Role of the Vasopressin 1b Receptor in Rodent Aggressive Behavior and Synaptic Plasticity in Hippocampal Area CA2

Abstract

The vasopressin 1b receptor (Avpr1b) is critical for social memory and social aggression in rodents, yet little is known about its specific roles in these behaviors. Some clues to Avpr1b function can be gained from its profile of expression in the brain, which is largely limited to the pyramidal neurons of the CA2 region of the hippocampus, and from experiments showing that inactivation of the gene or antagonism of the receptor leads to a reduction in social aggression. Here we show that partial replacement of the Avpr1b through lentiviral delivery into the dorsal CA2 region restored the probability of socially motivated attack behavior in total Avpr1b knockout mice, without altering anxiety-like behaviors. To further explore the role of the Avpr1b in this hippocampal region, we examined the effects of Avpr1b agonists on pyramidal neurons in mouse and rat hippocampal slices. We found that selective Avpr1b agonists induced significant potentiation of excitatory synaptic responses in CA2, but not in CA1 or in slices from Avpr1b knockout mice. In a way that is mechanistically very similar to synaptic potentiation induced by oxytocin, Avpr1b agonist-induced potentiation of CA2 synapses relies on NMDA (N-methyl-D-aspartic acid) receptor activation, calcium and calcium/calmodulin-dependent protein kinase II activity, but not on cAMP-dependent protein kinase activity or presynaptic mechanisms. Our data indicate that the hippocampal CA2 is important for attacking in response to a male intruder and that the Avpr1b, likely through its role in regulating CA2 synaptic plasticity, is a necessary mediator.Molecular Psychiatry advance online publication, 27 May 2014; doi:10.1038/mp.2014.47.

Full text

ORIGINAL ARTICLE
Role of the vasopressin 1b receptor in rodent aggressive
behavior and synaptic plasticity in hippocampal area CA2
JH Pagani
1,3
, M Zhao
2,3
, Z Cui
1,3
, SK Williams Avram
1
, DA Caruana
2,4
, SM Dudek
2
and WS Young
1
The vasopressin 1b receptor (Avpr1b) is critical for social memory and social aggression in rodents, yet little is known about its
specific roles in these behaviors. Some clues to Avpr1b function can be gained from its profile of expression in the brain, which is
largely limited to the pyramidal neurons of the CA2 region of the hippocampus, and from experiments showing that inactivation of
the gene or antagonism of the receptor leads to a reduction in social aggression. Here we show that partial replacement of the
Avpr1b through lentiviral delivery into the dorsal CA2 region restored the probability of socially motivated attack behavior in total
Avpr1b knockout mice, without altering anxiety-like behaviors. To further explore the role of the Avpr1b in this hippocampal region,
we examined the effects of Avpr1b agonists on pyramidal neurons in mouse and rat hippocampal slices. We found that selective
Avpr1b agonists induced significant potentiation of excitatory synaptic responses in CA2, but not in CA1 or in slices from Avpr1b
knockout mice. In a way that is mechanistically very similar to synaptic potentiation induced by oxytocin, Avpr1b agonist-induced
potentiation of CA2 synapses relies on NMDA (N-methyl-D-aspartic acid) receptor activation, calcium and calcium/calmodulin-
dependent protein kinase II activity, but not on cAMP-dependent protein kinase activity or presynaptic mechanisms. Our data
indicate that the hippocampal CA2 is important for attacking in response to a male intruder and that the Avpr1b, likely through its
role in regulating CA2 synaptic plasticity, is a necessary mediator.
Molecular Psychiatry advance online publication, 27 May 2014; doi:10.1038/mp.2014.47
INTRODUCTION
Aggressive behavior, found across the animal kingdom, is usually
highly adaptive for survival. Examples include maternal protection
of the young, defense of territory and capture of prey.
1,2
Human
aggressive behavior, on the other hand, particularly that involving
physical violence, is typically viewed as pathological and can
accompany several forms of psychiatric illness such as schizo-
phrenia. An understanding of these complex behaviors at the
cellular level, however, is still lacking. With the goal of ameliorat-
ing some symptoms of mental illness, including aggressive
behavior, many recent human studies have explored the effects
of the two neuropeptides vasopressin (Avp) and oxytocin (Oxt).
3
Many of the effects of these neuropeptides are likely mediated by
the oxytocin (Oxtr) and vasopressin 1a (Avpr1a) receptors
4–6
which are widely distributed within the central nervous system.
Vasopressin 1b receptor (Avpr1b) expression, in contrast, is highly
restricted to the pyramidal cells in the CA2 region of the
hippocampus.
7
Like the Oxtr and Avpr1a, this receptor is likely
to have an important role in human behavior, as it is required for
proper regulation of social aggression and social recognition in
several mammalian species.
8,9
The CA2 region was described in 1934,
10
yet little is known of its
function as it had, until recently, been overlooked as a part of the
hippocampal circuit (reviews, Jones et al.
11
and Piskorowski and
Chevaleyre
12
). Pathological studies show that compared with
neurons in the flanking CA1 and CA3 fields, neurons in CA2 are
relatively resistant to damage arising during the course of various
illnesses, including epilepsy.
13–18
Conversely, CA2 non-pyramidal
neurons in schizophrenic and bipolar patients seem to be
preferentially lost
19
and pyramidal neurons in CA2 of schizo-
phrenics are smaller.
20
Gene expression studies show that the CA2
region is molecularly distinct from the rest of the hippo-
campus.
21,22
In addition, its pyramidal neurons have distinct
physiological characteristics that include an apparent lack of
capacity for typical long-term synaptic potentiation (LTP) when
using conventional methods of Schaffer collateral stimulation.
23
This property of LTP resistance seems to be due to higher calcium
buffering and extrusion and the expression of RGS14 in CA2
pyramidal neurons.
24,25
To gain an understanding of its role in the brain, we inactivated
the Avpr1b gene in the mouse and found that social recognition is
reduced in both male and female mice in these knockouts
(KOs).
9,26
Specific inactivation of CA2 pyramidal cell activity also
reduces social recognition.
27
In addition, male territorial aggres-
sion and maternal aggression are disrupted in this knockout
line.
9,28
Spatial memory, as tested in the Morris water maze, is
normal.
9
Predatory aggression and defensive behaviors are
unaffected, indicating that the pattern of motor skills important
for aggressive behaviors remains intact.
28
Interestingly, although
phenotypic changes in aggression often co-occur with changes in
anxiety-like behavior,
29
reduced aggression in the Avpr1b KOs is
observed without any detectible changes in anxiety-like behavior.
7
1
Section on Neural Gene Expression, National Institute of Mental Health, National Institutes of Health, Bethesda, MD, USA and
2
Laboratory of Neurobiology, National Institute of
Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC, USA. Correspondence: Dr WS Young, Section on Neural Gene Expression, National
Institute of Mental Health, National Institutes of Health, 9000 Rockville Pike, Building 49, Room 5A56, Bethesda, 20892-4484, MD, USA or Dr SM Dudek, Laboratory of Neurobiology,
National Institute of Environmental Health Sciences, National Institutes of Health, Building 101, Room F279A, 111T W. Alexander Drive, Research Triangle Park, NC 27709, USA.
E-mail: wsy@mail.nih.gov or dudek@niehs.nih.gov
3
These authors contributed equally to this work.
4
Current address: Institute for Science and Technology in Medicine, Keele University, Keele, Staffordshire ST5 5BG, UK.
Received 20 November 2012; revised 7 March 2014; accepted 16 April 2014
Molecular Psychiatry (2014), 1– 10
© 2014 Macmillan Publishers Limited All rights reserved 1359-4184/14
www.nature.com/mp

Support for the role of Avpr1b in aggression comes from the
administration of an Avpr1b antagonist to mice and hamsters that
reduces aggressive behavior in these species.
30,31
To test our hypothesis that Avp acts through the Avpr1b
specifically expressed in dorsal CA2 to permit normal social
aggression, we used lentiviral injections to partially restore Avpr1b
expression there. This resulted in significant aggressive behavior
in Avpr1b KO mice, without altering anxiety-like behavior. We then
sought to determine the functional effects of Avp on CA2
synapses in vitro by testing our hypothesis that Avpr1b agonists
modulate synaptic strength or plasticity in mice and rats. We
found that application of the Avpr1b agonists induced significant
potentiation of synaptic responses, an effect mimicked by Oxt and
not found in Avpr1b knockout mice.
MATERIALS AND METHODS
Animals
The development and genotyping of the Avpr1b and Oxtr KO lines were
described in detail previously.
9,32
Briefly, Avpr1b mice were genotyped
using these primers: 5, ACCTGTAGATATTTGACAGCCCGG; 9, GAAACGGCTA
CTCTCTCCGATTCCAAAAGAAAG; and neo1, ACCCCTTCCCAGCCTCTGAG
CCCAGAAAGCGAAGG. PCR (95 °C × 4′; (95 °C × 1′,60°C×1′,72°C
×1′) × 40; 72 °C × 5′; 10 °C) yields 762 and 461 bp bands for wild-types
(WTs) and Avpr1b KOs, respectively (see Supplementary Figure 1 for
schematic of the Avpr1b KO). Oxtr mice were genotyped using these
primers: Seq. 1, ACCCCAGGAAGATGTACCCGTAGTAAAGC; Seq4, TTAGGT
CCCAGGAAAGAGTCAGCCGCTCTGCCTGCAGAGAGG; and DTAo10.3, TGGGA
GTCCAGAGATAGTGGAA. PCR (95 °C × 4′, (95 °C × 45′′,60°C×45′′,72°
C×45′′) × 40, 72 °C × 5′, 10 °C) yields bands at 221 and 150 bp for WTs
and Oxtr KOs, respectively. The mice have been backcrossed into C57Bl/6J
mice (Jackson Laboratories, Bar Harbor, ME, USA) for more than 10
generations and used here for in vivo behavior and in vitro electrophysiol-
ogy experiments. Oxtr KO mouse pups were fostered with CD-1 dams
(Charles River Laboratories, Raleigh, CA, USA, bred at NIEHS) until used for
in vitro experiments.
Aggression experiments used a total of 48 male mice taken from 19
liters run in five separate squads: 16 wild-type (WT) mice, 19 KO mice
injected with a lentivirus containing a cytomegalovirus promoter-driven
mouse Avpr1b receptor coding sequence (KO+Replace) and 13 KO mice
injected with a lentivirus containing a cytomegalovirus promoter-driven
green fluorescent protein construct (KO+GFP). KO mice were randomly
assigned to either the GFP or the Avpr1b groups. All mice were between
81 and 216 days old at testing. A total of 42 BalbC mice obtained from the
National Cancer Institute (Frederick, MD, USA) at 8 weeks of age were used
as intruders. Anxiety-like behavioral experiments used a total of 39 male
mice run in five separate squads: 14 WT, 8 KO+GFP and 8 KO+Replace.
Tissues for brain slice experiments were obtained from mice or rats of
either sex at 14–20 days of age, or 6 weeks of age in some experiments.
All animals were grouped housed in same sex cages (not segregated by
genotype) from weaning until singly housed for aggression or housed with
dams (in vitro studies) and maintained in a 12-h light/dark cycle (lights on
at 0400 h) with food and water available ad libitum. Behavioral tests were
conducted 1 h after the onset of the dark phase (1700 h), and at least
2 weeks after surgery. All animal procedures were approved by the
National Institute of Mental Health and National Institute of Environmental
Health Sciences Animal Care and Use Committees and were in accordance
with the National Institutes of Health guidelines on the care and use of
animals.
Virus
The coding region of the Mus musculus Avpr1b mRNA (Gene Bank
accession number: NM_011924) was cloned from mouse hippocampal
tissue by reverse transcriptase–PCR. This region was inserted into the
plasmid pRRLsin.CMV.GFPpre
33
replacing the GFP sequence. A flag tag
sequence (amino acids DYKDDDK) was also inserted after the ATG codon
(Supplementary Figure 2a). A western blot was conducted to confirm
proper mouse Avpr1b expression after infection of 293T cells
(Supplementary Figure 2b). Vectors to express the lentiviral gag-pol and
the VSV-G envelope were co-transfected into 293T cells and lentiviruses
expressing GFP or Avpr1b were produced as previously described.
33
Titers
of 1.7–2.2 × 10
8
particles per ml were obtained.
Surgical procedures
Mice were anesthetized with 250–500 mg kg
− 1
intraperitoneal injections
of 2,2,2-tribromoethanol (Avertin; Sigma-Aldrich, St. Louis, MO, USA) and
were kept warm with a heating pad during anesthesia and recovery. Each
mouse was placed in a small animal stereotaxic instrument (Benchmark
Angle Two, Leica Microsystems, Richmond, VA, USA), and an ophthalmic
ointment was applied to prevent drying of the eyes. The skull hair was
plucked, the surgical area was disinfected, and a small incision was made
to expose the skull. The skull was then opened over the appropriate
stereotaxic coordinates using a small-burr (0.45 mm) drill and a 30-gauge
blunt-end needle was inserted for injection. Following needle removal, the
skin was closed with wound clips. The mouse received 0.35 ml of warm
saline intraperitoneally and was observed until waking. Then he was
returned to the home cage and monitored carefully for the next 48 h.
Surgery was conducted in accordance with NIH Guidelines for rodent
survival following surgery.
Virus injections
Each mouse received pressure injections targeting six sites (three on each
side) of the dorsal hippocampus of either lenti-Avpr1b or lenti-GFP (KO
+Replace or KO+GFP, respectively) using a Hamilton syringe with a 30G
blunt-ended needle mounted on a stereotaxic device. The viral solutions
were stored at − 80 °C before being thawed on ice and backfilled into the
syringes. The six sites of injection (per mouse) were: injection sites 1 and 2
medial–lateral relative to the midline: ± 1.25 mm, anterior–posterior
relative to the bregma: − 1.22 and dorsal–ventral relative to the surface
of the brain: − 1.73 mm; sites 3 and 4 medial–lateral: ± 2.00, anterior–
posterior: − 1.70 and dorsal–ventral: − 1.83 mm; and sites 5 and 6
medial–lateral: ± 2.60, anterior–posterior: − 2.18 and dorsal–ventral:
− 2.15 mm. The injection volume for each site was 400 nl delivered at
50 nl min
− 1
.
In situ hybridization histochemistry
After behavioral testing, mice were killed and the brains were collected
and frozen on dry ice. Viral expression of the Avpr1b in 16-μm thick
sections was determined by in situ hybridization histochemistry as
described previously.
7
Images were obtained using a Cyclone phosphor-
imaging system (PerkinElmer, Waltham, MA, USA) after 2–4 weeks of
exposure. When we examined the in situ hybridization histochemistry
results after the six bilateral lentiviral injections (three each side, each one
approximately 0.5 mm further posterior in A-P axis than the preceding one)
for Avpr1b, we saw a spread that appears rather planar extending about
0.3–0.6 mm varying from site to site and from animal to animal (Figure 1).
The CA2 region that expresses Avpr1b is in the dorsal (rostral third)
hippocampus and extends about 1.5 mm in the A-P axis.
7
So, with a width
of about 0.25 mm for CA2, except most anteriorly where it is wider before
CA1 appears, we estimate that even with the smaller injections as judged
by the in situ hybridization histochemistry, we covered 60% (0.9mm of
1.5 mm) of the CA2. With the larger injections, we approached 100%.
Aggression experiments
Aggression was conducted as previously reported by our lab.
9,28
All
experimental mice were singly housed for two weeks, with a cage change
1 week before the encounter with the intruder. Stimulus mice were group
housed and used for only a single encounter per day. No stimulus mouse
was used for more than two aggressive episodes. The encounter took
place in the experimental mouse’s (resident’s) home cage (32 × 17.5 ×
14 cm) with the wire rack for food and water removed. Encounters were
recorded under red lighting with a Panasonic HDC-TM700 camera
(Amazon.com) and later analyzed using the Observer XT software (version
10, Noldus Information Technology, Leesburg, VA, USA) on a Dell personal
computer.
Mice were brought into an anteroom and weighed just before lights out
(1700 h), and were then transported to the behavioral room and left to sit
for 1 h. A weight-matched intruder mouse was introduced into the
resident’s cage. If, after 5 min, no aggression occurred, the intruder was
removed and a latency of 300 s was recorded. Aggression was allowed to
continue for 2 min after its onset, which was defined by an attack. All
interactions were recorded and scored at a later time. The latency to
attack, attack duration, number of bites and number of tail rattles were
measured and analyzed.
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
2
Molecular Psychiatry (2014), 1 – 10 © 2014 Macmillan Publishers Limited

Anxiety-like behavioral tests
Anxiety-like behaviors were tested in an Elevated O Maze (EOM; San Diego
Instruments, San Diego, CA, USA) and an open field. All animals were
handled and tail-marked for identification the day before testing. Testing
took place in a dark room with the open areas of the maze illuminated to
120 lux at the maze surface with soft white light. Mice were moved into an
anteroom of the behavioral suite at 1700 h and tests began at 1800 h. Mice
were placed on the open arm of the EOM (inside wall of diameter 20 inches)
facing a closed arm and were allowed to explore the maze for 5 min.
The open field activity was measured as previously described.
32,34,35
On
the test day, mice were brought to the testing room at least 30 min after
lights off and allowed to sit in their cages for at least 30 min. Mice housed
in the same cage were tested simultaneously. The Plexiglas testing
apparatus had four identical arenas, which were 43 × 43 cm with two
opaque walls and two clear outer walls. This apparatus was placed in the
middle of the test room. The center was defined as the inner 32 × 32 cm
square. Each arena was evenly illuminated at 120–150 lux using white
incandescent lights. The chambers were cleaned with 70% ethanol 5 min
before each test session. Each mouse was placed in an open arena at the
outermost corner facing the center and allowed to explore for 10 min.
Mice were recorded using a ceiling-mounted camera connected to a
Dell computer running Ethovision software (Noldus Information Technol-
ogy). Trials began as soon as the experimenter left the room. The distance
traveled, and the duration and frequency of entry into the open arms or
center of the arena are reported. These mice were also tested for
aggression after the tests for anxiety-like behavior were run.
Electrophysiology
Slice preparation and recording techniques were described previ-
ously.
23,25,36
Hippocampal slices were prepared from mice (C57Bl/6J WT,
Avpr1b KO or Oxtr KO) or Sprague–Dawley rats (Charles River Laboratories,
Raleigh, NC, USA) of either sex. Under deep anesthesia with pentobarbital,
animals were decapitated and the brains rapidly removed. Coronal brain
slices (350 μm thick) containing the hippocampus were cut using a
vibrating blade microtome in ice-cold sucrose-substituted artificial
cerebrospinal fluid (ACSF) containing (in mM): 240 sucrose, 2.0 KCl, 2
MgCl
2
, 1 CaCl
2
, 1.25 NaH
2
PO
4
, 26 NaHCO
3
and 10 glucose that was
bubbled continuously with 95% O
2
/5% CO
2
to obtain a pH of 7.4. Freshly
cut slices were placed in a holding chamber with ACSF containing (in mM):
124 NaCl, 2.5 KCl, 2 MgCl
2
, 2 CaCl
2
, 1.25 NaH
2
PO
4
, 26 NaHCO
3
and 15
glucose and allowed to recover for at least 1 h. For electrophysiological
recordings, slices were then transferred to a recording chamber where
they were bathed continuously with ACSF at room temperature (~24 °C) at
a rate of 2 ml min
− 1
. Whole-cell recordings from CA1, CA2 or CA3 neurons
were made with patch pipettes (3–5MΩ) filled with solution containing (in
mM): 120 K-gluconate, 10 KCl, 3 MgCl
2
, 0.5 EGTA, 40 HEPES, 2 ATP, 0.3 GTP,
with pH adjusted to 7.2 with NaOH. Single test pulses were delivered via a
single cluster-style electrode placed in the stratum radiatum to stimulate
the Schaffer collaterals once every 15 s and evoke excitatory post synaptic
currents (EPSCs) in CA2 or CA1. In experiments that recorded from CA3
neurons, EPSCs were evoked by stimulation of the commissural and
associational CA3/CA3 fibers. Stimulation of the mossy fiber synapses was
avoided in recordings from both CA2 and CA3 neurons. Following at least
5 min of stable recordings of baseline EPSCs, one of two Avpr1b agonists
(10 n
M D3PVP; 50 nM d[Leu
4
,Lys
8
]-Avp) or Oxt agonists (1 μM Oxt or 100 nM
[Thr
4
,Gly
7
]-Oxt) were added to the bathing media for either 15 min or until
the end of the 30-min recording session. To assess agonist-induced
changes in presynaptic function, effects on paired-pulse facilitation for
[Thr
4
,Gly
7
]-Oxt and d[Leu
4
,Lys
8
]-Avp, two pulses were delivered 20, 40, 80,
100 or 200 ms apart, and the ratio of the amplitudes of the second
responses and the first responses calculated before and after drug
Figure 1. Aggressive behavior is rescued in Avpr1b KO mice following bilateral injections of a lentivirus expressing the mouse Avpr1b into
hippocampal area CA2. (a) The schematic diagrams on the left depict the mouse hippocampus at the three levels targeted for bilateral
lentiviral replacement (at coordinates 1.2 to 2.2 mm posterior to the bregma). Image plates are adapted from a brain atlas.
82
Images on the
right highlight the expression of Avpr1b in the hippocampus detected by in situ hybridization histochemistry in a representative WT mouse
(wild-type), a Avpr1b KO mouse injected with a GFP control lentivirus (KO+GFP), and a KO mouse injected with the Avpr1b lentivirus (KO
+Replace). Arrowheads indicate examples of high Avpr1b expression in the hippocampus (scale bar, 2 mm). (b) An expanded view of the
lentiviral expression from the boxed region in the image marked with a star in a is presented with the hippocampal cell layers superimposed.
Note that the high Avpr1b expression from the lentivirus localized bilaterally at the injection sites in area CA2. (c) Aggressive behavior was
restored in Avpr1b KO mice following bilateral injections of the Avpr1b lentivirus into the area CA2 (KO+Replace), but not in the mice injected
with a virus to express GFP (KO+GFP). Behavior data are from 16 WT mice, 13 KO mice injected with a lentivirus containing a cytomegalovirus
promoter-driven green fluorescent protein (CMV-GFP) construct (KO+GFP), and 19 KO mice injected with a lentivirus containing a construct
for the Avpr1b (KO+Replace). KO, knockout.
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
3
© 2014 Macmillan Publishers Limited Molecular Psychiatry (2014), 1 – 10

application. Action potential threshold was determined in current clamp
mode by depolarizing neurons and measuring the membrane potential at
which the first action potentials occurred (rheobase current). Input
resistance was calculated by measuring the amplitude of the steady-
state current evoked during a − 10 mV voltage step delivered 100 ms
before test stimulation. No significant changes were observed in paired-
pulse facilitation, action potential threshold or input resistance between
pre-drug baseline levels and those measured at 25–30 min post-drug. The
effects of pharmacological treatments were assessed on the amplitude of
averaged EPSCs obtained during 5-min epochs recorded before and
10 min after drug application (last 5 min of the experiment). Because the
CA3 is too close to CA2 to cut off without risking damage to the recording
area, all slices were kept intact. As a result, epileptiform activity was
observed in some of the experiments testing for the effect of bicuculline
(see Results below). These cases were excluded from the data set if the
activity interfered with accurate measurements of EPSCs (5 of the total 21).
Chemicals
All the chemicals were purchased from Tocris Bioscience (R&D Systems,
Minneapolis, MN, USA) except where indicated. D3PVP [deamino-Cys
1
, D-3-
(pyridyl)-Ala
2
, Arg
8
-Avp] and [dLeu
4
,Lys
8
]-Avp were used as selective
Avp1b receptor agonists. Oxt and [Thr
4
,Gly
7
]-Oxt (American Peptide,
Sunnyvale, CA, UAS) were used as agonists of the Oxtr. The following drugs
were used to interfere with known regulators of synaptic plasticity: BAPTA
[1,2-is(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid], a selective cal-
cium chelator; KN-62 [4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-
oxo-3-(4-phenyl-1 piperazinyl)propyl] phenyl isoquinolinesulfonic acid
ester], and KN-93 [N-[2-[[[3-(4-chlorophenyl)-2-propenyl]methylamino]
methyl]phenyl]-N-(2-hydroxyethyl)-4-methoxybenzenesulphonamide],
cell-permeable inhibitors of calcium/calmodulin-dependent protein kinase
II alpha (CaMKII); PKI [protein kinase A inhibitor fragment (6–22) amide], an
inhibitor of the catalytic subunit of cAMP-dependent protein kinases; D-(-)
-2-Amino-5-phosphonopentanoic acid (AP5), a competitive NMDA (N-
methyl-D-aspartic acid) receptor antagonist; and bicuculline, a competitive
antagonist of GABA
A
receptors. KN-92 [2-[N-(4-methoxybenzenesulfonyl)]
amino-N-(4-chlorocinnamyl)-N-methylbenzylamine, monohydrochloride] is
an inactive analog of KN-93 (Santa Cruz Biotechnology, Dallas, TX, USA).
Statistical analyses
For aggression studies, we compared the proportions of animals in each
group that exhibited aggressive behaviors, Fisher’s exact tests were used.
Normally distributed data from the EOM and open field tests were
analyzed with one-way ANOVAS (analyses of variance). For electrophysio-
logical studies, all data are expressed as the mean ± s.e.m. and are
normalized to baseline recordings for plotting. Changes in response
properties were assessed using paired samples t-tests.
RESULTS
We first sought to ascertain whether the restoration of Avpr1b to
only the CA2 could affect the aggression deficit that accompanies
the total and constitutive elimination of the Avpr1b in KO mice.
We studied three groups of mice: WTs and KOs targeted with
expression in the CA2 of either GFP (KO+GFP) or Avpr1b (KO
+Replace) using lentiviruses. Only the WT and KO+Replace mice
had Avpr1b expression in the CA2 (Figures 1a and b). Similar to
our previous findings with Avpr1b KO mice,
9
only one of 12 KO
mice that received GFP attacked the intruder compared with six of
16 Avpr1b replaced mice and nine of 16 WTs. The percentage of
mice attacking was analyzed using Fisher’s exact probability test.
Using two 2 × 2 matrices, we found a significant difference
between the WT and KO+GFP (Po 0.05), but no difference
between the WT and KO+Replace groups (P>0.05). This indicates
a successful restoration of the attack behavior in the mice with
Avpr1b replacement covering the CA2 (Figure 1c).
The groups differed in the latency to attack, which was analyzed
by a one-way ANOVA (202 ± 21, 284 ± 24 and 256 ± 21s for WT, KO
+GFP and KO+Replace, respectively; F(2,41) = 3.54, Po 0.05). Post
hoc testing with Tukey’s HSD test demonstrated that the WT
attacked significantly faster than the KO+GFP (P o 0.05) but the
KO+Replace group was not signi ficantly different from either WT
or KO+GFP groups (P>0.05). Thus the receptor replacement group
had an intermediate attack latency. We observed no significant
differences in attack durations (21.2 ± 4.0 vs 8.9 ± 4.9;
F(1,13) = 3.80, P = 0.073) or the number of attacks (7.1 ± 1.2 vs
3.5 ± 1.5; F(1,13) = 3.67, P = 0.074), but did see a difference in tail
rattles (7.1 ± 1.2 vs 2.8 ± 1.4; F(1,13) = 5.23, Po 0.05) for WT
compared with KO+Replace, respectively. (Because only a single
KO+GFP mouse attacked, this group could not be included in
these analyses.)
To ensure that the changes in aggression were not tied to
changes in anxiety-like behavior or that the Avpr1b expression did
not affect other behaviors, we tested a second group of mice on
the open field and EOM (see Supplementary Table 1). No differen-
ces in anxiety-like behavior were observed between groups.
Specifically, in the open field test, one-way ANOVAs revealed
no difference in locomotor activity (F(2,29) = 0.39, P = 0.68),
frequency of entries into the central area (F(2,29) = 0.11, P = 0.90)
or center durations (F(2,29) = 0.77, P = 0.47). Similarly, in the EOM,
no differences in locomotor activity (F(2,29) = 0.48, P = 0.62),
frequency of entries (F(2,29) = 0.42, P = 0.66) or duration in the
open arm (F(2,29) = 0.75, P = 0.48) were observed. The same
pattern of aggression as seen in the first cohort above was
observed in these mice tested after the anxiety-like behaviors
were measured.
After showing that partial Avpr1b replacement restores aggres-
sion, we examined whether Avp influenced synaptic or cellular
properties of CA2 pyramidal cells, where the receptor is highly
expressed (Figure 2a). Using whole cell recordings of rat CA2
pyramidal cells in vitro, we found that application of 50 n
M d[Leu
4
,
Lys
8
]-Avp (n =9) or 50nM D3PVP (n = 7) induced a significant
potentiation of EPSCs. Synaptic responses were facilitated to
194.2 ± 21.8% (t8 = 7.90, Po 0.001) and 153.0 ± 15.0% (t6 = 4.14,
Po 0.01) of the baseline amplitude, respectively (Figure 2b;
Supplementary Figure 3a). In addition, d[Leu
4
,Lys
8
]-Avp induced
a significant and lasting potentiation of EPSCs in area CA2 in slices
taken from adult animals (to 173.0 ± 29.4% of baseline; n =7;
t12 = 2.73, Po 0.05; Supplementary Figure 3b). Neither compound
was effective at inducing potentiation in CA1 neurons at these
concentrations (d[Leu
4
,Lys
8
]-Avp, 101.5 ± 13.8% of baseline, n =6;
D3PVP, 98.8 ± 11.2% of baseline, n = 5). Consistent with the
observation that (postsynaptic) CA2 pyramidal neurons express
the Avpr1b, but not the (presynaptic) CA3 neurons,
7
we found that
d[Leu
4
,Lys
8
]-Avp potentiated only the AMPA receptor-dependent
component of the EPSCs, but not the NMDA receptor-dependent
component (Figures 3a and b); the AMPA/NMDA ratio was larger
after peptide treatment, but was not significantly larger
(Figure 3c). Furthermore, we found no significant effect of d
[Leu
4
,Lys
8
]-Avp on paired-pulse facilitation, and there was a
consistent increase in the coefficient of variation (1/CV
2
) which
accompanied the agonist-induced potentiation of EPSCs (Figures
3d–f). The lack of an effect on paired-pulse facilitation and the
reduction in response-to-response variability (increase in 1/CV
2
)
suggests that d[Leu
4
,Lys
8
]-Avp is acting postsynaptically to
facilitate synaptic transmission in area CA2. We also found no
significant change in membrane properties, such as input
resistance (Supplementary Figures 4a and c) nor the number of
spikes fired in response to suprathreshold current injection
(Supplementary Figures 4a and b), nor any change in action
potential threshold or rheobase current (109.09 ± 11.24 and
114.55 ± 11.47 pA for baseline and during agonist, respectively;
n = 11). Together these results indicate that vasopressin modulates
synaptic strength in CA2 neurons and that CA2 may be unique
among hippocampal regions in that regard.
Oxytocin has received intensive study in humans for deficits in
social behavior, yet effects of the peptide on synaptic responses in
the hippocampus are subtle.
37
Given its similarity to the Avp
peptide, and that the Oxtr binding is highly enriched in the CA2
and CA3 regions of C57Bl/6J mice (Figure 2d)
38
we sought to
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
4
Molecular Psychiatry (2014), 1 – 10 © 2014 Macmillan Publishers Limited

compare the effects of Avp with Oxt in CA2. Consistent with the
Oxtr binding, we found that 100 n
M [Thr
4
,Gly
7
]-Oxt mimicked the
effects of Avp1b agonists in rat CA2 pyramidal neurons in that it
induced a robust potentiation of excitatory synaptic currents (to
196.3 ± 40.9% of baseline, n = 11, t10 = 2.42, Po 0.05; Figure 2e,
red circles). In addition, and again consistent with the distribution
of the receptor binding, this Oxtr agonist also induced synaptic
potentiation in CA3 neurons (to 207.7 ± 29.9%, n = 7, t6 = 4.11,
Po 0.01; Figure 2e, green triangles), but had no significant effect
on excitatory synaptic responses in CA1 at this concentration
(Figure 2e, blue squares, n = 8).
To determine definitively whether these agonists were acting
on the intended receptors, we performed similar experiments
using hippocampal slices prepared from Avpr1b and Oxtr KO mice
(Figures 2c and f). As we observed using rat tissue, the agonists
induced potentiation in CA2 neurons from wild-type mice (Avpr1b
agonist, to 160.0 ± 20.1% of baseline, n = 6, t5 = 3.14, Po 0.05,
Figure 2c; Oxtr agonist, to 168.6 ± 23.1% of baseline, n =7,
t6 = 3.20, Po 0.05, Figure 2f), but not in slices from the respective
KOs (Avpr1b KO, n = 7; Oxtr KO, n = 6). Likewise, the agonists were
still effective in the mice lacking the other receptor (Figures 2c
and f: Avpr1b agonist in Oxtr KO mice, EPSCs enhanced to
225.5 ± 49.7% of baseline, n = 4; Oxt agonist in Avpr1b KO mice,
EPSCs enhanced to 168.9 ± 24.6% of baseline, n = 11), further
indicating that these peptides were acting selectively at their
respective receptors.
Figure 2. Synaptic potentiation is induced by Avpr1b and Oxtr agonists in slices of rat and mouse hippocampus. (a)Reflecting the enrich-
ment of Avpr1b in CA2, (b)50n
M d[Leu
4
,Lys
8
]-Avp, a selective Avpr1b agonist, induced potentiation of EPSCs recorded in rat CA2
(red circles; n = 9) but not in CA1 (blue squares; n = 6). The duration of drug application is indicated by the black bar in this and subsequent
figures. Representative synaptic currents from time points before (1) and after (2) drug application are shown above the averaged results
for areas CA2 and CA1. (c) Similar effects were observed in CA2 neurons in slices from WT (gray squares; n = 6) and Oxtr KO (pink triangles;
n = 4) mice, but not in slices from Avpr1b KO mice (red circles; n = 7). Representative currents are shown above the group data at the
time points indicated by the numbers. Similar results were observed with 100 n
M of the Oxtr agonist [Thr
4
,Gly
7
]-Oxt (d–f). The high
levels of oxytocin receptor binding in areas CA2 and CA3 are depicted in the schematic diagram shown in d, and (e) synaptic potentiation
induced with the Oxtr agonist is observed in CA2 (pink circles; n = 11) and CA3 (green triangles; n = 7), but not CA1 (blue squares; n = 8).
Conventions in e and f are the same as in b and c.(f) In addition, potentiation induced with [Thr
4
,Gly
7
]-Oxt was also observed in slices
from WT mice (gray squares; n = 6) and Avpr1b KO mice (red circles; n = 11), but not in slices from Oxtr KO mice (pink triangles; n = 7).
KO, knockout; WT, wild-type.
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
5
© 2014 Macmillan Publishers Limited Molecular Psychiatry (2014), 1 – 10

Both Oxtr and Avpr1b signal through G-protein coupled receptors
(GPCRs ) of the G
q
type, which are coupled to phospholipase
C-dependent pathways that increase intracellular calcium levels
through inositol triphosphate.
39
It was not clear, however, how these
receptor agonists could cause any synaptic plasticity in CA2 given
that typical LTP is not observed there mainly due to robust calcium
handling processes.
24
Therefore, to better understand the mechan-
isms underlying Avpr1b- and Oxtr-induced synaptic potentiation, we
Figure 3. The potentiation of EPSCs in area CA2 induced by d[Leu
4
,Lys
8
]-Avp is mediated by a postsynaptic change in AMPA receptor function.
AMPA- and NMDA-mediated currents were recorded before and after bath application of 50nM d[Leu
4
,Lys
8
]-Avp and synaptic stimulation for
15 min. Sample currents in (a) show that the AMPA-mediated EPSC is enhanced following application of the agonist. (b) This is also reflected in
the group data by a significant increase in the AMPA-mediated EPSC (*P o 0.01), but not in the NMDA-mediated EPSC (NS, non-significant;
n = 12 each). (c) The AMPA/NMDA ratio was not significantly different. (d,e) The Avp1b agonist, d[Leu
4
,Lys
8
]-Avp, induces no significant
change in paired-pulse facilitation. Pairs of stimulation pulses were delivered to the SC input to CA2 separated by an inter-pulse interval of
100 ms. Although 50 n
M d[Leu
4
,Lys
8
]-Avp enhanced the amplitude of synaptic currents in CA2, there was no change in paired-pulse
facilitation; scaled example currents from a representative experiment are shown in d and group data are shown in e; n = 6 each. (f)In
addition, response-to-response variability in the amplitude of EPSCs was reduced following application of the Avpr1b agonist as indicated by
an increase in the coefficient of variation (1/CV
2
)(n = 9 each). AMPA, α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid; EPSC, excitatory
post synaptic current; NMDA, N-methyl-D-aspartic acid.
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
6
Molecular Psychiatry (2014), 1 – 10 © 2014 Macmillan Publishers Limited

investigated whether known pharmacological blockers of synaptic
plasticity could inhibit these phenomena.
We found that the potentiating effect induced by Avpr1b and
Oxtr agonists strongly resembled LTP mechanistically (Figure 4a;
Supplementary Figure 5a): effects of both drugs were blocked by
an inhibitor of NMDA receptors (50 μ
M AP5; n = 9 and n =6,
respectively) and appeared to require synaptic stimulation (both
n = 7), with likely release of glutamate, during the drug application
(Figure 4b; Supplementary Figure 5b). Furthermore, the poten-
tiating effects required postsynaptic calcium (15 m
M BAPTA in
pipette; both n = 5) and activity of the calcium- and calmodulin-
dependent kinase CaMKII (10 μ
M KN-62 in pipette; n = 7 and n = 10,
respectively; Figure 4c, Supplementary Figure 5c; and 1 μ
M KN-93
but not 10 μ
M KN-92, n = 6 and n = 7, respectively; Figure 4d).
Unlike the potentiating effects of adenosine receptor antagonists
like caffeine,
36
however, the Avpr1b and Oxtr agonist effects were
unaffected by an inhibitor of the cAMP-dependent protein kinase,
protein kinase A (20 μM PKI in pipette plus Avpr1b agonist, to
203.3 ± 27.6% of baseline, n = 8, t7 = 2.72, Po 0.05, Figure 4e; plus
Oxtr agonist, to 232.2 ± 42.7% of baseline, n = 9, t8 = 4.76, Po 0.01,
Supplementary Figure 5d). Moreover, the effects of the Avpr1b
agonist did not appear to be working through or require GABA
A
receptors in that the potentiation was still observed when GABA
A
receptors were blocked with 10 μM bicuculline (Figure 4f) and that
the Avpr1b agonist had no significant effect on isolated inhibitory
postsynaptic currents (IPSCs; Supplementary Figure 3c). We
therefore conclude that Avpr1b and Oxtr activation allows for an
LTP-like enhancement of excitatory synaptic currents to be
induced simply with baseline frequencies of stimulation (one test
pulse delivered every 15 s).
Figure 4. Avpr1b agonist-induced synaptic potentiation in CA2 is calcium dependent. (a) Proposed mechanism of Avpr1b-induced
potentiation based on the idea that Avpr1b is coupled to Gq proteins and phospholipase C-dependent calcium increases. This mechanism is
in contrast to the potentiation induced with antagonists of the CA2-enriched A1 adenosine receptor, which acts through a PKA-dependent
pathway. (b) Avpr1b agonist-induced potentiation is blocked by the application of 50 μ
M AP5, an inhibitor of NMDA receptors (blue circles;
n = 9) or by temporarily pausing stimulation during drug application (black triangles; n = 7), indicating that synaptic glutamate release and
NMDA receptors are required for the potentiation. For reference in all the panels, the results of application of d[Leu
4
,Lys
8
]-Avp is indicated by
the gray squares (n = 9). (c) Similarly, loading cells with 15 m
M BAPTA, a high affinity calcium chelator, blocked the potentiation induced by
50 n
M d[Leu
4
,Lys
8
]-Avp (red triangles; n = 5), indicating that this potentiation is Ca
2+
dependent. In addition, 10 μM KN-62 (orange circles; n = 7)
and KN-93 (d; green triangles; n = 6), inhibitors of CaMKII, included in the recording pipette also inhibited the potentiation. However, KN-92, an
inactive analog of KN-93 (brown circles; n = 7), 20 μ
M PKI, an inhibitor of PKA, (magenta circles; n = 8, e), or bicuculline, an inhibitor of GABA
A
receptors (pink circles; n = 7, f), failed to block the potentiation. Representative traces are shown as insets at the times indicated by 1 and 2
(scale bars, 50 pA, 20 ms). BAPTA, 1,2-bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid; NMDA, N-methyl-D-aspartic acid; PKA, protein
kinase A.
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
7
© 2014 Macmillan Publishers Limited Molecular Psychiatry (2014), 1 – 10

DISCUSSION
The hippocampus has long been known to regulate aggression.
For example, removal of the cat hippocampus leads to a less
aggressive, ‘placid’ state.
40
Electrical stimulation of the cat dorsal
or ventral hippocampus fails to elicit predatory attacks on rats.
However, the latencies to hypothalamically-induced attacks are
increased or decreased after paired dorsal or ventral hippocampal
stimulations, respectively.
41,42
Conversely, dorsal or ventral hippo-
campal lesions in the cat causes reduced or increased aggression
from hypothalamic stimulations, respectively.
43
Large hippocam-
pal lesions in rats similarly reduce shock-induced intra-species
male aggression.
44,45
In addition to reducing male aggression,
these lesions also impair the development of social hierarchies in
mice.
46
Interestingly, in humans, a history of aggression in border-
line personality disorder is associated with reductions in
hippocampal volume.
47,48
Aggression often accompanies demen-
tia and so, not surprisingly, it is also correlated with increased
neurofibrillary tangles in the hippocampus.
49
These previous
studies considered the hippocampus a homogenous region, and
so specific roles for the CA1, CA2 and CA3 in aggression are not
clear. Therefore, as the CA3 and CA1 are primary inputs and
outputs of CA2, respectively, disruption of any of these areas
would be expected to disrupt the functional output of CA2.
Extensive studies from our group and others show that
vasopressin impacts aggression (see review Pagani et al.
50
). Most
previous studies suggest that Avp acts in limbic areas such as the
anterior hypothalamus, presumably through the Avpr1a, to
influence aggression.
51
The Avpr1a is found only at low levels, if
at all, throughout the rodent dorsal hippocampus, however.
38,52–56
Consistent with the deficits in the Avpr1b KO mice, systemic
administration of an Avpr1b antagonist reduces aggression in
hamsters
30
and mice,
57
further supporting a role for the Avpr1b in
aggression. Pharmacological blockade of Avpr1b has also been
shown to act as an anxiolytic when administered peripherally to
rats and mice,
58,59
but this seems to be dependent on pituitary
function.
60
Although differences in anxiety-like behavior can
greatly impact the probability of aggressive behavior,
29,61
Avpr1b
KO mice do not differ from wild-type mice when assessed for
anxiety-like behavior.
7
Vasopressin is present in the dorsal hippocampus,
62
but its
source to the CA2 area has been unclear. Albreck et al.
63
suggested that Avp, released from the terminals of axons
originating in the medial amygdala, diffuses to the dorsal
hippocampus. Recently, however, Avp projections from the
paraventricular nucleus of the hypothalamus of the mouse
64
and
rat
65
into the CA2 were discovered. The paraventricular nucleus
receives and responds to convergent physiological and psycho-
logical inputs
66
and is thus well positioned to exert an integrated
influence on CA2 neurons.
Avpr1b is enriched in the CA2, so we hypothesized that the
Avpr1b there is responsible for the profound deficit in social
aggression in the total KO.
9
Here we tested whether restoration of
receptor expression in CA2 alone was sufficient to restore a
cognitive function that was impaired in the total KO. If so, that
would rule out a critical role for the pituitary corticotrophs (where
this receptor was first discovered)
67
or the few cells elsewhere in
the central nervous system that express Avpr1b. Our results show
that expression of Avpr1b in the CA2 alone is sufficient to enable
the Avpr1b KO mouse to exhibit social aggression. Viral
replacement did not completely establish normal levels of
aggression, but we note that the injections, placed in six different
sites within the CA2, may not have covered the entire dorsal CA2.
Also, although we cannot rule out the possibility that the Avpr1b
in the CA2 has an important developmental (perhaps organiza-
tional) function in addition to its role in adults, our finding that
Avpr1b introduced later in adulthood can restore aggressive
behavior argues against a critical developmental role for Avpr1b in
the circuitry formation. Importantly, we confirmed that the
increased aggressive behavior seen in KO+Replace mice was not
caused by a change in an anxiety-like phenotype. Furthermore,
social memory is reduced in the Avpr1b KO
9
and following chronic
inhibition of CA2 synaptic transmission.
27
These findings support
the idea that social recognition, as mediated by the Avpr1b in he
CA2, is a cognitive ability critical for the expression of appropriate
social aggression. Interestingly, in humans, polymorphisms of the
Avpr1b are associated with childhood aggression,
68
autistic
traits
69
and a protective effect against recurrent major
depression.
70
Also, CA2 non-pyramidal neurons in schizophrenics
seem to be preferentially lost
19
and pyramidal neurons in CA2 of
schizophrenics are smaller.
20
It is possible that the paranoia that
often accompanies this illness is produced by inappropriate
evaluation of the social situation resulting in an expectation of
impending aggression. Thus, the Avpr1b within the CA2 may be
involved in several psychiatric diseases with social components.
Further characterization of these polymorphisms with respect to
the protein function is clearly needed.
Findings have varied in the few studies examining the effects of
vasopressin on synaptic transmission in the hippocampus, with a
tendency toward excitation.
71–77
Most studies, however, did not
focus on the CA2 where the Avpr1b is most highly expressed.
Given that both the Avpr1b and Oxtr are linked to phospholipase
C and calcium increases,
39
and that LTP is calcium dependent,
78
we propose that Avp and Oxt dramatically decrease the threshold
for LTP in CA2 principle neurons. Our data showing that even
baseline frequencies of stimulation can induce potentiation during
agonist application, and that the potentiation is sensitive to NMDA
receptor blockers, a calcium chelator and CaMKII inhibitors
(Figure 4a), support this idea. As such, these results suggest that
the peptides could be more effective treatments in humans if
paired with specific behavioral interventions. Further, these
findings point to a mechanism for potentiation that is decidedly
different than that induced in CA2 by caffeine and other A1
adenosine receptor antagonists, which (a) relies on cAMP and
protein kinase A activity and (b) appears not to require synaptic
stimulation for its appearance.
36
Importantly, these data suggest
that the CA2 Schaffer collateral synapses are highly regulated by
neuromodulatory substances at concentrations that do little at
other hippocampal synapses.
Previously, we showed that Avpr1b KO mice have intact attack
motor skills when defending themselves or attacking prey
28
as
well as intact main olfaction and olfactory pathway activation,
9
despite reduced interest in social odors (presumably accessory
olfactory information).
79
Here, we find that the CA2 Avpr1b
receptor enables appropriate social aggression and significant
potentiation of CA2 synaptic responses. We suggest a model in
which social chemosensory information obtained by investigating
another mouse travels via components of the accessory olfactory
system to the entorhinal cortex and then onto the CA2 area of the
hippocampus (this model does not preclude the input of
additional information arriving from other areas such as the
supramammillary nucleus). Simultaneously, this social interaction
with the other mouse activates vasopressinergic neurons within
the hypothalamic paraventricular nucleus to release Avp in the
CA2. Avp activation of the Avpr1b then enhances synaptic
potentiation leading to association (or, subsequently, recall) of
social circumstances with specific odors. These social circum-
stances would include spatial context and behavior of the other
mouse. We speculate that this coincidental input arrives at
CA2 neurons that, in a fashion analogous to place cells in the
CA1 hippocampus, are social cells that will form associations
and respond to similar social situations. As opposed to place
cells in which olfactory cues may aid in their stabilization,
80,81
olfactory cues would be essential for the establishment of the social
‘space’ that the CA2 neurons encode. This framework should be
testable, for example, by measuring the activities of CA2 pyramidal
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
8
Molecular Psychiatry (2014), 1 – 10 © 2014 Macmillan Publishers Limited

neurons in freely behaving mice exposed to various and repeated
social situations. Future studies of the CA2, including investiga-
tions of the role of the Avpr1b there, should provide exciting
new insights into how such a small region may have profound
influences on social behavior.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
ACKNOWLEDGMENTS
We would like to thank Emily Shepard and June Song for their technical assistance as
well as the NIMH Animal Program and NIEHS Comparative Medicine Branch. This
research was supported by the Intramural Research Program of the National
Institutes of Health, National Institute of Mental Health (Z01-MH-002498-24) and
National Institute of Environmental Health Sciences (Z01-ES-100221).
REFERENCES
1 Bosch OJ. Maternal aggression in rodents: brain oxytocin and vasopressin
mediate pup defence. Philos Trans R Soc Lond B Biol Sci 2013; 368: 20130085.
2 Takahashi A, Miczek KA. Neurogenetics of aggressive behavior: studies in rodents.
Curr Top Behav Neurosci advance online publication, 7 December 2013 (e-pub
ahead of print).
3 Meyer-Lindenberg A, Domes G, Kirsch P, Heinrichs M. Oxytocin and vasopressin in
the human brain: social neuropeptides for translational medicine. Nat Rev Neu-
rosci 2011; 12: 524–538.
4 Loup F, Tribollet E, Dubois-Dauphin M, Pizzolato G, Dreifuss JJ. Localization of
oxytocin binding sites in the human brainstem and upper spinal cord: an
autoradiographic study. Brain Res 1989; 500: 223–230.
5 Loup F, Tribollet E, Dubois-Dauphin M, Dreifuss JJ. Localization of high-affinity
binding sites for oxytocin and vasopressin in the huma n brain. An
autoradiographic study. Brain Res 1991; 555: 220–232.
6 Ostrowski NL, Lolait SJ, Young WS 3rd. Cellular localization of vasopressin V1a
receptor messenger ribonucleic acid in adult male rat brain, pineal, and brain
vasculature. Endocrinology 1994; 135: 1511–1528.
7 Young WS, Li J, Wersinger SR, Palkovits M. The vasopressin 1b receptor is pro-
minent in the hippocampal area CA2 where it is unaffected by restraint stress or
adrenalectomy. Neuroscience 2006; 143: 1031–1039.
8 Caldwell HK, Lee HJ, Macbeth AH, Young WS 3rd. Vasopressin: behavioral roles of
an ‘original’ neuropeptide. Prog Neurobiol 2008; 84:1–24.
9 Wersinger SR, Ginns EI, O'Carroll AM, Lolait SJ, Young WS 3rd. Vasopressin V1b
receptor knockout reduces aggressive behavior in male mice. Mol Psychiatry 2002;
7: 975–984.
10 Lorente de Nó R. Studies on the structure of the cerebral cortex. II. Continuation of
the study of the ammonic system. J Psychol Neurol (Leipzig) 1934; 46:113–177.
11 Jones MW, McHugh TJ. Updating hippocampal representations: CA2 joins the
circuit. Trends Neurosci 2011; 34: 526–535.
12 Piskorowski RA, Chevaleyre V. Synap tic integration by different dendritic com-
partments of hippocampal CA1 and CA2 pyramidal neurons. Cell Mol Life Sci 2012;
69:75–88.
13 Dam AM. Epilepsy and neuron loss in the hippocampus. Epilepsia 1980; 21
:
617–629.
14 Williamson A, Spencer DD. Electrophysiological characterization of CA2 pyramidal
cells from epileptic humans. Hippocampus 1994; 4:226–237.
15 Honkaniemi J, Sharp FR. Prolonged expression of zinc finger immediate-early
gene mRNAs and decreased protein synthesis following kainic acid induced
seizures. Eur J Neurosci 1999; 11:10–17.
16 Sperk G. Kainic acid seizures in the rat. Prog Neurobiol 1994; 42:1–32.
17 Brierley, JB Graha m, DI. Hypoxia and vascular disorders of the central
nervous system. Greenfield's Neuropathology. 4th edn. John Wiley & Sons: New
York, NY, USA, 1984, p 137.
18 Meldrum, BS Corsellis, JAN. Epilepsy. Greenfield's Neuropathology. 4th edn. John
Wiley & Sons: New York, NY, USA, 1984, pp 928–929.
19 Benes FM, Kwok EW, Vincent SL, Todtenkopf MS. A reduction of nonpyramidal
cells in sector CA2 of schizophrenics and manic depressives. Biol Psychiatry 1998;
44:88–97.
20 Benes FM, Sorensen I, Bird ED. Reduced neuronal size in posterior hippocampus
of schizophrenic patients. Schizophr Bull 1991; 17: 597–608.
21 Lein E, Zhao X, Gage F. Defining a molecular atlas of the hippocampus using DNA
microarrays and high-throughput in situ hybridization. J Neurosci 2004; 24:
3879–3889.
22 Lein E, Callaway E, Albright T, Gage F. Redefining the boundaries of the hippo-
campal CA2 subfield in the mouse using gene expression and 3-dimensional
reconstruction. J Comp Neurol 2005; 485:1–10.
23 Zhao M, Choi YS, Obrietan K, Dudek SM. Synaptic plasticity (and the lack thereof)
in hippocampal CA2 neurons. J Neurosci 2007; 27: 12025–12032.
24 Simons SB, Escobedo Y, Yasuda R, Dudek SM. Regional differences in hippo-
campal calcium handling provide a cellular mechanism for limiting plasticity. Proc
Natl Acad Sci USA 2009; 106: 14080–14084.
25 Lee SE, Simons SB, Heldt SA, Zhao M, Schroeder JP, Vellano CP et al. RGS14 is a
natural suppressor of both synaptic plasticity in CA2 neurons and hippocampal-
based learning and memory. Proc Natl Acad Sci USA 2010; 107: 16994–16998.
26 Wersinger SR, Temple JL, Caldwell HK, Young WS 3rd. Inactivation of the oxytocin
and the vasopressin (Avp) 1b receptor genes, but not the Avp 1a receptor
gene, differentially impairs the Bruce effect in laboratory mice (Mus musculus).
Endocrinology 2008; 149:116–121.
27 Hitti FL, Siegelbaum SA. The hippocampal CA2 region is essential for
social memory. Nature 2014; 508:88–92.
28 Wersinger SR, Caldwell HK, Christiansen M, Young WS 3rd. Disruption of the
vasopressin 1b receptor gene impairs the attack component of aggressive
behavior in mice. Genes Brain Behav 2007; 6: 653–660.
29 Neumann ID, Veenema AH, Beiderb eck DI. Aggression and anxiety: social context
and neurobiological links. Front Behav Neurosci 2010; 4:12.
30 Blanchard RJ, Griebel G, Farrokhi C, Markham C, Yang M, Blanchard DC. AVP V1b
selective antagonist SSR149415 blocks aggressive behaviors in hamsters. Phar-
macol Biochem Behav 2005; 80:189–194.
31 Serradeil-Le Gal C, Wagnon J, Tonnerre B, Roux R, Garcia G, Griebel G et al. An
overview of SSR149415, a selective nonpeptide vasopressin V(1b) receptor
antagonist for the treatment of stress-related disorders. CNS Drug Rev 2005; 11:
53–68.
32 Lee HJ, Caldwell HK, Macbeth AH, Tolu SG, Young WS 3rd. A conditional knockout
mouse line of the oxytocin receptor. Endocrinology 2008; 149: 3256–3263.
33 Dull T, Zufferey R, Kelly M, Mandel R, Nguyen M, Trono D et al. A third-generation
lentivirus vector with a conditional packaging system. J Virol 1998; 72: 8463–8471.
34 Caldwell HK, Stewart J, Wiedholz LM, Millstein RA, Iacangelo A, Holmes A et al. The
acute intoxicating effects of ethanol are not dependent on the vasopressin 1a or
1b receptors. Neuropeptides 2006; 40:325–337.
35 Wersinger SR, Caldwell HK, Martinez L, Gold P, Hu SB, Young WS 3rd. Vasopressin
1a receptor knockout mice have a subtle olfactory deficit but normal aggression.
Genes Brain Behav 2007; 6: 540–
551.
36 Simons SB, Caruana DA, Zhao M, Dudek SM. Caffeine-induced synaptic poten-
tiation in hippocampal CA2 neurons. Nat Neurosci 2012; 15:23–25.
37 Tomizawa K, Iga N, Lu YF, Moriwaki A, Matsushita M, Li ST et al. Oxytocin improves
long-lasting spatial memory during motherhood through MAP kinase cascade.
Nat Neurosci 2003; 6:384–390.
38 Pagani JH, Lee HJ, Young WS 3rd. Postweaning, forebrain-specific perturbation of
the oxytocin system impairs fear conditioning. Genes Brain Behav 2011; 10:
710–719.
39 Zingg HH. Vasopressin and oxytocin receptors. Baillieres Clin Endocrinol Metab
1996; 10:75–96.
40 Bard P, Mountcastle VB. Some forebrain mechanisms involved in expression of
rage with special reference to suppression of angry behavior. Res Publ Assoc Res
Nerv Ment Dis 1948; 27:362–404.
41 Siegel A, Flynn JP. Differential effects of electrical stimulation and lesions of the
hippocampus and adjacent regions upon attack behavior in cats. Brain Res 1968;
7:252–267.
42 Watson RE Jr, Edinger HM, Siegel A. An analysis of the mechanisms underlying
hippocampal control of hypothalamically-elicited aggression in the cat. Brain Res
1983; 269: 327–345.
43 Psatta DM. Emotional and other effects of hypothalamic stimulation oppositely
modified by dorsal and ventral hippocampus lesions. Neurol Psychiatr (Bucur)
1979; 17:121–131.
44 Kolb B, Nonneman AJ. Frontolimbic lesions and social behavior in the rat. Physiol
Behav 1974; 13: 637–643.
45 Eichelman BS Jr. Effect of subcortical lesions on shock-induced aggression in
the rat. J Comp Physiol Psychol 1971; 74: 331–339.
46 Ely D, Greene EG, Henry JP. Minicomputer monitored social behavior of mice with
hippocampus lesions. Behav Biol 1976; 16:1–29.
47 Zetzsche T, Preuss UW, Frodl T, Schmitt G, Seifert D, Munchhausen E et al. Hip-
pocampal volume reduction and history of aggressive behaviour in patients with
borderline personality disorder. Psychiatry Res 2007;
154: 157–170.
48 Sala M, Caverzasi E, Lazzaretti M, Morandotti N, De Vidovich G, Marraffini E et al.
Dorsolateral prefrontal cortex and hippocampus sustain impulsivity and aggres-
siveness in borderline personality disorder. J Affect Disord 2011; 131: 417–421.
49 Lai MK, Chen CP, Hope T, Esiri MM. Hippocampal neurofibrillary tangle changes
and aggressive behaviour in dementia. Neuroreport 2010; 21:1111–1115.
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
9
© 2014 Macmillan Publishers Limited Molecular Psychiatry (2014), 1 – 10

50 Pagani JH, Wersinger SR, Young WS 3rd. The Roles of vasopressin and oxytocin in
aggression. In: Choleris E, Pfaff DW, Kavaliers M (eds). Oxytocin, Vasopressin and
Related Peptides in the Regulation of Behavior. Cambridge University Press: Cam-
bridge, UK, 2012.
51 Ferris CF, Potegal M. Vasopressin receptor blockade in the anterior hypothalamus
suppresses aggression in hamsters. Physiol Behav 1988; 44:235–239.
52 Tribollet E, Barberis C, Dubois-Dauphin M, Dreifuss JJ. Localization and char-
acterization of binding sites for vasopressin and oxytocin in the brain of the
guinea pig. Brain Res 1992; 589:15–23.
53 Kremarik P, Freund-Mercier MJ, Stoeckel ME. Histoautoradiographic detection of
oxytocin- and vasopressin-binding sites in the telenc ephalon of the rat. J Comp
Neurol 1993; 333: 343–359.
54 Johnson AE, Audigier S, Rossi F, Jard S, Tribollet E, Barberis C. Localization and
characterization of vasopressin binding sites in the rat brain using an iodinated
linear AVP antagonist. Brain Res 1993; 622:9–16.
55 Insel TR, Wang ZX, Ferris CF. Patterns of brain vasopressin receptor distribution
associated with social organization in microtine rodents. J Neurosci 1994; 14:
5381–5392.
56 Insel TR, Gelhard R, Shapiro LE. The comparative distribution of forebrain recep-
tors for neurohypophyseal peptides in monogamous and polygamous mice.
Neuroscience 1991; 43:623–630.
57 Griebel G, Simiand J, Stemmelin J, Gal CS, Steinberg R. The vasopressin V1b
receptor as a therapeutic target in stress-related disorders. Curr Drug Targets CNS
Neurol Disord 2003; 2:191–200.
58 Hodgson RA, Higgins GA, Guthrie DH, Lu SX, Pond AJ, Mullins DE et al. Com-
parison of the V1b antagonist, SSR149415, and the CRF1 antagonist, CP-154,526,
in rodent models of anxiety and depression. Pharmacol Biochem Behav 2007; 86:
431–440.
59 Amikishieva AV, Ilnitskaya SI, Nikolin VP, Popova NA. Effect of vasopressin V1b
receptor antagonist, SSR149415, on anxiety-like behavior and Lewis lung carci-
noma metastasis in mice. Exp Oncol 2011; 33: 126–129.
60 Shimazaki T, Iijima M, Chaki S. The pituitary mediates the anxiolytic-like effects of
the vasopressin V1B receptor antagonist, SSR149415, in a social interaction test
in rats. Eur J Pharmacol 2006; 543:63–67.
61 Nehrenberg DL, Rodriguiz RM, Cyr M, Zhang X, Lauder JM, Gariepy JL et al. An
anxiety-like phenotype in mice selectively bred for aggression. Behav Brain Res
2009; 201: 179–
191.
62 Landgraf R, Neumann I, Pittman QJ. Septal and hippocampal release of vaso-
pressin and oxytocin during late pregnancy and parturition in the rat. Neu-
roendocrinology 1991; 54: 378–383.
63 Albeck D, Bullock N, Marrs K, Cooper R, Smock T, De Vries GJ. Antidromic acti-
vation of a peptidergic pathway in the limbic system of the male rat. Brain Res
1993; 606: 171–174.
64 Cui Z, Gerfen CR, Young WS 3rd. Hypothalamic and other connections with the
dorsal CA2 area of the mouse hippocampus. J Comp Neurol 2013; 521: 1844–1866.
65 Zhang L, Hernandez VS. Synaptic innervation to rat hippocampus by vasopressin-
immuno-positive fibres from the hypothalamic supraoptic and paraventricular
nuclei. Neuroscience 2013; 228: 139–162.
66 Hazell GG, Hindmarch CC, Pope GR, Roper JA, Lightman SL, Murphy D et al. G
protein-coupled receptors in the hypothalamic paraventricular and supraoptic
nuclei--serpentine gateways to neuroendocrine homeostasis. Front Neuroendo-
crinol 2012; 33 :45–66.
67 Antoni F, Holmes M, Makara G, Karteszi M, Laszlo F. Evidence that the effects of
arginine-8-vasopressin (AVP) on pituitary corticotropin (ACTH) release are medi-
ated by a novel type of receptor. Peptides 1984; 5: 519–522.
68 Zai CC, Muir KE, Nowrouzi B, Shaikh SA, Choi E, Berall L et al. Possible genetic
association between vasopressin receptor 1B and child aggression. Psychiatry Res
2012; 200:784–788.
69 Chakrabarti B, Dudbridge F, Kent L, Wheelwright S, Hill-Cawthorne G, Allison C
et al. Genes related to sex steroids, neural growth, and social-emotional behavior
are associated with autistic traits, empathy, and Asperger syndrome. Autism Res
2009; 2: 157 –177.
70 van West D, Del-Favero J, Aulchenko Y, Oswald P, Souery D, Forsgren T et al.
A major SNP haplotype of the arginine vasopressin 1B receptor protects against
recurrent major depression. Mol Psychiatry 2004; 9:287–292.
71 Mizuno Y, Oomura Y, Hori N, Carpenter DO. Action of vasopressin on CA1 pyr-
amidal neurons in rat hippocampal slices. Brain Res 1984; 309: 241–246.
72 Albeck D, Smock T, McMechen P, Purves D, Floyd L. Peptidergic transmission in
the brain. I. Vasopressin-like signal in the hippocampus. Brain Res 1990; 511:7–
14.
73 Chen C, Diaz Brinton RD, Shors TJ, Thompson RF. Vasopressin induction of long-
lasting potentiation of synaptic transmission in the dentate gyrus. Hippocampus
1993; 3: 193 –203.
74 Sakurai E, Maeda T, Kaneko S, Akaike A, Satoh M. Inhibition by [Arg8]-vasopressin
of long term potentiation in guinea pig hippocampal slice. Jpn J Pharmacol 1998;
77:103–105.
75 Chepkova AN, French P, De Wied D, Ontskul AH, Ramakers GM, Skrebitski VG et al.
Long-lasting enhancement of synaptic excitability of CA1/subiculu m neurons of
the rat ventral hippocampus by vasopressin and vasopressin(4-8). Brain Res 1995;
701:255–266.
76 Urban IJ. Effects of vasopressin and related peptides on neurons of the rat lateral
septum and ventral hippocampus. Prog Brain Res 1998; 119:285–310.
77 Chafai M, Corbani M, Guillon G, Desarmenien MG. Vasopressin inhibits LTP in the
CA2 mouse hippocampal area. PLoS One 2012; 7: e49708.
78 Lynch G, Larson J, Kelso S, Barrionuevo G, Schottler F. Intracellular injections of
EGTA block induction of hippocampal long-term potentiation. Nature 1983; 305:
719–721.
79 Wersinger SR, Kelliher KR, Zufall F, Lolait SJ, O'Carroll AM, Young WS 3rd.
Social motivation is reduced in vasopressin 1b receptor null mice despite
normal performance in an olfactory discrimination task. Horm Behav 2004; 46:
638–645.
80 Save E, Nerad L, Poucet B. Contribution of multiple sensory information to place
field stability in hippocampal place cells. Hippocampus 2000; 10:64–76.
81 Zhang S, Manahan-Vaughan D. Spatial Olfactory Learning Contributes to Place
Field Formation in the Hippocampus. Cereb Cortex 2013 (e-pub ahead of print).
82 Franklin, KBJ Paxinos, G. The Mouse Brain in Stereotaxic Coordinates. 3rd edn.
Academic Press: San Diego, CA, USA, 2007.
Supplementary Information accompanies the paper on the Molecular Psychiatry website (http://www.nature.com/mp)
Vasopressin 1b receptor function in the hippocampal CA2
JH Pagani et al
10
Molecular Psychiatry (2014), 1 – 10 © 2014 Macmillan Publishers Limited