intranasally with a 90% lethal dose (2 Â 10 7 pfu) of VEEV TC-83 (Julander et al., 2008). Groups of 10 mice were treated by oral gavage daily with PBS or with ACF at 10 mg/kg, and were monitored for survival for 16 days. ...
... Fully-virulent TrD lacks this mutation and therefore is better able to evade the host immune response (Hyde et al., 2014). While TC-83 is lethal in a C3H/HeN mouse model (Julander et al., 2008), the attenuated virus has minimal effects in the caudal regions of the brain, and a reported time to death of 12 days from infection (Steele et al., 1998). In contrast, TrD readily invades the caudal region and produces a mean time to death of approximately 7 days in both C3H/HeN and BALB/c mice (Steele et al., 1998). ...
... To screen for antiviral activity in vivo, we used the C3H/HeN mouse, which is susceptible to infection by the VEEV TC-83 strain and causes a lethal disease [16]. Based on the MTD and ADME data, we chose to evaluate for antiviral efficacy of CID15997213 at 2, 10, 50 or 200 mg/kg/day with 10 mice per group. ...
... We used the lethal VEEV TC-83-mouse model, which has been used widely for screening and efficacy studies of antivirals and vaccine candidates, to test the efficacy of CID15997213 [10,16]. Forty percent of the challenged mice survived when treated with 10 mg/kg of CID15997213, and all mice survived when treated with 50 or 200 mg/kg/day. ...
Alphaviruses present serious health threats as emerging and re-emerging viruses. Venezuelan equine encephalitis virus (VEEV), a New World alphavirus, can cause encephalitis in humans and horses, but there are no therapeutics for treatment. To date, compounds reported as anti-VEEV or anti-alphavirus inhibitors have shown moderate activity. To discover new classes of anti-VEEV inhibitors with novel viral targets, we used a high-throughput screen based on the measurement of cell protection from live VEEV TC-83-induced cytopathic effect to screen a 340,000 compound library. Of those, we identified five novel anti-VEEV compounds and chose a quinazolinone compound, CID15997213 (IC50 = 0.84 µM), for further characterization. The antiviral effect of CID15997213 was alphavirus-specific, inhibiting VEEV and Western equine encephalitis virus, but not Eastern equine encephalitis virus. In vitro assays confirmed inhibition of viral RNA, protein, and progeny synthesis. No antiviral activity was detected against a select group of RNA viruses. We found mutations conferring the resistance to the compound in the N-terminal domain of nsP2 and confirmed the target residues using a reverse genetic approach. Time of addition studies showed that the compound inhibits the middle stage of replication when viral genome replication is most active. In mice, the compound showed complete protection from lethal VEEV disease at 50 mg/kg/day. Collectively, these results reveal a potent anti-VEEV compound that uniquely targets the viral nsP2 N-terminal domain. While the function of nsP2 has yet to be characterized, our studies suggest that the protein might play a critical role in viral replication, and further, may represent an innovative opportunity to develop therapeutic interventions for alphavirus infection.
... The cytokine profiles for NHA and mAST cell lines were examined at 0-45 h following infection with TC83, which has been shown to retain virulence in the murine model and in other susceptible animals (Fine et al., 2008;Julander et al., 2008;Paessler et al., 2003;Steele et al., 1998). ...
... It appears that the VEEV vaccine strain TC83 is similar to the wild-type VEEV in efficiently infecting human and murine astrocytes while inducing a host response comparable to the wild-type virus. This correlates with the fact that TC83 is virulent for mice if introduced directly into the brain as previously reported by others (Fine et al., 2008;Julander et al., 2008;Paessler et al., 2003;Steele et al., 1998) and our group (Paessler et al., 2003). Future studies are needed to identify how the virulent VEEV suppresses (or avoids inducing) the proinflammatory response in astrocytes. ...
Venezuelan equine encephalitis virus (VEEV) is an important, naturally emerging zoonotic pathogen. Recent outbreaks in Venezuela and Colombia in 1995 indicate that VEEV still poses a serious public health threat. Astrocytes may be target cells in human and mouse infection and they play an important role in repair through gliosis. In this study, we report that virulent VEEV efficiently infects cultured normal human astrocytes, three different murine astrocyte cell lines and astrocytes in the mouse brain. The attenuation of virus replication positively correlates with the increased levels of production of IL-8, IL-17, IFN-gamma and IP-10. In addition, VEEV infection induces release of basic fibroblast growth factor and production of potent chemokines such as RANTES and MIP-1-beta from cultured human astrocytes. This growth factor and cytokine profile modeled by astrocytes in vitro may contribute to both neuroprotection and repair and may play a role in leukocyte recruitment in vivo.
... Similar symptoms have been found in preclinical rodent models. For example, in the C3H/HeN mouse strain, primary clinical indicators of VEEV TC-83 infection typically encompass weight loss, hunching, and fluctuations in alertness/lethargy, culminating in mice eventually progressing to a moribund state (Julander et al., 2008). It infects neurons and glial cells in the CNS, promoting neurodegeneration and potentially leading to permanent neurological sequelae during its lymphotropic and neurotropic phases (Bocan et al., 2019;Gleiser et al., 1962;Schoneboom et al., 2000). ...
Alzheimer's disease is classified as a progressive disorder resulting from protein misfolding, also known as proteinopathies. Proteinopathies include synucleinopathies triggered by misfolded amyloid α-synuclein, tauopathies triggered by misfolded tau, and amyloidopathies triggered by misfolded amyloid of which Alzheimer's disease (β-amyloid) is most prevalent. Most neurodegenerative diseases (>90%) are not due to dominantly inherited genetic causes. Instead, it is thought that the risk for disease is a complicated interaction between inherited and environmental risk factors that, with age, drive pathology that ultimately results in neurodegeneration and disease onset. Since it is increasingly appreciated that encephalitic viral infections can have profoundly detrimental neurological consequences long after the acute infection has resolved, we tested the hypothesis that viral encephalitis exacerbates the pathological profile of protein-misfolding diseases. Using a robust, reproducible, and well-characterized mouse model for β-amyloidosis, Tg2576, we studied the contribution of alphavirus-induced encephalitis (TC-83 strain of VEEV to model alphavirus encephalitis viruses) on the progression of neurodegenerative pathology. We longitudinally evaluated neurological, neurobehavioral, and cognitive levels, followed by a post-mortem analysis of brain pathology focusing on neuroinflammation. We found more severe cognitive deficits and brain pathology in Tg2576 mice inoculated with TC-83 than in their mock controls. These data set the groundwork to investigate sporadic Alzheimer's disease and treatment interventions for this infectious disease risk factor.
... Viremia following TC-83 vaccination may have resulted in unintentional vaccine transmission among mosquito populations in the past, so this gives more support to the use of the V3526 vaccine over the TC-83 vaccine in the future [47]. Low viral titers were previously reported in the liver of C3H/HeN mice, so the undetectable liver viral load in our study was an expected result [48]. Undetectable viral loads in the brain indicates that the incorporated RdRp mutations do not result in neuroinvasion after subcutaneous injection. ...
Background
Venezuelan equine encephalitis virus (VEEV) is an arbovirus endemic to the Americas, for which no vaccines or antiviral agents have been approved. TC-83 and V3526 are the best-characterized vaccine candidates for VEEV. Both are live-attenuated vaccines and have been associated with safety concerns, although fewer concerns exist for V3526. A previous attempt to improve the TC-83 vaccine focused on further attenuating the vaccine by adding mutations that alter the error-incorporation rate of the RNA-dependent RNA polymerase (RdRp).
Methods
The research herein examined the effects of these RdRp mutations in V3526 by cloning the 3X and 4X strains, assessing vaccine efficacy against challenge in adult female CD-1 mice, examining neutralizing-antibody titers, investigating vaccine tissue tropism, and testing the stability of the mutant strains.
Results
The V3526 RdRp mutants exhibited less tissue tropism in the spleen and kidney than the wild-type V3526, while maintaining vaccine efficacy. Illumina sequencing indicated that the RdRp mutations reverted to wild-type V3526 after five passages in murine pup brains.
Conclusions
The observed genotypic reversion is likely to be of limited concern, because wild-type V3526 remains an effective vaccine capable of providing protection. Our results indicate that the V3526 RdRp mutants may be a safer vaccine design than the original V3526.
... Additionally, Fujimaki et al. (2007) used female C3H/HeN mice, which is a commonly used strain for modeling immune system function and infectious disease (Julander et al., 2008). The use of a single 30-min toluene exposure, use of an outbred strain of mice, and a different sex (i.e., male) in the present study may have contributed to the differences observed between the two studies. ...
Toluene is an aromatic hydrocarbon commonly abused by young adolescents for its central nervous system depressant effects. While toluene's pharmacological effects at high concentrations are relatively well known, few studies have assessed toluene's effects on lung and brain tissues. The present study characterized the pathological effects of acute inhaled toluene exposure in the lungs and brains of male Swiss-Webster mice (N = 68). Using a static vapor exposure chamber, mice (PND 28) received a single 30-min toluene administration (0, 1000, 2000, or 4000 ppm). Lung and brain tissues were extracted 24 hrs post-exposure. Histology results revealed significant changes in the morphology lung tissue (e.g., irregular cellular architecture) with the 2000 and 4000 ppm exposures expressing greater signs of pathology than control 0-ppm exposure. Markers of immune system activity (F4/80 and Ly-6G) and cellular proliferation (Ki-67) in the lung revealed no significant differences. Additionally, brain tissues were analyzed for changes of astrogliosis (GFAP) and oxidative stress (GPx). GFAP showed increased astrogliosis in the striatum with 2000 ppm toluene showing significantly higher expression than control (p < 0.05), and a marginal effect in the hippocampus. No other markers showed significant changes. The increased signs of inflammation and cellular damage suggest that exposure to a single high concentration of toluene, typical of abuse, are capable of producing pathology in both lung and brain tissue.
... Intracellular total RNA along with viral RNA was isolated at 16 h.p.i using the RNeasy Mini Kit (Qiagen ® , Hilden, Germany, Cat# 74106) according to the manufacturer's instruction. RT-qPCR procedures were described previously [12] and performed using the UltraSense™ One-Step Quantitative RT-PCR System (Thermo Fisher Scientific, Waltham, MA, USA; Cat# 11732927), primer pair (forward TCTGACAAGACGTTCCCAATCA, reverse GAATAACTTCCCTCCGACCACA), and TaqMan probe (5 6-carboxyfluorescein-TGTTGGAAGGGAAGATAAACGGCTACGC-6-carboxy-N,N,N ,N -tetramethylrhodamine-3 ) on an Applied Biosystem StepOne Plus PCR system [30]. The absolute genomic copy number was calculated based on a standard curve established by known concentrations of VEEV-TC-83 RNA. ...
The host proteins Protein Kinase B (AKT) and glycogen synthase kinase-3 (GSK-3) are associated with multiple neurodegenerative disorders. They are also important for the replication of Venezuelan equine encephalitis virus (VEEV), thereby making the AKT/GSK-3 pathway an attractive target for developing anti-VEEV therapeutics. Resveratrol, a natural phytochemical, has been shown to substantially inhibit the AKT pathway. Therefore, we attempted to explore whether it exerts any antiviral activity against VEEV. In this study, we utilized green fluorescent protein (GFP)- and luciferase-encoding recombinant VEEV to determine the cytotoxicity and antiviral efficacy via luciferase reporter assays, flow cytometry, and immunofluorescent assays. Our results indicate that resveratrol treatment is capable of inhibiting VEEV replication, resulting in increased viability of Vero and U87MG cells as well as reduced virion production and viral RNA contents within host cells for at least 48 h with a single treatment. Furthermore, the suppression of apoptotic signaling adaptors, caspase-3, caspase-7, and annexin V may also be implicated in resveratrol-mediated antiviral activity. We found that decreased phosphorylation of the AKT/GSK-3 pathway, mediated by resveratrol, can be triggered during the early stages of VEEV infection, suggesting that resveratrol disrupts the viral replication cycle and consequently promotes cell survival. Finally, molecular docking and dynamics simulation studies revealed that resveratrol can directly bind to VEEV glycoproteins, which may interfere with virus attachment and entry. In conclusion, our results suggest that resveratrol exerts inhibitory activity against VEEV infection and upon further modification could be a useful compound to study in neuroprotective research and veterinary sciences.
... Primer/probe sets contained a double-quenched ZEN/IBFQ probe with a 6-FAM fluorescent dye attachment at the 5 end. Capsid primer/probe set, initially described by Julander et al. [38] was used and is represented in Table 1. Quantitative data for nsP3 is represented for each non-structural RT-PCR figure and the primer/probe set is represented in Table 1. ...
Venezuelan equine encephalitis virus (VEEV), a mosquito transmitted alphavirus of the Togaviridae family, can cause a highly inflammatory and encephalitic disease upon infection. Although a category B select agent, no FDA-approved vaccines or therapeutics against VEEV currently exist. We previously demonstrated NF-κB activation and macromolecular reorganization of the IKK complex upon VEEV infection in vitro, with IKKβ inhibition reducing viral replication. Mass spectrometry and confocal microscopy revealed an interaction between IKKβ and VEEV non-structural protein 3 (nsP3). Here, using western blotting, a cell-free kinase activity assay, and mass spectrometry, we demonstrate that IKKβ kinase activity can directly phosphorylate VEEV nsP3 at sites 204/5, 142, and 134/5. Alanine substitution mutations at sites 204/5, 142, or 134/5 reduced VEEV replication by >30-100,000-fold corresponding to a severe decrease in negative-strand synthesis. Serial passaging rescued viral replication and negative-strand synthesis, and sequencing of revertant viruses revealed reversion to the wild-type TC-83 phosphorylation capable amino acid sequences at nsP3 sites 204/5, 142, and 135. Generation of phosphomimetic mutants using aspartic acid substitutions at site 204/5 resulted in rescue of both viral replication and negative-strand RNA production, whereas phosphomimetic mutant 134/5 rescued viral replication but failed to restore negative-strand RNA levels, and phosphomimetic mutant 142 did not rescue VEEV replication. Together, these data demonstrate that IKKβ can phosphorylate VEEV nsP3 at sites 204/5, 142, and 134/5, and suggest that phosphorylation is essential for negative-strand RNA synthesis at site 204/5, but may be important for infectious particle production at site 134/5.
... The transmission of VEEV is primarily mediated by mosquitoes, where it replicates in salivary glands and is passed to hosts, such as human and horses with overt symptoms (5,6). Moreover, aerosolized VEEV can be directly disseminated and can infect humans or susceptible experimental animal models, causing encephalitis, and possibly limb paralysis (7)(8)(9). Historically, since the late 1930s the former Soviet Union regarded VEEV as an operational biological weapon to incapacitate the rear services and reinforcement behind the front line, leading to the spread of the disease among infected individuals with flulike symptoms that are difficult to distinguish from epidemic influenza outbreaks. Weaponized VEEV was not expected to kill the soldiers, but cause panic and ultimately maim the military targets (10). ...
Most of the modern techniques used for identification of viral-induced disease are based on identification of viral antigens and/or nucleic acids in patient's blood. Diagnosis in the field or in remote locations can be challenging and alternatively samples are shipped to diagnostic labs for testing. Shipments must occur under controlled temperature conditions to prevent loss of sample integrity. We have tested the ability of magnetic Nanotrap® (NT) particles to improve stability and detection of Venezuelan equine encephalitis virus (VEEV), viral capsid protein, and viral genomic RNA in whole human blood at elevated temperature and prolonged storage conditions. NT particles have previously been shown to capture and enrich multiple pathogens including respiratory syncytial virus, influenza virus, coronavirus, and Rift Valley fever virus. Our study indicates that samples incubated with NT particles had detectable levels of infectious VEEV in blood equal to or greater than samples without NT treatment across all temperatures. Viral RNA detection was increased in the presence of NT particles at later time points (72 h) and higher temperature (40°C) conditions. Likewise, detection of VEEV capsid protein was enhanced in the presence of NT particles up to 72 h at 40°C. Finally, we intranasally infected C3H mice with TC-83, the live attenuated vaccine strain of VEEV, and demonstrated that NT particles could substantially increase the detection of VEEV capsid in infected blood incubated up to 72 h at 40°C. Samples without NT particles had undetectable capsid protein levels. Taken together, our data demonstrate the ability of NT particles to preserve and enable detection of VEEV in human and mouse blood samples over time and at elevated temperatures.
... The pre-cycling conditions were adapted from Verso 1-step RT-qPCR kit (ThermoFisher AB4101C) manufacturer's instructions: 1 cycle at 50 • C for 20 min, 1 cycle at 95 • C for 15 min, 40 cycles at 95 • C for 15 s and at 51 • C for 1 min using a StepOnePlus™ Real Time PCR system (Applied Biosystems 4376600). VEEV TC-83 primers and probes targeted nucleotides 7931-8005 in VEEV capsid: forward primer (5'-TCTGACAAGACGTTCCCAATCA-3') and reverse primer (5'-GAATAACTTCCCTCCGACCACA-3') [22]. The probe utilized different tags (5 6-FAM/TGTTGGAAG/ZEN/GGAAGATAAACGGCTACGC/3 IABkFQ) to improve sensitivity. ...
Venezuelan equine encephalitis virus (VEEV) is a category B select agent pathogen that can be aerosolized. Infections in murine models and humans can advance to an encephalitic phenotype which may result in long-term neurological complications or death. No specific FDA-approved treatments or vaccines are available for the treatment or prevention of VEEV infection. Neurotropic viral infections have two damaging components: neuronal death caused by viral replication, and damage from the subsequent inflammatory response. Reducing the level of inflammation may lessen neurological tissue damage that often arises following VEEV infection. In this study, three commercially available anti-inflammatory drugs, Celecoxib, Rolipram, and Tofacitinib, were evaluated for antiviral activity in an astrocyte and a microglial model of VEEV infection. The inhibitors were tested against the vaccine strain VEEV TC-83, as well as the wild-type VEEV Trinidad donkey strain. Celecoxib, Tofacitinib, and Rolipram significantly decreased viral titers both after pre-treatment and post-treatment of infected cells. VEEV Trinidad Donkey (TrD) titers were reduced 6.45-fold in cells treated with 50 µM of Celecoxib, 2.45-fold when treated with 50 µM of Tofacitinib, and 1.81-fold when treated with 50 µM of Rolipram. Celecoxib was also shown to decrease inflammatory gene expression in the context of TC-83 infection. Overall, Celecoxib demonstrated potency as a countermeasure strategy that slowed VEEV infection and infection-induced inflammation in an in vitro model.
... However, mortality is observed in C3H/HeN mice exposed by intranasal instillation, aerosol, or direct intracranial injection [5,7]. Several studies established the utility of the C3H/HeN mouse model to closely mimic virulent VEEV encephalitis and for the testing of therapeutic candidates [8,9]. VEEV TC-83 in the C3H/HeN mouse model was shown to induce encephalitis, cause 100% mortality by day 12, and infect the olfactory epithelium following aerosol administration. ...
Traditional pathogenesis studies of alphaviruses involves monitoring survival, viremia, and pathogen dissemination via serial necropsies; however, molecular imaging shifts this paradigm and provides a dynamic assessment of pathogen infection. Positron emission tomography (PET) with PET tracers targeted to study neuroinflammation (N,N-diethyl-2-[4-phenyl]-5,7-dimethylpyrazolo[1,5-a]pyrimidine-3-acetamide, [18F]DPA-714), apoptosis (caspase-3 substrate, [18F]CP-18), hypoxia (fluormisonidazole, [18F]FMISO), blood–brain barrier (BBB) integrity ([18F]albumin), and metabolism (fluorodeoxyglucose, [18F]FDG) was performed on C3H/HeN mice infected intranasally with 7000 plaque-forming units (PFU) of Venezuelan equine encephalitis virus (VEEV) TC-83. The main findings are as follows: (1) whole-brain [18F]DPA-714 and [18F]CP-18 uptake increased three-fold demonstrating, neuroinflammation and apoptosis, respectively; (2) [18F]albumin uptake increased by 25% across the brain demonstrating an altered BBB; (3) [18F]FMISO uptake increased by 50% across the whole brain indicating hypoxic regions; (4) whole-brain [18F]FDG uptake was unaffected; (5) [18F]DPA-714 uptake in (a) cortex, thalamus, striatum, hypothalamus, and hippocampus increased through day seven and decreased by day 10 post exposure, (b) olfactory bulb increased at day three, peaked day seven, and decreased day 10, and (c) brain stem and cerebellum increased through day 10. In conclusion, intranasal exposure of C3H/HeN mice to VEEV TC-83 results in both time-dependent and regional increases in brain inflammation, apoptosis, and hypoxia, as well as modest decreases in BBB integrity; however, it has no effect on brain glucose metabolism.
... For quantification of VA1 sgRNA, we developed a qRT-PCR assay targeting a region within ORF2 common to both the genomic and subgenomic strands (sg/gRNA qRT-PCR assay) using the following primers and probe: forward primer AJ135 (5=-GTGTTGGACCAAGATCAGATG-3=), reverse primer AJ137 (5=-CAGAACTAGAGGAGTCTGAATCC-3=), and probe AJ136 (5=-56-FAM/TCAAATTCA/ZEN/GCATCGCTACAGATTGACC/3IABkFQ/-3=) (IDT). VEEV RNA was quantified by the use of a previously published qRT-PCR protocol and normalized to the calculated PFU (58). ...
Encephalitis remains a diagnostic conundrum in humans as over 50% of cases are managed without the identification of an etiology. Astroviruses have been detected from the central nervous system of mammals in association with disease, suggesting that this family of RNA viruses could be responsible for cases of some neurological diseases that are currently without an ascribed etiology. However, there are significant barriers to understanding astrovirus infection as the capacity of these viruses to replicate in nervous system cells in vitro has not been determined. We describe primary and immortalized cultured cells of the nervous system that support infection by astroviruses. These results further corroborate the role of astroviruses in causing neurological diseases and will serve as an essential model to interrogate the neuropathogenesis of astrovirus infection.
... The observation of ZIKV in motor neurons in the ventral horn of the spinal cord was similar to disease observed after infection with West Nile virus [14]. Astrocytes were also heavily infected in various regions of the brain and spinal cord after ZIKV infection, which was similar to pathology observed after challenge of mice with Venezuelan equine encephalitis virus, an alphavirus [15]. Interestingly, infected AG129 mice displayed rear limb myofiber degeneration and necrosis with inflammatory cell infiltration in the absence of hind-limb paralysis, suggesting that this virus infects muscle cells [6]. ...
Zika virus (ZIKV) infection can result in serious consequences, including severe congenital manifestations, persistent infection in the testes, and neurologic sequelae. After a pandemic emergence, the virus has spread to much of North and South America and has been introduced to many countries outside of ZIKV-endemic areas as infected travelers return to their home countries. Rodent models have been important in gaining a better understanding of the wide range of disease etiologies associated with ZIKV infection and for the initial phase of developing countermeasures to prevent or treat viral infections. We discuss herein the advantages and disadvantages of small-animal models that have been developed to replicate various aspects of disease associated with ZIKV infection.
... 56,74,75 Intranasal challenge of C3H/HeN mice with high dose VEEV caused high morbidity and mortality. 76 Viral titers in brain peaked on day 4 postchallenge and stayed high until animals died on day 9-10 postchallenge. Protein cytokine array done on brains of infected mice showed elevated interleukin (IL)-1a, IL-1b, IL-6, IL-12, monocyte chemoattractant protein-1 (MCP-1), IFNg, MIP-1a, and regulated and normal T-cell expressed and secreted levels ½AU3 . ...
As the threat of exposure to emerging and reemerging viruses within a naïve population increases, it is vital that the basic mechanisms of pathogenesis and immune response be thoroughly investigated. Recent outbreaks of Middle East respiratory syndrome corona virus, Ebola virus, Chikungunya virus, and Zika virus illustrate the emerging threats that are encountered. By utilizing animal models in this endeavor, the host response to viruses can be studied in a more complex and integrated context to identify novel drug targets, and assess the efficacy and safety of new products rapidly. This is especially true in the advent and implementation of the FDA animal rule. Although no one animal model is able to recapitulate all aspects of human disease, understanding the current limitations allows for a more targeted experimental design. Important facets to consider prior to an animal study are route of viral exposure, species of animal, biomarkers of disease, and a humane endpoint. This chapter covers the current animal models for medically important human viruses, and demonstrates where the gaps in knowledge exist.
... Since TC-83 is only available for use as an investigational vaccine and the population to which it is available is limited, additional studies to evaluate the immunogenicity of the vaccine in humans over time are not available. Of interest to this study is that following intranasal infection with the vaccine strain of VEEV-TC-83, C57BL/6 (WT) mice develop disseminated infection of the brain with high infectious titers without mortality (Hart et al., 1997;Steele et al., 1998;Julander et al., 2008;Taylor et al., 2012). ...
Intranasal infection with vaccine strain of Venezuelan equine encephalitis virus (TC83) caused persistent viral infection in the brains of mice without functional αβ T-cells (αβ-TCR -/-). Remarkably, viral kinetics, host response gene transcripts and symptomatic disease are similar between αβ-TCR -/- and wild-type C57BL/6 (WT) mice during acute phase of infection [0–13 days post-infection (dpi)]. While WT mice clear infectious virus in the brain by 13 dpi, αβ-TCR -/- maintain infectious virus in the brain to 92 dpi. Persistent brain infection in αβ-TCR -/- correlated with inflammatory infiltrates and elevated cytokine protein levels in the brain at later time points. Persistent brain infection of αβ-TCR -/- mice provides a novel model to study prolonged alphaviral infection as well as the effects and biomarkers of long-term viral inflammation in the brain.
... Q-RT-PCR was performed as described previously [35] for viral RNA using the Applied Biosystems StepOne Plus. Primer-pairs (forward TCTGACAAGACGTTCCCAATCA, reverse GAATAACTTCCCTCCGACCACA) and Taq-Man probe (5 0 6-carboxyfluorescein-TGTTGGAAGGGAAGATAAACGGCTACGC-6-carboxy-N,N,N 0 ,N 0 -tetramethylrhodamine-3 0 ) against 7931-8005 of VEEV-TC83 were utilized [36]. The absolute quantification was calculated using StepOne Software v2.3 and based on the threshold cycle relative to the standard curve. ...
The capsid structural protein of the New World alphavirus, Venezuelan equine encephalitis virus (VEEV), interacts with the host nuclear transport proteins importin α/β1 and CRM1. Novel selective inhibitor of nuclear export (SINE) compounds, KPT-185, KPT-335 (verdinexor), and KPT-350, target the host’s primary nuclear export protein, CRM1, in a manner similar to the archetypical inhibitor Leptomycin B. One major limitation of Leptomycin B is its irreversible binding to CRM1; which SINE compounds alleviate because they are slowly reversible. Chemically inhibiting CRM1 with these compounds enhanced capsid localization to the nucleus compared to the inactive compound KPT-301, as indicated by immunofluorescent confocal microscopy. Differences in extracellular versus intracellular viral RNA, as well as decreased capsid in cell free supernatants, indicated the inhibitors affected viral assembly, which led to a decrease in viral titers. The decrease in viral replication was confirmed using a luciferase-tagged virus and through plaque assays. SINE compounds had no effect on VEEV TC83_Cm, which encodes a mutated form of capsid that is unable to enter the nucleus. Serially passaging VEEV in the presence of KPT-185 resulted in mutations within the nuclear localization and nuclear export signals of capsid. Finally, SINE compound treatment also reduced the viral titers of the related eastern and western equine encephalitis viruses, suggesting that CRM1 maintains a common interaction with capsid proteins across the New World alphavirus genus.
... A VEEV diagnosis is presently confirmed mostly by conventional RT-PCR using broad-range primer pairs covering the whole genus Alphavirus followed by subsequent amplicon sequencing [14]. Recent publications experimentally demonstrated RT-qPCR assays for detection of the VEEV vaccine strain TC-83 but without proven experimental demonstration of the assay's sensitivity and efficiency regarding other VEEV subtypes [15,16]. In this study we are introducing a general purpose, rapid, one-step quantitative RT-qPCR assay for the sensitive and specific detection of all VEEV subtypes in combination with an internal calibrator construct which in turn can be used in the quantification of the three equine encephalitis viruses. ...
Venezuelan equine encephalitis virus (VEEV) is an Alphavirus from the family Togaviridae that causes epizootic outbreaks in equids and humans in Central and South America. So far, most studies use conventional reverse transcriptase PCR assays for the detection of the different VEEV subtypes. Here we describe the development of a TaqMan quantitative real-time reverse transcriptase PCR assay for the specific detection and quantitation of all VEEV subtypes which uses in parallel a universal equine encephalitis virus control RNA carrying target sequences of the three equine encephalitis viruses. The control RNA was used to generate standard curves for the calculation of copy numbers of viral genome of Eastern equine encephalitis virus (EEEV), Western equine encephalitis virus (WEEV), and VEEV. The new assay provides a reliable high-throughput method for the detection and quantitation of VEEV RNA in clinical and field samples and allows a rapid differentiation from potentially cocirculating EEEV and WEEV strains. The capability to detect all known VEEV variants was experimentally demonstrated and makes this assay suitable especially for the surveillance of VEEV.
... Quantification of viral RNA was determined by quantitative reverse transcription-PCR (qRT-PCR; TC83) or quantitative PCR (qPCR; TrD) using a StepOnePlus real-time PCR system (Applied Biosystems). Primer pairs (forward primer, 5=-TCTGACAAGACGTTCCCAATCA-3=; reverse primer, 5=-GAATAACTTCCCTCCGACCACA-3=) and TaqMan probe (5=-6-carboxyfluorescein-TGTTGGAAGG GAAGATAAACGGCTACGC-6-carboxy-N,N,N=,N=-tetramethylrhodamine-3=) for nucleotides 7931 to 8005 of VEEV TC83 were originally described previously (55). The reaction mixtures for TC83 were assembled using an RNA UltraSense one-step quantitative RT-PCR system (Invitrogen), and absolute quantification was calculated on the basis of the threshold cycle (C T ) relative to that on the standard curve. ...
Importance:
Venezuelan equine encephalitis virus (VEEV) is as a select agent that has been weaponized. This arthropod-borne (+) RNA virus causes acute and fatal encephalitis in many mammals including humans. There is no vaccine or other approved therapeutic. VEEV and related Alphaviruses utilize programmed -1 ribosomal frameshifting (-1 PRF) to synthesize the viral trans-frame protein (TF), which is important for neuropathogenesis. -1 PRF attenuation strongly inhibited VEEV pathogenesis in mice, and viral replication analyses suggest that TF protein is critical for neurological disease. These findings suggest a new approach toward the development of safe and effective live attenuated vaccines directed against VEEV and other related viruses.
... The infection pattern of ZIKV in the central nervous system was similar to that of the related flavivirus WNV that also infects motor neurons in the ventral horn of spinal cord (Siddharthan et al., 2009) and the brain stem , although ZIKV infected cells generally co-localized with astroglial cells while WNV is more neuronspecific. We have also observed a similar infection of astroglial cells after Venezulan equine encephalitis virus infection in a C3H/ HeN mouse model (Julander et al., 2008). ...
Zika virus (ZIKV) is currently undergoing pandemic emergence. While disease is typically subclinical, severe neurologic manifestations in fetuses and newborns after congenital infection underscore an urgent need for antiviral interventions. The adenosine analog BCX4430 has broad-spectrum activity against a wide range of RNA viruses, including potent in vivo activity against yellow fever, Marburg and Ebola viruses. We tested this compound against African and Asian lineage ZIKV in cytopathic effect inhibition and virus yield reduction assays in various cell lines. To further evaluate the efficacy in a relevant animal model, we developed a mouse model of severe ZIKV infection, which recapitulates various human disease manifestations including peripheral virus replication, conjunctivitis, encephalitis and myelitis. Time-course quantification of viral RNA accumulation demonstrated robust viral replication in several relevant tissues, including high and persistent viral loads observed in the brain and testis. The presence of viral RNA in various tissues was confirmed by an infectious culture assay as well as immunohistochemical staining of tissue sections. Treatment of ZIKV-infected mice with BCX4430 significantly improved outcome even when treatment was initiated during the peak of viremia. The demonstration of potent activity of BCX4430 against ZIKV in a lethal mouse model warrant its continued clinical development.
... q-RT-PCR cycling conditions were as follows: 1 cycle at 50°C for 30 minutes, 1 cycle at 95°C for 2 minutes and 40 cycles at 95°C for 15 seconds and 61°C for 1 minute using the StepOne Plus Real Time PCR system [34]. The primer and probe pairs used were originally described by Julander; forward primer (TCTGACAAGACGTTCCCAATCA) and reverse primer (GAATAACTTCCCTCCGACCACA) and Taqman probe (5' 6-carboxyfluorescein-TGTTGGAAGGGAAGATAAACGGCTACGC-6-carboxy-N,N,N 0 ,N 0 -tetramethylrhodamine-3 0 ) [35]. q-RT-PCR assays were performed using BioRad iTaq Universal Probes one-step 2x mix (BioRad, 172-5140). ...
Many viruses have been implicated in utilizing or modulating the Ubiquitin Proteasome System (UPS) to enhance viral multiplication and/or to sustain a persistent infection. The mosquito-borne Venezuelan equine encephalitis virus (VEEV) belongs to the Togaviridae family and is an important biodefense pathogen and select agent. There are currently no approved vaccines or therapies for VEEV infections; therefore, it is imperative to identify novel targets for therapeutic development. We hypothesized that a functional UPS is required for efficient VEEV multiplication. We have shown that at non-toxic concentrations Bortezomib, a FDA-approved inhibitor of the proteasome, proved to be a potent inhibitor of VEEV multiplication in the human astrocytoma cell line U87MG. Bortezomib inhibited the virulent Trinidad donkey (TrD) strain and the attenuated TC-83 strain of VEEV. Additional studies with virulent strains of Eastern equine encephalitis virus (EEEV) and Western equine encephalitis virus (WEEV) demonstrated that Bortezomib is a broad spectrum inhibitor of the New World alphaviruses. Time-of-addition assays showed that Bortezomib was an effective inhibitor of viral multiplication even when the drug was introduced many hours post exposure to the virus. Mass spectrometry analyses indicated that the VEEV capsid protein is ubiquitinated in infected cells, which was validated by confocal microscopy and immunoprecipitation assays. Subsequent studies revealed that capsid is ubiquitinated on K48 during early stages of infection which was affected by Bortezomib treatment. This study will aid future investigations in identifying host proteins as potential broad spectrum therapeutic targets for treating alphavirus infections.
... Vaccine strains are often developed by serial passage of the virus multiple times in cell culture to attenuate the virus, and attenuated virus can be used at a lower biosafety level once the sufficient safety testing has been performed. One example is the TC-83 vaccine strain of Venezuelan equine encephalitis virus (VEEV) that has been commonly used under BSL-2 conditions [56,57]. However, it is often unclear how the attenuation of the agent may affect the results obtained in screening assays. ...
Currently, there are no Food and Drug Administration (FDA)-approved antiviral drugs or therapeutics for many of the biosafety level three (BSL-3) and four (BSL-4) pathogens. Many of these high-consequence pathogens, including Venezuelan equine encephalitis virus (VEEV), Ebola virus (EBOV), Marburg virus (MARV), and Lassa virus (LASV), are classified as biothreat agents and the development of therapeutic treatments for these diseases is an important area of research. In recent years, high-throughput screening (HTS) assays have become an effective and robust tool used for drug and therapeutic discovery. There are several types of HTS methods available, including targeted screening, diversity and high-content screening, and RNA interference (RNAi). These screens have been used effectively with a number of BSL-2 pathogens, but present unique challenges for the BSL-3/4 pathogens due to the requirement for higher level biocontainment facilities as well as biosurety requirements. Addressing and overcoming these challenges is essential for the proper adaptation of HTS into higher biocontainment facilities. In this article, we will discuss the advantages and disadvantages of each of the aforementioned HTS methods in the context of BSL-3/4 containment.
... The q-RT-PCR cycling conditions were as follows: 1 cycle at 50 1C for 30 min, 1 cycle at 95 1C for 2 min and 40 cycles at 95 1C for 15 s and 61 1C for 1 min using the StepOne Plus Real Time PCR system. The primer and probe pairs used were originally described by Julander; forward primer (TCTGACAAGACGTTCCCAATCA) and reverse primer (GAATAACTT CCCTCCGACCACA) and Taqman probe (5 0 6-carboxyfluorescein-TGTTGGAAGGGAAGATAAACGGCTACGC-6-carboxy-N,N,N 0 ,N 0 -tetramethylrhodamine-3 0 ) (Julander et al., 2008). The q-RT-PCR assays were performed using BioRad iTaq Universal Probes onestep 2 Â mix (BioRad, 172-5140). ...
New World alphaviruses belonging to the family Togaviridae are classified as emerging infectious agents and Category B select agents. Our study is focused on the role of the host extracellular signal-regulated kinase (ERK) in the infectious process of New World alphaviruses. Infection of human cells by Venezuelan equine encephalitis virus (VEEV) results in the activation of the ERK-signaling cascade. Inhibition of ERK1/2 by the small molecule inhibitor Ag-126 results in inhibition of viral multiplication. Ag-126-mediated inhibition of VEEV was due to potential effects on early and late stages of the infectious process. While expression of viral proteins was down-regulated in Ag-126 treated cells, we did not observe any influence of Ag-126 on the nuclear distribution of capsid. Finally, Ag-126 exerted a broad-spectrum inhibitory effect on New World alphavirus multiplication, thus indicating that the host kinase, ERK, is a broad-spectrum candidate for development of novel therapeutics against New World alphaviruses.
... 56,74,75 Intranasal challenge of C3H/HeN mice with high dose VEEV caused high morbidity and mortality. 76 Viral titers in brain peaked on day 4 postchallenge and stayed high until animals died on day 9-10 postchallenge. Protein cytokine array done on brains of infected mice showed elevated interleukin (IL)-1a, IL-1b, IL-6, IL-12, monocyte chemoattractant protein-1 (MCP-1), IFNg, MIP-1a, and regulated and normal T-cell expressed and secreted levels ½AU3 . ...
... These studies did not investigate the mechanism of the Ampligen TM -triggered antiviral effect in SARS-CoV-infected mice; type I IFN, however, was proposed as a mediator of antiviral immunity. Ampligen TM is indeed a potent type I IFN inducer that acts through TLR3 [47] and triggers protection from HIV [48,49], coxsackie virus [50], Punta Toro virus [47], Venezuelan equine encephalitis virus [51], and influenza virus [52] infections. Overall, our data demonstrates that TLR3 triggered type I IFN inhibits murine CoV infection of macrophages. ...
Toll-like Receptors (TLRs) sense viral infections and induce production of type I interferons (IFNs), other cytokines, and chemokines. Viral recognition by TLRs and other pattern recognition receptors (PRRs) has been proven to be cell-type specific. Triggering of TLRs with selected ligands can be beneficial against some viral infections. Macrophages are antigen-presenting cells that express TLRs and have a key role in the innate and adaptive immunity against viruses. Coronaviruses (CoVs) are single-stranded, positive-sense RNA viruses that cause acute and chronic infections and can productively infect macrophages. Investigation of the interplay between CoVs and PRRs is in its infancy. We assessed the effect of triggering TLR2, TLR3, TLR4, and TLR7 with selected ligands on the susceptibility of the J774A.1 macrophage cell line to infection with murine coronavirus (mouse hepatitis virus, [MHV]). Stimulation of TLR2, TLR4, or TLR7 did not affect MHV production. In contrast, pre-stimulation of TLR3 with polyinosinic-polycytidylic acid (poly I:C) hindered MHV infection through induction of IFN-β in macrophages. We demonstrate that activation of TLR3 with the synthetic ligand poly I:C mediates antiviral immunity that diminishes (MHV-A59) or suppresses (MHV-JHM, MHV-3) virus production in macrophages.
... C3H/HeN and BALB/C mice vaccinated dermally with TC-83, the live attenuated vaccine strain, survive. However, aerosol or IN infection with TC83 results in 90-100% mortality in C3H/HeN animals unlike inbred counterparts BALB/C that respond with no evidence of mortality (Julander, et al., 2007; Julander, et al., 2008c; Steele, et al., 2007; Steele, et al., 1998; Steele, et al., 2006). Similar experiences have shown that route of administration can alter neuroinvasion with nonpathogenic viruses failing to enter the CNS by peripheral routes, but exhibiting the ability to enter the CNS by IC, IN, or aerosol administration. ...
... Antiviral agents that inhibit viral replication were evaluated as treatments for VEEV infection using a lethal mouse model (Julander et al., 2008b). (-)Carbodine was shown to be effective in improving disease parameters even when administered up to 4 days post infection (Julander et al., 2008a). ...
The use of biological agents has generally been confined to military-led conflicts. However, there has been an increase in non-state-based terrorism, including the use of asymmetric warfare, such as biological agents in the past few decades. Thus, it is becoming increasingly important to consider strategies for preventing and preparing for attacks by insurgents, such as the development of pre- and post-exposure medical countermeasures. There are a wide range of prophylactics and treatments being investigated to combat the effects of biological agents. These include antibiotics (for both conventional and unconventional use), antibodies, anti-virals, immunomodulators, nucleic acids (analogues, antisense, ribozymes and DNAzymes), bacteriophage therapy and micro-encapsulation. While vaccines are commercially available for the prevention of anthrax, cholera, plague, Q fever and smallpox, there are no licensed vaccines available for use in the case of botulinum toxins, viral encephalitis, melioidosis or ricin. Antibiotics are still recommended as the mainstay treatment following exposure to anthrax, plague, Q fever and melioidosis. Anti-toxin therapy and anti-virals may be used in the case of botulinum toxins or smallpox respectively. However, supportive care is the only, or mainstay, post-exposure treatment for cholera, viral encephalitis and ricin - a recommendation that has not changed in decades. Indeed, with the difficulty that antibiotic resistance poses, the development and further evaluation of techniques and atypical pharmaceuticals are fundamental to the development of prophylaxis and post-exposure treatment options. The aim of this review is to present an update on prophylaxis and post-exposure treatment recommendations and research initiatives for biological agents in the open literature from 2007 to 2009.
... Ampligen™, poly(I:C( 12 )U), is a synthetic dsRNA polymer that stimulates production of interferon (Carter et al., 1972; Gowen et al., 2007). Ampligen™ has been shown to be effective in vivo against multiple viruses, including Coxsackie virus (Padalko et al., 2004), Venezuelan equine encephalitis (VEE) virus (Julander et al., 2008), punta toro virus (Sidwell et al., 1994), Modoc virus (Leyssen et al., 2003), duck hepatitis B virus (Niu et al., 1993), Banzi virus (Pinto, Morahan, and Brinton, 1988), herpes simplex type 2 (HSV-2) virus (Pinto, Morahan, and Brinton, 1988), and Pichinde virus (Smee et al., 1993). In a virus replication model, Ampligen™ at 10 mg/kg was previously found to afford protection against SARS-CoV replication in the lungs (Barnard et al., 2006a). ...
Severe acute respiratory syndrome (SARS) is a highly lethal emerging disease caused by coronavirus SARS-CoV. New lethal animal models for SARS were needed to facilitate antiviral research. We adapted and characterized a new strain of SARS-CoV (strain v2163) that was highly lethal in 5- to 6-week-old BALB/c mice. It had nine mutations affecting 10 amino acid residues. Strain v2163 increased IL-1alpha, IL-6, MIP-1alpha, MCP-1, and RANTES in mice, and high IL-6 expression correlated with mortality. The infection largely mimicked human disease, but lung pathology lacked hyaline membrane formation. In vitro efficacy against v2163 was shown with known inhibitors of SARS-CoV replication. In v2163-infected mice, Ampligen was fully protective, stinging nettle lectin (UDA) was partially protective, ribavirin was disputable and possibly exacerbated disease, and EP128533 was inactive. Ribavirin, UDA, and Ampligen decreased IL-6 expression. Strain v2163 provided a valuable model for anti-SARS research.
Alphaviruses are RNA viruses that represent emerging public health threats. To identify protective antibodies, we immunized macaques with a mixture of western, eastern, and Venezuelan equine encephalitis virus-like particles (VLPs), a regimen that protects against aerosol challenge with all three viruses. Single- and triple-virus-specific antibodies were isolated, and we identified 21 unique binding groups. Cryo-EM structures revealed that broad VLP binding inversely correlated with sequence and conformational variability. One triple-specific antibody, SKT05, bound proximal to the fusion peptide and neutralized all three Env-pseudotyped encephalitic alphaviruses by using different symmetry elements for recognition across VLPs. Neutralization in other assays (e.g., chimeric Sindbis virus) yielded variable results. SKT05 bound backbone atoms of sequence-diverse residues, enabling broad recognition despite sequence variability; accordingly, SKT05 protected mice against Venezuelan equine encephalitis virus, chikungunya virus, and Ross River virus challenges. Thus, a single vaccine-elicited antibody can protect in vivo against a broad range of alphaviruses.
Venezuelan and eastern equine encephalitis viruses (VEEV and EEEV, respectively) are mosquito-borne, neuroinvasive human pathogens for which no FDA-approved therapeutic exists. Besides the biothreat posed by these viruses when aerosolized, arthropod transmission presents serious health risks to humans, as demonstrated by the 2019 outbreak of EEE disease in the United States that resulted in 38 confirmed cases, 19 deaths, and neurological effects in survivors. Here, we describe the discovery of a 2-pyrrolidinoquinazolinone scaffold, efficiently synthesized in two to five steps, whose structural optimization resulted in profound antiviral activity. The lead quinazolinone, BDGR-49, potently reduced cellular VEEV and EEEV titers by >7 log at 1 μM and exhibited suitable intravenous and oral pharmacokinetic profiles in BALB/c mice to achieve excellent brain exposure. Outstanding in vivo efficacy was observed in several lethal, subcutaneous infection mouse models using an 8-day dosing regimen. Prophylactically administered BDGR-49 at 25 mg kg-1 per day fully protected against a 10× LD50 VEEV Trinidad donkey (TrD) challenge in BALB/c mice. Similarly, we observed 70% protection when 10× LD50 EEEV FL93-939-infected C57BL/6 mice were treated prophylactically with BDGR-49 at 50 mg kg-1 per day. Last, we observed 100% therapeutic efficacy when mice, challenged with 10× LD50 VEEV TrD, were dosed at 48 hours after infection with BDGR-49 at 25 mg kg-1 per day. Mouse brain viral titers at 96 hours after infection were reduced to values near the limit of detection. Collectively, these results underscore the substantial development potential of a well-tolerated, brain-penetrant lead compound that shows promise in preventing and treating encephalitic alphavirus disease.
Recent studies highlight that infection with Coxsackievirus B3, Venezuelan equine encephalitis virus (VEEV), Marburg virus, or stimulation using poly I:C (dsRNA), upregulates the signaling adaptor protein MyD88 and impairs the host antiviral type I interferon (IFN) responses. In contrast, MyD88 deficiency (MyD88-/-) increases the type I IFN and survivability of mice implying that MyD88 up regulation limits the type I IFN response. Reasoning that MyD88 inhibition in a virus-like manner may increase type I IFN responses, our studies revealed lipopolysaccharide stimulation of U937 cells or poly I:C stimulation of HEK293-TLR3, THP1 or U87 cells in the presence of a previously reported MyD88 inhibitor (compound 4210) augmented IFN-β and RANTES production. Consistent with these results, overexpression of MyD88 decreased IFN-β, whereas MyD88 inhibition rescued IFN-β production concomitant with increased IRF3 phosphorylation, suggesting IRF-mediated downstream signaling to the IFN-β response. Further, compound 4210 treatment inhibited MyD88 interaction with IRF3/IRF7 indicating that MyD88 restricts type I IFN signaling through sequestration of IRF3/IRF7. In cell based infection assays, compound 4210 treatment suppressed replication of VEEV, Eastern equine encephalitis virus, Ebola virus (EBOV), Rift Valley Fever virus, Lassa virus, and Dengue virus with IC50 values ranging from 11-42μM. Notably, administration of compound 4210 improved survival, weight change, and clinical disease scores in mice following challenge with VEEV TC-83 and EBOV. Collectively, these results provide evidence that viral infections responsive to MyD88 inhibition lead to activation of IRF3/IRF7 and promoted a type I IFN response, thus, raising the prospect of an approach of host-directed antiviral therapy.
Venezuelan equine encephalitis virus (VEEV) causes moderate flu-like symptoms and can lead to severe encephalitic disease and potentially death. There are currently no FDA-approved therapeutics or vaccines for human use, and understanding the molecular underpinning of host-virus interactions can aid in the rational design of intervention strategies. The significance of our research is in identifying the interaction between protein phosphatase 1 (PP1) and the viral capsid protein. This interaction is important for viral replication, as inhibition of PP1 results in decrease viral replication. Inhibition of PP1 also inhibited multiple biomedically important alphaviruses, indicating that PP1 may be a potential therapeutic target for alphavirus-induced disease.
Arthropod-borne viruses (arboviruses) have continued to emerge in recent years, posing a significant health threat to millions of people worldwide. The majority of arboviruses that are pathogenic to humans are transmitted by mosquitoes and ticks, but other types of arthropod vectors can also be involved in the transmission of these viruses. To alleviate the health burdens associated with arbovirus infections, it is necessary to focus today's research on disease control and therapeutic strategies. Animal models for arboviruses are valuable experimental tools that can shed light on the pathophysiology of infection and will enable the evaluation of future treatments and vaccine candidates. Ideally an animal model will closely mimic the disease manifestations observed in humans. In this review, we outline the currently available animal models for several viruses vectored by mosquitoes, ticks, and midges, for which there are no standardly available vaccines or therapeutics. Copyright 2017 by the American Association for Laboratory Animal Science.
Arthropod-borne viruses (arboviruses) have continued to emerge in recent years, posing a significant health threat to millions ofpeople worldwide. The majority of arboviruses that are pathogenic to humans are transmitted by mosquitoes and ticks, but othertypes of arthropod vectors can also be involved in the transmission of these viruses. To alleviate the health burdens associated with arbovirus infections, it is necessary to focus today's research on disease control and therapeutic strategies. Animal models for arboviruses are valuable experimental tools that can shed light on the pathophysiology of infection and will enable the evaluation of future treatments and vaccine candidates. Ideally an animal model will closely mimic the disease manifestations observed in humans. In this review, we outline the currently available animal models for several viruses vectored by mosquitoes, ticks, and midges, for which there are no standardly available vaccines or therapeutics.
As the threat of exposure to emerging and reemerging viruses within a naive population increases, it is vital that the basic mechanisms of pathogenesis and immune response be thoroughly investigated. By using animal models in this endeavor, the response to viruses can be studied in a more natural context to identify novel drug targets, and assess the efficacy and safety of new products. This is especially true in the advent of the Food and Drug Administration's animal rule. Although no one animal model is able to recapitulate all the aspects of human disease, understanding the current limitations allows for a more targeted experimental design. Important facets to be considered before an animal study are the route of challenge, species of animals, biomarkers of disease, and a humane endpoint. This chapter covers the current animal models for medically important human viruses, and demonstrates where the gaps in knowledge exist.
Part of the Togaviridae family, alphaviruses are arthropod-borne viruses that are widely distributed throughout the globe. Alphaviruses are able to infect a variety of vertebrate hosts, but in humans infection can result in extensive morbidity and mortality. Symptomatic infection can manifest as fever, an erythematous rash and/or significant inflammatory pathologies such as arthritis and encephalitis. Recent overwhelming outbreaks of alphaviral disease have highlighted the void in our understanding of alphavirus pathogenesis and the re-emergence of alphaviruses has given new impetus to anti-alphaviral drug design. In this review, the development of viable mouse models of Old Word and New World alphaviruses is examined. How mouse models that best replicate human disease have been used to elucidate the immunopathology of alphavirus pathogenesis and trial novel therapeutic discoveries is also discussed.
During the anthrax outbreak and threat in Trenton (2001), our allergy practice experienced increased visits from approximately 50 of our regular patients with symptoms they believed resulted from anthrax exposure. In all cases, their symptoms were caused by a combination of an exacerbation of their underlying allergic disease and anxiety because of possible exposure to anthrax. Our objective is to present an orderly approach to the allergist's outpatients presenting with possible exposure to a bioterrorist's agent. The 10 precepts of approach to the management of a biological casualty (index of suspicion, protect yourself, patient assessment, decontaminate, diagnose, treat, infection control, alert authorities, assist in investigation, and maintain proficiency) and the epidemiological characteristics of a biological attack are discussed. In table form, we compared the signs and symptoms of the most common outpatient consultations to an allergist's office practice (chronic rhinitis, asthma, food allergy, venom allergy, atopic dermatitis, drug allergy, chronic urticaria, acute urticaria, immunodeficiency, and anaphylaxis) with those of likely bioterrorism threats. Descriptions of smallpox, plague, tularemia, anthrax, viral hemorrhagic fevers, Q fever, brucellosis, Venezuelan equine encephalitis, glanders, and melioidosis are presented. Patients may readily mistake their allergic symptoms with those of infection with a bioterrorist's agent. At the same time, the allergist may be faced with one of his own chronic patients presenting with symptoms resembling their allergic disease but actually caused by one of the aforementioned pathogens.
Bluetongue virus (BTV) is a pathogenic member of the Reoviridae family. BTV does not cause disease in humans, but is capable of selectively infecting and killing certain transformed human cell lines. Understanding BTV's oncotrophism may lead to new therapeutics for treating cancer. This study focused on the underlying mechanisms of BTV-induced cell death in carcinoma cell lines. It was our hypothesis that BTV infects human carcinoma transformed cells, produces mRNA and protein, induces a strong inflammatory response, induces mitogen activated protein kinase (MAPK)-based pro-apoptotic signaling, inhibits PKB-based signaling, and eventually kills the cell by inducing apoptosis.Three carcinoma cell lines (A498, HEP-G2, and A549) were independently infected with BTV. In each cell line we determined: (1) cell viability over the course of infection; (2) BTV induced cytokine expression profile and magnitude of expression; (3) BTV viral RNA expression profile and magnitude of expression; (4) BTV viral protein expression profile and magnitude of expression; (5) changes in BTV induced cell death and cytokine expression in cells with protein kinase B (PKB), p38-MAPK, extracellular receptor kinase (ERK-1/2), stress-activated protein kinase (SAPK-JNK), Src kinase, platelet-derived growth factor receptor (PDGFR) kinase, epidermal growth factor receptor (EDGFR) kinase, or Janus kinase (JAK) activity inhibited; (6) intracellular changes in PKB, p38-MAPK, ERK-1/2, and SAPK-JNK phosphorylation as a result of BTV infection; and (7) BTV-induced changes in tyrosine phosphorylation.We determined that BTV infects and kills all three cell lines in a cell line dependent manner. Relative cell death between cell lines was proportional to cytokine expression, but inversely proportional to viral protein expression. Only tyrosine kinase inhibitors influenced BTV-induced cell death and cytokine expression. Both A498 and A549 cells constitutively expressed phosphorylated PKB and p38 MAPK, of which both were de-phosphorylated during BTV infection. Tyrosine phosphorylation remained active, with elevated tyrosine phosphorylation exclusively in infected cells. We conclude that BTV-induced cell death and cytokine expression are a function of the cell's response to infection and are directly related through intracellular signaling. These pathways are only partially poly I:C inducible, but include PKB and tyrosine kinase signaling.
Venezuelan equine encephalitis virus (VEEV) may cause encephalitis in humans, for which no FDA-approved antiviral treatment is available. Carbocyclic cytosine (carbodine) has broad-spectrum activity but toxicity has limited its utility. It was anticipated that one of the enantiomers of carbodine would show enhanced activity and reduced toxicity. The activity of the d-(-) enantiomer of carbodine [(-)-carbodine] was evaluated by infectious cell culture assay and was found to have a 50% effective concentration (EC50) of 0.2 microg/ml against the TC-83 vaccine strain of VEEV in Vero cells, while the l-(+) enantiomer had no activity. Virus titer inhibition correlated with intracellular cytidine triphosphate reduction after treatment with (-)-carbodine, as determined by HPLC analysis. Pre-treatment with 200 mg/(kgd) resulted in significant improvement in survival, virus load in the brain, weight change, and mean day-to-death in a mouse model of TC-83 VEEV disease. A single dose of (-)-carbodine resulted in a slight extension of mean time to death in mice infected with wild-type VEEV. Post-virus exposure treatment with (-)-carbodine was effective in significantly improving disease parameters in mice infected with TC-83 VEEV when treatment was initiated as late as 4 days post-virus installation (dpi). It is remarkable that (-)-carbodine is effective when initiated after the establishment of brain infection.
The pathogenesis of Venezuelan equine encephalitis (VEE) virus infection was compared in intraperitoneally inoculated mice (n = 24, 6 to 8 weeks old) and hamsters (n = 9, 90-110 g) using histopathology and immunohistochemical localization of VEE virus antigen. Infected mice developed paralysis, and the majority died by 9 days after inoculation. In contrast, hamsters did not survive beyond 3 days after inoculation, and they did not develop any neurologic signs. VEE virus antigen, demonstrated by immunoperoxidase staining, and pathologic changes were present in extraneural organs of both mice and hamsters. There was more severe involvement in hamsters, particularly in Peyer's patches of the distal small intestine. There was a severe encephalomyelitis in mice, but pathologic changes were not well established in the brains of hamsters before death. VEE virus antigen was widespread in the central nervous system of both mice and hamsters. VEE virus was found to be highly neurotropic in hamsters and had a similar distribution in the brain as in mice, but hamsters died from their extraneural disease before major central nervous system disease developed.
The virulent Trinidad donkey (TRD) strain of Venezuelan equine encephalitis (VEE) virus and its live attenuated vaccine derivative, TC-83 virus, have different neurovirulence characteristics. A full-length cDNA clone of the TC-83 virus genome was constructed behind the bacteriophage T7 promoter in the polylinker of plasmid pUC18. To identify the genomic determinants of TC-83 virus attenuation, TRD virus-specific sequences were inserted into the TC-83 virus clone by in vitro mutagenesis or recombination. Antigenic analysis of recombinant viruses with VEE E2- and E1-specific monoclonal antibodies gave predicted antigenic reactivities. Mouse challenge experiments indicated that genetic markers responsible for the attenuated phenotype of TC-83 virus are composed of genome nucleotide position 3 in the 5'-noncoding region and the E2 envelope glycoprotein. TC-83 virus amino acid position E2-120 appeared to be the major structural determinant of attenuation. Insertion of the TRD virus-specific 5'-noncoding region, by itself, into the TC-83 virus full-length clone did not alter the attenuated phenotype of the virus. However, the TRD virus-specific 5'-noncoding region enhanced the virulence potential of downstream TRD virus amino acid sequences.
To assess the potential for aerosol administration of vaccines for Venezuelan equine encephalitis virus (VEE), we compared the neurovirulence and tissue tropism of the wild-type Trinidad donkey (TrD) strain to those of the attenuated TC83 and V3526 strains of VEE in mice. Six to 8-week-old female C3H/HeN and BALB/c mice were aerosol exposed to one of the three VEE strains. Three mice of each strain were euthanatized at different times and their tissues were processed and stained using hematoxylin and eosin, immunohistochemistry, and in situ hybridization. All three viral strains infected the brains of mice and induced encephalitis. TrD spread caudally from the olfactory bulbs to all regions of the brain, caused widespread necrotizing panencephalitis by day 5, and resulted in 100% mortality (geometric mean = 7 days) in both mouse strains. By comparison, TC83 relatively spared the caudal regions of the brain but still caused 100% mortality in the C3H/HeN mice (geometric mean = 12 days), yet it did not kill any BALB/c mice. V3526 infectivity of the brain was the most limited, mainly affecting the neocortex and diencephalon. This virus was not lethal in either mouse strain. The TrD strain also infected the olfactory neuroepithelium, local lymphoid tissues, teeth, and vomeronasal organs, whereas the affinity of TC83 and V3526 outside the brain was essentially limited to the olfactory neuroepithelium. Attenuated VEE strains administered to mice by aerosol have restricted tissue tropism as compared with wild-type virus; however, even attenuated strains can infect the brain and induce encephalitis.
We compared the alpha/beta interferon (IFN-alpha/beta) sensitivities of the TC-83 vaccine strain and 24 enzootic and epizootic Venezuelan equine encephalitis (VEE) isolates. The IFN-resistant or -sensitive phenotype correlated well with epizootic or enzootic potential. IFN-alpha/beta resistance of Trinidad donkey (TRD) virus correlated with virulence determinants in the 5' noncoding region and glycoproteins. Infection of mice lacking a functional IFN system with the IFN-sensitive TC-83 virus resulted in disease equivalent to that produced by the virulent, IFN-resistant TRD virus, further demonstrating that IFN resistance contributes to VEE virus virulence and is a biological marker of epizootic potential.
Venezuelan equine encephalitis virus (VEEV) is a highly infectious alphavirus endemic in parts of Central and South America.
The disease is transmitted by mosquitoes, and the natural reservoir is the small rodent population, with epidemics occurring
in horses and occasionally humans. Following infection, VEEV replicates in lymphoid tissues prior to invasion of the central
nervous system. Treatment of VEEV-infected BALB/c mice with polyethylene glycol-conjugated alpha interferon (PEG IFN-α) results
in a greatly enhanced survival from either a subcutaneous or an aerosol infection. Virus is undetectable within PEG IFN-α-treated
individuals by day 30 postinfection (p.i.). Treatment results in a number of changes to the immune response characteristics
normally associated with VEEV infection. Increased macrophage activation occurs in PEG IFN-α-treated BALB/c mice infected
with VEEV. The rapid activation of splenic CD4, CD8, and B cells by day 2 p.i. normally associated with VEEV infection is
absent in PEG IFN-α-treated mice. The high tumor necrosis factor alpha production by macrophages from untreated mice is greatly
diminished in PEG IFN-α-treated mice. These results suggest key immunological mechanisms targeted by this lethal alphavirus
that can be modulated by prolonged exposure to IFN-α.
Venezuelan equine encephalitis virus (VEE) is an important equine and human pathogen of the Americas. In the adult mouse model, cDNA-derived, virulent V3000 inoculated subcutaneously (s.c.) causes high-titer peripheral replication followed by neuroinvasion and lethal encephalitis. A single change (G to A) at nucleotide 3 (nt 3) of the 5' untranslated region (UTR) of the V3000 genome resulted in a virus (V3043) that was avirulent in mice. The mechanism of attenuation by the V3043 mutation was studied in vivo and in vitro. Kinetic studies of virus spread in adult mice following s.c. inoculation showed that V3043 replication was reduced in peripheral organs compared to that of V3000, titers in serum also were lower, and V3043 was cleared more rapidly from the periphery than V3000. Because clearance of V3043 from serum began 1 to 2 days prior to clearance of V3000, we examined the involvement of alpha/beta interferon (IFN-alpha/beta) activity in VEE pathogenesis. In IFN-alpha/betaR(-/-) mice, the course of the wild-type disease was extremely rapid, with all animals dying within 48 h (average survival time of 30 h compared to 7.7 days in the wild-type mice). The mutant V3043 was as virulent as the wild type (100% mortality, average survival time of 30 h). Virus titers in serum, peripheral organs, and the brain were similar in V3000- and V3043-infected IFN-alpha/betaR(-/-) mice at all time points up until the death of the animals. Consistent with the in vivo data, the mutant virus exhibited reduced growth in vitro in several cell types except in cells that lacked a functional IFN-alpha/beta pathway. In cells derived from IFN-alpha/betaR(-/-) mice, the mutant virus showed no growth disadvantage compared to the wild-type virus, suggesting that IFN-alpha/beta plays a major role in the attenuation of V3043 compared to V3000. There were no differences in the induction of IFN-alpha/beta between V3000 and V3043, but the mutant virus was more sensitive than V3000 to the antiviral actions of IFN-alpha/beta in two separate in vitro assays, suggesting that the increased sensitivity to IFN-alpha/beta plays a major role in the in vivo attenuation of V3043.
Venezuelan equine encephalitis virus (VEEV) remains a naturally emerging disease threat as well as a highly developed biological weapon. Recently, progress has been made in understanding the complex ecological and viral genetic mechanisms that coincide in time and space to generate outbreaks. Enzootic, equine avirulent, serotype ID VEEV strains appear to alter their serotype to IAB or IC, and their vertebrate and mosquito host range, to mediate repeated VEE emergence via mutations in the E2 envelope glycoprotein that represent convergent evolution. Adaptation to equines results in highly efficient amplification, which results in human disease. Although epizootic VEEV strains are opportunistic in their use of mosquito vectors, the most widespread outbreaks appear to involve specific adaptation to Ochlerotatus taeniorhynchus, the most common vector in many coastal areas. In contrast, enzootic VEEV strains are highly specialized and appear to utilize vectors exclusively in the Spissipes section of the Culex (Melanoconion) subgenus.
We evaluated the prophylactic and therapeutic efficacy of interferon α-2b, pegylated interferon α-2b, poly(I · C), and Ampligen
against Modoc virus encephalitis in an animal model for flavivirus infections. All compounds significantly delayed virus-induced
morbidity (paralysis) and mortality (due to progressive encephalitis). Viral load (as measured on day 7 postinfection) was
significantly reduced by 80 to 100% in the serum, brain, and spleen in mice that had been treated with either interferon α-2b,
pegylated interferon α-2b, poly(I · C), or Ampligen. We also studied whether a combination of interferon α-2b and ribavirin
(presently the standard therapy for the treatment of infections with hepatitis C virus) would be more effective than treatment
with interferon alone. However, ribavirin did not enhance the inhibitory effect of interferon therapy in this animal model
for flavivirus infections.
Here we briefly report testosterone and cytokine responses to Venezuelan equine encephalitis virus (VEEV) in macaques which were used as part of a larger study conducted by the Department of Defense to better characterize pathological responses to aerosolized VEEV in non-human primates. Serial samples were collected and analyzed for testosterone and cytokines prior to and during infection in 8 captive male macaques. Infected animals exhibited a febrile response with few significant changes in cytokine levels. Baseline testosterone levels were positively associated with viremia following exposure and were significantly higher than levels obtained during infection. Such findings suggest that disease-induced androgen suppression is a reasonable area for future study. Decreased androgen levels during physiological perturbations may function, in part, to prevent immunosuppression by high testosterone levels and to prevent the use of energetic resources for metabolically-expensive anabolic functions.
We compared the alpha/beta interferon (IFN-alpha/beta) sensitivities of the TC-83 vaccine strain and 24 enzootic and epizootic Venezuelan equine encephalitis (VEE) isolates: The IFN-resistant or -sensitive phenotype correlated well with epizootic or enzootic potential. IFN-alpha/beta resistance of Trinidad donkey (TRD) virus correlated with virulence determinants in the 5' noncoding region and glycoproteins. Infection of mice lacking a functional IFN system with the IFN-sensitive TC-83 virus resulted in disease equivalent to that produced by the virulent, IFN-resistant TRD virus, further demonstrating that IFN resistance contributes to VEE virus virulence and is a biological marker of epizootic potential.
A lethal Pichinde (An 4763 strain) virus infection was produced in 3-week-old random-bred Golden Syrian (LVG/Lak strain) hamsters inoculated intraperitoneally with virus, causing mortality in 6–9 days. High virus titers (⩾ 107.5 cell culture infectious doses/g) were present in visceral organs, serum, brain and salivary glands near the time of death. Intraperitoneal treatments with ribavirin (10 and 32 mg/kg) and ribamidine (32, 100, and 320 mg/kg) for 10 days starting 24 h after virus challenge significantly decreased mortality and reduced virus titers by 100- to 10 000-fold in liver, spleen, brain, and serum. Serum alanine aminotransferase (an indicator of liver damage) was also reduced in animals treated with the two compounds (ribavirin at 32 mg/kg; ribamidine at 100 and 320 mg/kg). Intraperitoneal selenazofurin (1–100 mg/kg per day for 10 days) and ampligen (0.5 and 5 mg/kg every other day for 5 injections) treatments provided neither protection from the lethal infection nor increased mean survival times. In fact, selenazofurin was overtly toxic, causing death of uninfected hamsters at 32 and 100 mg/kg. The random-bred LVG/Lak hamster appears to be a viable and cost-effective model for evaluating new therapies for arenavirus infections.
An indirect mouse model was utilized to evaluate the antiviral activity of several compounds against Venezuelan equine encephalomyelitis
(VEE) virus infection in mice. Mice were given various dosages of lysine-stabilized polyriboinosinic acid-polyribocytidylic
acid, a tilorone analogue, kethoxal, or mepacrine before and/or shortly after receiving one of several dose levels of attenuated
strain TC-83 VEE virus. Twenty-one days later, the same mice were rechallenged intracranially with virulent Trinidad donkey
strain VEE virus. Susceptibility to rechallenge was interpreted as evidence of drug effectiveness in completely preventing
the initial immunizing virus infection. In contrast, if a drug lacked antiviral effectiveness, the initial attenuated infection
stimulated sufficient immunity to protect mice against the virulent rechallenge. Both of the interferon inducers, lysine-stabilized
polyriboinosinic acid-polyribocytidylic acid and tilorone analogue 11,567, possessed significant (P < 0.01) antiviral activity based upon this indirect model, whereas mepacrine and kethoxal were inactive. Results using the
indirect method were confirmed by using the conventional direct method for evaluating the effectiveness of potentially useful
antiviral compounds. The indirect mouse model described should prove useful for studying drug efficacy against certain viruses
that are lethal only by intracranial inoculation.
Several immunomodulators were compared for immunomodulatory and antiviral activity in B6C3F1 female mice. Our results demonstrate that murine recombinant gamma interferon (rIFN-G), human recombinant alpha A/D interferon (rIFN-A), ampligen (a polyribonucleotide) and CL246,738 modulate nonspecific immunity and are effective antiviral agents in vivo. Administration of each of these agents 1 day before cell harvest induced high levels of splenic natural killer (NK) cell activity against YAC-1 target cells. rIFN-G was also a potent activator of peritoneal macrophages (M phi), as evidenced by high levels of antitumor activity and changes in ectoenzyme phenotype that is characteristic of tumoricidal M phi. rIFN-A, ampligen and CL246,738 induced moderate to low levels of M phi activation by these criteria. In vivo protection experiments showed that repeated therapeutic treatment with rIFN-A protected mice against i.p. infection with Venezuelan equine encephalitis (an alpha togavirus, VEE), Banzi (a flavivirus) and herpes simplex virus type 2 (HSV-2). Similar treatment with rIFN-G was effective against VEE and HSV-2, but ineffective against Banzi virus. A single prophylactic i.p. dose of ampligen 1 day before virus challenge was very effective against Banzi virus, moderately effective against HSV-2, and ineffective against VEE and Caraparu (a bunyavirus) infection. A single prophylactic oral dose of CL246,738 provided almost complete protection of mice against VEE, Banzi, and HSV-2, and also increased the mean survival time for Caraparu infected mice. Collectively, these results indicate that rIFN-A, r-IFN-G, ampligen and CL246,738 may be useful in prophylactic or early therapeutic treatment of several serious virus infections. Since these agents stimulate NK cells and M phi, their antiviral activity may result, in part, from the alterations they induce in the natural immune system.
The nucleotide and deduced amino acid sequences of the structural proteins of the TC-83 vaccine strain of Venezuelan equine encephalitis (VEE) virus have been determined from a cDNA clone containing the 26S mRNA coding region. A cDNA clone encoding the equivalent region of the virulent parent VEE virus [Trinidad donkey strain (TRD)] has been sequenced previously. Comparison of the sequences of the TC-83 and TRD cDNA clones revealed 13 nucleotide differences. Neither the organization of the structural proteins (5'-capsid-E3-E2-6K-E1-3') nor the length (3762 nucleotides) of the open reading frame coding for the viral polyprotein precursor was altered during attenuation. Of the 13 nucleotide differences between the cDNA clones of TC-83 and TRD, nine occurred in the dominant population of the respective genomic RNAs from plaque-purified viruses. Six of the nine mutations were clustered in the E2 surface glycoprotein gene. All five of the nucleotide changes which produced non-conservative amino acid substitutions in the encoded proteins were located in the E2 gene. Two mutations occurred in the E1 glycoprotein gene; one was silent and the other did not alter the chemical character of the E1 protein. One nucleotide difference was found in the non-coding region immediately preceding the 5'-end of the 26S mRNA. The E2 and non-coding region mutations are candidates for the molecular determinants of VEE virus neurovirulence.
The histopathology of fatal Venezuelan equine encephalitis (VEE) in humans has not been well documented. To evaluate the spectrum of disease in man, the histologic slides of the 21 autopsied patients who died with documented VEE infection during the 1962-63 VEE epidemic in Zulia, Venezuela were reviewed. The main histopathologic lesion observed in multiple organs and tissues, especially the brain, gastrointestinal tract, and lungs, was moderate to marked diffuse congestion and edema with hemorrhage. In the central nervous system (CNS), mild or focal mixed inflammatory cell infiltrates were present in the leptomeninges and perivascular spaces (65%). Meningoencephalitis associated with intense necrotizing vasculitis was observed in 2 patients (10%), and cerebritis was observed in 5 cases (25%). There was a striking depletion of lymphocytes with vascular thrombosis and necrosis of follicles in lymph nodes (77%), spleen (69%), and the gastrointestinal tract (90%). Widespread hepatocellular degeneration and individual cell necrosis was observed in 61% of the cases. Most patients (90%) had interstitial pneumonia, frequently complicated by acute bronchopneumonia (33%). Overall, the lesions observed in the CNS and reticuloendothelial tissues are comparable to what is observed in experimental animals; however, extensive hepatocellular degeneration and interstitial pneumonia are not prominent pathologic features of VEE in animals. The findings are consistent with the hypothesis that lymphoid and reticuloendothelial tissues are the targets in VEE virus infection in humans, and that many of the histopathologic changes are attributable to primary lymphoid and endothelial cell injury.
Two strains of Venezuelan equine encephalomyelitis virus, which differ in virulence for mice, have been studied for their production of and sensitivity to chick and mouse interferon. Little interferon was produced by chick cells in response to the virulent Trinidad strain or the attenuated TC-83 strain without either aging or priming the cultures. Consistent differences in the production of chick interferon were not found between the two strains. Plaque variants of the Trinidad strain produced higher titers of mouse interferon than the TC-83 strain in both primed and control L-cell cultures. The TC-83 strain was found to be more sensitive than the Trinidad strain to the inhibitory effects of interferon. The greater sensitivity of the TC-83 strain was observed at both high and low multiplicities and for both chick and mouse interferons. These results are consistent with the hypothesis that interferon sensitivity may have a role as a determinant of virulence in some virus-host systems.
Ampligen, a known immunomodulator and interferon inducer, was used alone and in combination with other antiviral agents to treat ducks congenitally-infected with duck hepatitis B virus. These antiviral agents included the conventional nucleoside analogue ganciclovir and the prokaryotic DNA gyrase B inhibitor coumermycin A1. When used alone, ampligen decreased the amount of serum and liver viral DNA, but had no effect on circulating duck hepatitis B surface antigen (DHBsAg). In combination with ganciclovir, the antiviral effect appeared at least additive with a greater inhibition of viral DNA replication within the liver. The combination of ampligen with coumermycin A1 also resulted in inhibition of viral replication but to a lesser extent than ampligen alone. When all three agents were used together, viral DNA replication was again inhibited, but as with previous treatment regimes, serum DHBsAg levels remained unchanged. At the end of the treatment period for all regimes, analysis of viral DNA forms in the liver showed that the viral relaxed circular and supercoiled DNA forms had persisted. Within 1 week of cessation of therapy, viral replication had often returned to pre-treatment levels. Interferon-like activity was detected in the sera of the majority of the treated ducks during the ampligen therapy, but no clear relationship between the presence of interferon and antiviral effect could be established. These observations in the duck hepatitis B model may provide a rational basis for the use of combinations of antiviral and immunomodulatory regimes for the management of chronic hepatitis B infection in man.
Venezuelan equine encephalitis virus (VEE) causes a biphasic disease in mice following subcutaneous inoculation in the footpad. In the initial phase, virus replicates primarily in the lymphoid tissues and induces a high titer viremia. Subsequently, the virus invades the central nervous system (CNS) from the circulation, and an encephalitis ensues. At the earliest times that VEE specific in situ hybridization signal was observed in the CNS, it was in areas of the brain involved in olfaction, leading to the hypothesis that virus may invade the brain from the circulation through the olfactory system. The results presented in this paper define the route of CNS invasion in experimental murine VEE disease initiated by subcutaneous inoculation. Virus circulating in the blood appears to seed specific areas of the peripheral nervous system during the viremic lymphoid phase of the illness. Virus replication within olfactory and dental tissues is followed by centripetal spread of virus along neural pathways. Virus enters the brain in a pattern reflecting the proximity of the peripheral invasion site to the CNS. Specifically, virus is first found in the brain within the structures of the olfactory system, followed by areas innervated by the trigeminal nerve. Virus later disseminates along fiber tracts and connected circuits within the brain, resulting in a disseminated meningoencephalitis. Surgical or chemical interruption of the olfactory system at the level of the olfactory neuroepithelium or the main olfactory bulb inhibited entry of VEE into the CNS through the olfactory nerve. However, the olfactory route is not absolutely required for CNS invasion, as virus invaded the CNS of olfactory ablated animals through the trigeminal nerve. These observations are consistent with a model of hematogenous seeding of the peripheral nervous system, followed by invasion of the CNS by direct neural spread.
The pathogenesis of Venezuelan equine encephalitis virus (VEE) was examined in the mouse model using V3000, a virus derived from a molecular clone of the Trinidad donkey strain of VEE. These results were compared in parallel experiments with avirulent mutants of VEE derived by site-directed mutagenesis of the clone. Adult mice, inoculated subcutaneously in their left rear footpad with V3000, were followed in a time course study for 6 days in which 15 organs were tested for histopathological changes, for the presence of viral antigen by immunohistochemical staining, for the presence of viral nucleic acid by in situ hybridization analysis, and for content of viable virus. Virus was detected in the footpad inoculation site, but until 12 hr postinoculation (pi), the level of virus did not suggest early viral replication. By 4 hr pi, however, replication of V3000 was evident in the draining popliteal lymph node. At this early time point, no virus could be isolated from any other organ examined. At 12 hr, a significant serum viremia was observed, and virus was detected at a low level in a number of well vascularized organs, including spleen, heart, lung, liver, kidney, and adrenal gland. By 18 hr, high virus titers were present in serum and all the lymphoid organs examined, and these tissues appeared to be the major peripheral sites of V3000 replication. Virus in serum and peripheral organs was cleared by 3-4 days pi. In a second phase of the infection, V3000 invaded the central nervous system (CNS), replicated predominantly in neurons, and persisted in the brain until death by encephalitis. Pathologic findings as well as the results of immunocytochemical and in situ hybridization examination were generally coordinate with virus titration. A site-directed mutant of V3000, V3010, contained a mutation in the gene for the E2 glycoprotein at codon 76 (Glu to Lys) which rendered it avirulent after footpad inoculation. Detection of V3010 replication in the draining lymph node was sporadic and was sometimes delayed to as long as 3 days pi. Infrequent and/or delayed virus spread to other sites also was observed. Analogous experiments were performed with other mutants which were avirulent by the footpad inoculation route: V3014, a mutant differing from V3000 at three loci (E2 Lys 209, E1 Thr 272, and E2 Asn 239), as well as single-site mutants V3032 (E2 Lys 209) and V3034 (E1 Thr 272).(ABSTRACT TRUNCATED AT 400 WORDS)
Viral pathogenesis can be described as a series of steps, analogous to a biochemical pathway, whose endpoint is disease of the infected host. Distinct viral functions may be critical at each required step. Our genetic approach is to use Venezuelan equine encephalitis virus (VEE) mutants blocked at different steps to delineate the process of pathogenesis. A full-length cDNA clone of a virulent strain of VEE was used as a template for in vitro mutagenesis to produce attenuated single-site mutants. The spread of molecularly cloned parent or mutant viruses in the mouse was monitored by infectivity, immunocytochemistry, in situ hybridization and histopathology. Virulent VEE spread through the lymphatic system, produced viremia and replicated in several visceral organs. As virus was being cleared from these sites, it began to appear in the brain, frequently beginning in the olfactory tracts. A single-site mutant in the E2 glycoprotein appeared to block pathogenesis at a very early step, and required a reversion mutation to spread beyond the site of inoculation. The feasibility of combining attenuating mutations to produce a stable VEE vaccine strain has been demonstrated using three E2 mutations.
Sindbis virus (SV) causes an acute encephalomyelitis in mice. A T cell-dependent inflammatory response is first detected 3 days after infection and includes T cells, B cells, and macrophages. The cytokines produced locally by intrinsic cells of the brain in response to infection and by infiltrating mononuclear cells and their contributions to outcome of infection have not been identified. Semiquantitative reverse transcriptase-PCR was used to evaluate the expression of mRNAs for IL-1 beta, IL-2, IL-4, IL-6, IL-10, TNF-alpha, leukemia inhibitory factor (LIF), and TGF-beta in the brain during fatal and nonfatal SV encephalitis of immunocompetent BALB/cJ and immunodeficient scid/CB17 mice. IL-1 beta and IL-6 mRNAs were detected in uninfected mice before infection and were up-regulated within 24 h. TGF-beta mRNA was also constitutively expressed in uninfected mice. LIF mRNA was occasionally detected in uninfected mice but increased in amounts only in BALB/cJ not scid mice after infection. TNF-alpha, IL-4, and IL-10 mRNAs were not found in uninfected mice but were induced within 24 h and continued to rise through 7 days after infection with substantially higher levels in BALB/cJ than scid mice. These data suggest that intrinsic brain cells produce IL-1, IL-4, IL-6, IL-10, LIF, and TGF-beta mRNAs in response to viral infection. IFN-gamma and IL-2 mRNAs were detected only in BALB/cJ mice and not until 3 days after infection with the initiation of inflammation. IL-4 and IL-10 mRNAs were more persistent and more easily detectable than IL-2 and IFN-gamma mRNAs. These data suggest a predominant type 2 cytokine response in the brain during SV encephalitis. BALB/cJ mice infected with a neurovirulent strain of SV (NSV), had 100% mortality, whereas NSV-infected scid mice developed persistent nonfatal infection. Inflammation was more intense in NSV-infected mice, however, no substantial differences in cytokine mRNA levels were detected when compared with mice with nonfatal SV infection suggesting that the cytokines measured do not in and of themselves lead to fatal central nervous system disease.
Immunization with either a live-attenuated (TC-83) or formalin-inactivated (C-84) vaccine for Venezuelan equine encephalitis (VEE) virus protected BALB/c mice from lethal VEE infection acquired subcutaneously or by aerosol. While vaccinated C3H/HeN mice were also protected from parenteral infection, neither vaccine protected these mice from an aerosol infection. The apparent vaccine failures in C3H/HeN mice could not be attributed to deficiencies in virus-neutralizing antibodies in serum, as these responses were typically of equal or higher titer than those observed in protected BALB/c mice before challenge. IgG subclass analysis offered no facile explanation: profiles of IgG2 alpha dominance were observed in C3H/HeN mice given either vaccine and in BALB/c mice given the live-attenuated vaccine, whereas BALB/c antibody responses shifted toward IgGl dominance after immunization with the killed C-84 vaccine. Data from immunized congenic mice showed that the H-2 genes from the C3H/He mice were not singularly responsible for the inability of these mice to resist aerosol infection with VEE virus. VEE virus-specific IgA responses were detected more frequently in respiratory and vaginal secretions obtained from the protected BALB/c mice.
In the mouse model, the arbovirus Venezuelan equine encephalitis virus (VEE) replicates in lymphoid tissues prior to either inducing protective immunity (attenuated VEE mutant) or progressing to lethal encephalitis (virulent parent VEE). To investigate the mechanism of the protective response, cytokine gene expression was examined during the course of the primary in vivo immune response to molecularly cloned, virulent VEE and a single-site attenuated VEE mutant, using a quantitative reverse transcriptase-polymerase chain reaction assay. VEE-induced cytokine gene expression was 100-fold elevated over that of untreated controls for IFN-gamma and IL-6 and 10-fold increased for IL-12, IL-10, and TNF-alpha. There was no qualitative difference in cytokine gene induction comparing mice infected with the attenuated and the virulent VEE; however, there were significant differences in the cytokine gene expression kinetics. In mice infected with the attenuated VEE, elevated cytokine gene expression was delayed 24 hr when compared to mice infected with the virulent parent VEE clone at the same dose. Further, IFN-gamma protein secretion by cells from the draining lymph node mimicked the pattern of IFN-gamma gene induction by cells harvested from the same site. IFN-gamma gene expression was elevated at an earlier time point in mice given virulent V3000 24 hr after attenuated V3032 injection compared to mice infected with virulent V3000 alone. The combined V3000/V3032 infection resulted in host protection. Treatment of mice with IL-12 prior to infection with virulent VEE failed to reduce the severity of infection, while anti-IL-12 antibody did not prevent the early protective effect of attenuated virus. In contrast, administration of anti-IFN-alpha/beta antibody prior to VEE infection worsened virulent VEE disease. These results indicate that the attenuated VEE strain elicits a similar but delayed cytokine response compared to the virulent strain, suggesting that the kinetics of cytokine expression and the particular cytokine produced may influence the development of a host protective response. Furthermore, IFN-alpha/beta, but not IL-12, seems to be a major factor in the induction of early protection against VEE infection and disease.
Alphaviruses infect neurons in the brain and spinal cord and cause acute encephalomyelitis in a variety of mammals. The outcome of infection is determined by whether the neurons survive infection and this, in turn, is determined by the virulence of the virus and the age of the host at the time of infection. We have been studying Sindbis virus (SV) infection of mice as a model system for alphavirus-induced encephalomyelitis. Investigation of intracerebral infection of weanling mice with two different strains of SV has allowed us to analyze the role of the immune response in protection from fatal disease (virulent NSV strain) and in clearance of virus from the nervous system during non-fatal disease (less virulent SV AR339 strain). Neutralizing and non-neutralizing antibodies to the E1 and E2 surface glycoproteins can protect mice from fatal NSV infection when given before or after infection, while T cells are not protective. The mechanism of antibody-mediated protection is not known, but it is likely that more than one mechanism is involved and that different mechanisms are involved in pre-infection and post-infection treatment protection. Clearance of infectious virus from the nervous system of mice during recovery from non-fatal disease is accomplished by antibodies to the E2 glycoprotein. The process does not involve damage to the infected neurons and is independent of complement and mononuclear cells. Bivalent antibody is required and binds to the surface of the infected cell. Initially, release of virus by budding from the cell surface is prevented and, subsequently, intracellular virus replication is inhibited possibly through antiviral mechanisms induced in co-operation with interferon. This non-lytic mechanism for control of virus infection results in the prolonged presence of viral RNA in tissue and the need for prolonged intrathecal synthesis of antiviral antibody by B cells within the central nervous system.
The early stages of Venezuelan equine encephalitis virus (VEE) pathogenesis in the mouse model have been examined using a genetic approach. Disease progression of a molecularly cloned single-site mutant was compared with that of the parental virus to determine the step in the VEE pathogenetic sequence at which the mutant was blocked. Assuming that such a block constitutes a genetic screen, isolates from different tissues thought to be distal to the block in the VEE pathogenetic sequence were analyzed to determine the pathogenetic step at which revertants of the mutant were selected. Directed mutation and analysis of reversion in vivo provide two powerful genetic tools for the dissection of the wild-type VEE pathogenetic sequence. Virus from the parental virulent clone, V3000, first replicated in the draining lymph node after subcutaneous inoculation in the left rear footpad. Movement of a cloned avirulent mutant, V3010 (E2 76 Glu to Lys), to the draining lymph node was impaired, replication in the node was delayed, and spread beyond the draining lymph node was sporadic. Serum, contralateral lymph node, spleen, and brain isolates from V3010 inoculated animals were invariably revertant with respect to sequence at E2 76 and/or virulence in mice. Revertants isolated from serum and contralateral lymph node retained the V3010 E2 Lys 76 mutation but also contained a second-site mutation, Glu to Lys at E2 116. Modification of the V3010 clone by addition of the second-site mutation at E2 116 produced a virus that bypassed the V3010 block at the draining lymph node but that did not possess full wild-type capacity for replication in the central nervous system or for induction of mortality. A control construct containing only the E2 116 reverting mutation on the V3000 background was identical to V3000 in terms of early pathogenetic steps and virulence. Therefore, analysis of mutant replication and reversion in vivo suggested (1) that the earliest steps in VEE pathogenesis are transit to the draining lymph node and replication at that site, (2) that the mutation in V3010 impairs transit to the draining lymph node and blocks dissemination to other tissues, and (3) that reversion can overcome the block without restoring full virulence.
Infection with the mosquito-transmitted Venezuelan equine encephalitis virus (VEE) causes an acute systemic febrile illness followed by meningoencephalitis. In this communication we characterize the cytokine profile induced in the central nervous system (CNS) in response to virulent or attenuated strains of VEE using RNase Protection Assays. Virulent VEE causes an upregulation of multiple pro-inflammatory genes including inducible nitric oxide synthase (iNOS) and tumor necrosis factor alpha (TNF-alpha). To determine if iNOS and TNF-alpha contribute to the neuropathogenesis of VEE infection, iNOS and TNF receptor knockout mice were used in VEE mortality studies and exhibited extended survival times. Finally, CNS tissue sections labeled for VEE antigen, and adjacent sections double-labeled for an astrocyte marker and apoptosis, revealed that apoptosis of neurons occurs not only in areas of the brain positive for VEE-antigen, but also in areas of astrogliosis. These findings suggest that the inflammatory response, which is in part mediated by iNOS and TNF-alpha, may contribute to neurodegeneration following encephalitic virus infection.
The course of Venezuelan equine encephalitis (VEE) disease in immunodeficient and immunologically normal mice was compared to define the role of the immune system in this disease process. Immunocompetent mice infected with VEE exhibited a biphasic illness characterized by an early self-limiting lymphoid phase and a fatal CNS phase. The lymphoid phase of the illness was characterized by extensive viral replication within spleen, thymus, Peyer's patches, and lymph nodes, was accompanied by a high-titered serum viremia, and resolved with the production of VEE-specific IgM class antibody at 72 h postinfection (p.i.). Immunocompetent animals survived an average of 6.8 +/- 1.2 days before succumbing to fulminant encephalitis. In contrast, SCID mice infected with VEE showed a persistent replication of virus throughout all organs tested beginning at 24 h p.i. VEE-infected SCID mice exhibited a severe spongiform encephalopathy with 100% mortality and an average survival time of 8.9 +/- 0.9 days. These studies indicated that the characteristic organ tropism of VEE in the mouse is due in large part to an early anti-viral state, the establishment of which is dependent upon the presence of an intact immune system. Finally, the CNS pathology in a VEE-infected mouse had a significant immunologic component. However, in contrast to other neurovirulent alphaviruses, VEE was directly cytopathic for the cells of the CNS, even in the absence of an immune response.
A candidate live-attenuated virus vaccine for protection against Venezuelan equine encephalitis (VEE) (designated V3526) was tested in mice to measure the magnitude, duration, and kinetics of virus replication in the blood and the central nervous system and its phenotypic stability after multiple passages in mice and cell culture. All results were compared to parallel experiments with parental virus and the existing VEE virus vaccine, TC-83. Maximum virus titers in the brains of V3526-inoculated mice were between 10- and 100-fold less than those observed in brains of mice inoculated intracranially (i.c.) with either the parental virus or TC-83. Neither V3526 nor TC-83 was lethal in BALB/c mice inoculated i.c.. However, mice inoculated with TC-83 developed acute symptoms lasting at least 14 days. In contrast, i.c. inoculation of TC-83 was uniformly lethal for C3H/HeN mice. V3526 was avirulent in both BALB/c and C3H/HeN mice after i.c. inoculation. The virulence characteristics of V3526 remained unchanged after five serial i.c. passages in mouse brains or after five cell culture passages. Finally, pathologic changes induced after i.c. inoculation of V3526 were consistently less severe and of shorter duration than those observed in TC-83-inoculated mice. Based on these results, V3526 is stable and appears to be significantly less neurovirulent in mice than TC-83.
Mice are used as models for western equine encephalitis virus (WEEV) infection, but high mortality is generally only seen with intracranial or intranasal challenge, while peripheral inoculation results in approximately 50% mortality and is not dose-dependent. Hamsters were therefore studied as a model for WEEV infection. Hamsters were highly sensitive to intraperitoneal (i.p.) infection with WEEV. Disease progression was rapid, and virus titers in serum, brain, liver, and kidney of infected hamsters peaked between 2 and 4 days post-virus inoculation (dpi). Foci of virus infection were detected in neurons of the cerebral cortex and midbrain. Pre-treatment i.p. with either interferon alfacon-1 (5 microg/kg/day) or with Ampligen (3.2 mg/kg/day) resulted in complete survival, reduced brain titers, and improved weight gain. This model of WEEV infection in hamsters appears to serve as a suitable model for the evaluation of potential therapeutic agents for the treatment of WEE disease.
Mismatched double-stranded RNA: polyI:polyC12UPubMed A single-site mutant and revertants arising in vivo define early steps in the pathogenesis of Venezuelan equine encephalitis virus Attenuation of Venezuelan equine encephalomyelitis virus by in vitro cultivation in guinea-pig heart cells
- Anonymous
- Jf Aronson
- Fb Grieder
- Charles Nl Pc Davis
- T Knott
- K Brown
- Johnston
Anonymous. Mismatched double-stranded RNA: polyI:polyC12U. Drugs R D 2004;5:297–304. [PubMed: 15357629] Aronson JF, Grieder FB, Davis NL, Charles PC, Knott T, Brown K, Johnston RE. A single-site mutant and revertants arising in vivo define early steps in the pathogenesis of Venezuelan equine encephalitis virus. Virology 2000;270:111–123. [PubMed: 10772984] Berge TO, Banks IS, Tigertt WD. Attenuation of Venezuelan equine encephalomyelitis virus by in vitro cultivation in guinea-pig heart cells. Am J Hyg 1961;73:209–218
Mismatched double-stranded RNA: polyI:polyC12U
- Anon
Anon., 2004. Mismatched double-stranded RNA: polyI:polyC12U. Drugs R D 5, 297–304.