No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Induction of Sp1 Phosphorylation and NF-κB-Independent HIV Promoter Domain Activity in T Lymphocytes Stimulated by Okadaic Acid
Abstract
In contrast to the purely enhancer-dependent effect of cytokines such as TNF on the activity of the HIV regulatory region (LTR), we observed that okadaic acid (OKA) activates HIV transcription through both the enhancer, responding to the factor NF-κB, and the promoter domain of the LTR. The inducibility of HIV LTR-driven luciferase expression constructs in lymphoblastoid cells stimulated by OKA depended on both functional Sp1 binding elements and the ability of the TATA box to bind the protein TBP. In both transformed and normal lymphocytes, OKA stimulation induced intense phosphorylation of the constitutively expressed Sp1 protein in the nucleus, a property of OKA not shared by TNF, phorbol ester, or PHA and interleukin 2. Responsiveness of LTR constructs deleted of κB elements to HIV Tat expression was increased upon OKA but not TNF stimulation. Our results suggest that SP1 phosphorylation induced by OKA, a selective inhibitor of the serine threonine phosphatase PP2A, facilitates the formation of a transcription complex involving general transcription factors, HIV Tat, and Sp1 proteins. The formation of this complex would increase, independently of an in synergy with NF-κB, the low basal activity of the HIV LTR observed in normal T lymphocytes.
... Immediate increases in the phosphorylated form of Sp1 (Sp1-P band, Fig. 2B) (18,31) were noted in confluent U1-Mel cells after IR, with peak levels appearing in 2 h. Scanning densitometry revealed that nearly 20% of the total Sp1 protein was phosphorylated (shifted upwards) in the nuclei of confluent U1-Mel cells after doses of IR between 300 and 600 cGy. ...
... Higher doses of IR (Ͼ750 cGy) resulted in very little phosphorylation of Sp1 (Fig. 2B) compared to basal control levels, consistent with a lack of Sp1 TF binding (Fig. 1B). These data are consistent with previous reports that phosphorylation of Sp1 increased its transcriptional activity (31,32). The phosphorylation status of pRb (Fig. 2C) was not altered after IR, and virtually all of the pRb protein present in the nucleus of quiescent U1-Mel cells was in the hypophosphorylation form. ...
... The phosphorylation status of pRb (Fig. 2C) was not altered after IR, and virtually all of the pRb protein present in the nucleus of quiescent U1-Mel cells was in the hypophosphorylation form. These data suggest that increases in Sp1 DNA binding in U1-Mel cells after IR may be causally related to increased Sp1 phosphorylation (31,32) and may regulate xips. Furthermore, coordinate increases in Sp1 and NF-B DNA binding may regulate gene expression in a manner similar to that proposed for HIV gene regulation (33). ...
Regulation of transcriptional responses in growth-arrested human cells under conditions that promote potentially lethal damage repair after ionizing radiation (IR) is poorly understood. Sp1/retinoblastoma control protein (RCP) DNA binding increased within 30 min and peaked at 2-4 h after IR (450-600 cGy) in confluent radioresistant human malignant melanoma (U1-Mel) cells. Increased phosphorylation of Sp1 directly corresponded to Sp1/RCP binding and immediate-early gene induction, whereas pRb remained hypophosphorylated. Transfection of U1-Mel cells with the human papillomavirus E7 gene abrogated Sp1/RCP induction and G0/G1 cell cycle checkpoint arrest responses, increased apoptosis and radiosensitivity, and augmented genetic instability (i.e., increased polyploidy cells) after IR. Increased NF-κB DNA binding in U1-Mel cells after IR treatment lasted much longer (i.e., >20 h). U1-Mel cells overexpressing dominant-negative IκBα S32/36A mutant protein were significantly more resistant to IR exposure and retained both G2/M and G0/G1 cell cycle checkpoint responses without significant genetic instability (i.e., polyploid cell populations were not observed). Nuclear p53 protein levels and DNA binding activity increased only after high doses of IR (> 1200 cGy). Disruption of p53 responses in U1-Mel cells by E6 transfection also abrogated G0/G1 cell cycle checkpoint arrest responses and increased polyploidy after IR, but did not alter radiosensitivity. These data suggest that abrogation of individual components of this coordinate IR-activated transcription factor response may lead to divergent alterations in cell cycle checkpoints, genomic instability, apoptosis, and survival. Such coordinate transcription factor activation in human cancer cells is reminiscent of prokaryotic SOS responses, and further elucidation of these events should shed light on the initial molecular events in the chromosome instability phenotype.
... Besides SV40, human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) is one of the numerous viral promoters tightly regulated by Sp1 (22,23). Incubation of T lymphocytes with okadaic acid, an inhibitor of type 1 and 2A protein phosphatases (24), induces the phosphorylation of Sp1 and activation of Sp1-dependent HIV-1 gene transcription (25). Taken together, these findings prompted us to investigate whether interaction of small t with PP2A leads to up-regulation of Sp1 activity. ...
... Luciferase activity was measured in duplicate aliquots (20 l) of total cell extracts by measuring for 10 s the light emission in an Opticomp luminometer. CAT activity was measured 48 h post-transfection in 40 l of total cell extract following exactly the procedures described previously (25). The luciferase and CAT activities were normalized to the protein concentration determined in the same sample using a Bio-Rad protein assay. ...
... The transfected cells were serum-starved, after which total extracts were prepared and assayed for luciferase or CAT activity. As shown in Fig. 1A, expression of wild-type small t resulted in a ϳ7-fold increase in the activity of HIVS(Ϫ84)luc, a luciferase reporter construct under the control of a mutant of HIV-1 LTR deleted from all sequences upstream of three Sp1 sites (25). The effects of wild-type small t could be mimicked by incubating control cells with the PP2A inhibitor okadaic acid, which produced a ϳ12-fold induction of luciferase activity. ...
The transcription factor Sp1 regulates the activity of a large number of eukaryotic gene promoters, including early SV40 and
human immunodeficiency virus type 1 (HIV-1). Here, we report that expression of SV40 small tumor antigen (small t) in quiescent
CV-1 cells transactivates two Sp1-responsive promoters, including a deletion mutant of HIV-1 LTR, through specific inhibition
of endogenous AC and ABαC forms of protein phosphatase 2A (PP2A). Expression of a small t mutant, lacking the PP2A-binding
domain, failed to transactivate Sp1. Overexpression of the B56α, B56β, and B56γ1 regulatory PP2A subunits strongly inhibited
the ability of small t, but not the phosphatase inhibitor, okadaic acid, to enhance Sp1-driven gene expression. Using inhibitors
and co-expression of kinase-deficient mutants, we also show that functional phosphatidylinositol 3-kinase (PI 3-kinase) and
atypical protein kinase C ζ are required for small t-induced Sp1-dependent promoter transcriptional activation. Moreover,
two inhibitors of PI 3-kinase, wortmannin and LY294002, inhibit the initiation of SV40 DNA replication in quiescent CV-1 cells.
Taken together, these results suggest that PP2A and PI 3-kinase contribute to the ability of small t to regulate Sp1 activity,
stimulate early SV40 DNA replication, and enhance the transformation of resting cells during SV40 infection.
... [25] The following studies have proved that JNK plays an important role in the post-translational modification of Sp1: JNK activation is necessary to phosphorylate Sp1, [19,23,24] and to shield Sp1 from the ubiquitin-dependent degradation pathway; [19] knockdown or inhibition of JNK induced dephosphorylation resulted in the ubiquitination and degradation of Sp1; [19][20][21][22][23] phosphorylation of Sp1 by JNK was found to promote DNA binding [34] and transcription in some studies, [24,35] but repress DNA binding [23] in other studies. Interestingly, okadaic acid (OA) was found to increase the level of Sp1 phosphorylation [36][37][38] and prevent Sp1 degradation in a JNK dependent way; [39] in addition, OA induced phosphorylation of Sp1 either promotes [38,40] or represses [36] DNA binding, depending on the stimulation and target DNA. These data suggest that the post-translational modification of Sp1 may be involved in the transcriptional repression of CDK1 upon treatment with PP2A inhibitors. ...
... [25] The following studies have proved that JNK plays an important role in the post-translational modification of Sp1: JNK activation is necessary to phosphorylate Sp1, [19,23,24] and to shield Sp1 from the ubiquitin-dependent degradation pathway; [19] knockdown or inhibition of JNK induced dephosphorylation resulted in the ubiquitination and degradation of Sp1; [19][20][21][22][23] phosphorylation of Sp1 by JNK was found to promote DNA binding [34] and transcription in some studies, [24,35] but repress DNA binding [23] in other studies. Interestingly, okadaic acid (OA) was found to increase the level of Sp1 phosphorylation [36][37][38] and prevent Sp1 degradation in a JNK dependent way; [39] in addition, OA induced phosphorylation of Sp1 either promotes [38,40] or represses [36] DNA binding, depending on the stimulation and target DNA. These data suggest that the post-translational modification of Sp1 may be involved in the transcriptional repression of CDK1 upon treatment with PP2A inhibitors. ...
Protein phosphatase 2A (PP2A) plays an important role in the control of the cell cycle. We previously reported that the PP2A inhibitors, cantharidin and okadaic acid (OA), efficiently repressed the growth of cancer cells. In the present study, we found that PP2A inhibitors arrested the cell cycle at the G2 phase through a mechanism that was dependent on the JNK pathway. Microarrays further showed that PP2A inhibitors induced expression changes in multiple genes that participate in cell cycle transition. To verify whether these expression changes were executed in a PP2A-dependent manner, we targeted the PP2A catalytic subunit (PP2Ac) using siRNA and evaluated gene expression with a microarray. After the cross comparison of these microarray data, we identified that CDK1 was potentially the same target when treated with either PP2A inhibitors or PP2Ac siRNA. In addition, we found that the down-regulation of CDK1 occurred in a JNK-dependent manner. Luciferase reporter gene assays demonstrated that repression of the transcription of CDK1 was executed through the JNK-dependent activation of the Sp1 transcription factor. By constructing deletion mutants of the CDK1 promoter and by using ChIP assays, we identified an element in the CDK1 promoter that responded to the JNK/Sp1 pathway after stimulation with PP2A inhibitors. Cantharidin and OA also up-regulated the expression of p21, an inhibitor of CDK1, via autophagy rather than PP2A/JNK pathway. Thus, this present study found that the PP2A/JNK/Sp1/CDK1 pathway and the autophagy/p21 pathway participated in G2/M cell cycle arrest triggered by PP2A inhibitors.
... The participation of phosphatase(s) in the activation of NF-B was previously provided by a study demonstrating that the Ser/Thr PTP inhibitor okadaic acid is also a potent activator of NF-B (49). Our results represent the first demonstration that specific inhibitors of PTP lead to NF-B activation via a site-specific serine phosphorylation of IB␣. ...
... The NF-B-independent pathway remains to be elucidated, but preliminary results from our laboratory suggest that this mode of activation is not exclusive to the HIV-1 LTR (data not shown). A similar bimodal NF-B-dependent and -independent type of HIV-1 LTR induction has also been reported with okadaic acid (49). It is interesting to note that this inhibitor acts on serine/ threonine phosphatases and might thus trigger a cascade similar, at some point, to that initiated by pV compounds. ...
Replication of human immunodeficiency virus type 1 (HIV-1) is increased by different cytokines and T cell activators, also known to modulate tyrosine phosphorylation levels. A novel class of protein tyrosine phosphatase (PTP) inhibitors, peroxovanadium (pV) compounds, were tested for a putative effect on HIV-1 long terminal repeat (LTR) activity. We found that these PTP inhibitors markedly enhanced HIV-1 LTR activity in 1G5 cells, a stably transfected cell line that harbors an HIV-1 LTR-driven luciferase construct. A direct correlation between the extent of tyrosine phosphorylation and the level of HIV-1 LTR inducibility was seen after treatment with three different pV compounds. Transient transfection experiments were carried out in several T cell lines, and after addition of pV, a marked increase in HIV-1 LTR activity was measured. Monocytoid cells were tested using U937-derived cell lines and were also found to be sensitive to the pV-mediated potentiating effect on HIV-1 LTR activity. A significant reduction of the pV-mediated increase in HIV-1 LTR activity was seen in cells transiently transfected with an HIV-1 LTR-driven luciferase construct bearing a mutation in both NF-kappaB binding sites although detectable levels of induction remained. Electrophoretic mobility shift assays allowed the identification of the nuclear translocation of the NF-kappaB p50.p65 heterodimer complex induced by pV compounds. A dominant negative version of the repressor IkappaBalpha mutated on serines 32 and 36 impeded pV-induced NF-kappaB-dependent luciferase activity. Western blot analysis showed a clear diminution in the protein level of IkappaBalpha starting 30 min after pV treatment of Jurkat E6.1 cells which is indicative of its degradation. On the other hand, no increase in tyrosine phosphorylation was observed on IkappaBalpha itself. Finally, we tested the PTP inhibitors on four cell lines latently infected with HIV-1 and showed a consistent pV-mediated increase in virion production. Thus, our studies suggest that pV-mediated activation of HIV-1 LTR activity is controlled by the nuclear translocation of the NF-kappaB transcription factor, which is mediated by IkappaBalpha serine phosphorylation and degradation, but also by a still undefined NF-kappaB-independent pathway.
... Mutations of these Sp1 sites affect both basal and Tat-induced LTR transcriptional activity (9). In addition, modulation of Sp1 phosphorylation by agents such as phosphatase inhibitors and by Tat-mediated recruitment of Sp1 to DNA-dependent protein kinase complex results in upregulated expression of the HIV-1 LTR (10,11). Other authors have demonstrated that interaction between NF-B and Sp1 mediates HIV-1 LTR activation (12,13). ...
... The Sp1-binding Sites of HIV-1 LTR Are Sufficient to Mediate the Synergistic Activation by HBx but They Are Not Necessary in the Presence of the B Enhancer-It has been reported that the HIV-1 LTR Sp1-binding sites are not only mere components of the basal transcription machinery but that they also mediate the up-regulation of the transcriptional activity by Tat and other stimuli (10,11). In addition, it has been shown that HBx induces the expression of insulin-like growth factor II (IGF-II) through Sp1-binding sites located in the proximal promoter region of the IGF-II-encoding gene (50). ...
Co-infection with hepatitis B virus (HBV) and human immunodeficiency virus type-1 (HIV-1) is relatively common. However, the
impact of this co-infection on the clinical outcome of HIV infection has not been elucidated. We herein demonstrate that the
HBV X protein (HBx) superinduces ongoing HIV-1 replication and HIV-1 long terminal repeat (LTR) transcription by synergizing
with Tat protein and with T-cell activation signals. Although HBx cooperated with mitogenic stimuli in the induction of reporter
plasmids harboring the HIV-1 κB enhancer, in both a NF-κB-dependent manner and a NF-AT-dependent manner, deletion of this
element from the LTR did not affect the HBx-mediated up-regulation in the presence of Tat and/or mitogens. In contrast, mutation
of the proximal LTR Sp1-binding sites abolished the HBx-mediated synergistic activation, but only when it was accompanied
by deletion of the κB enhancer. When HBx was targeted to the nucleus, its ability to synergize with cellular activation stimuli
was maintained. Furthermore, mutations of HBx affecting its interaction with the basal transcription machinery abrogated the
synergistic activation by HBx, suggesting that this protein exerts its function by acting as a nuclear co-activator. These
results indicate that HBx could contribute to a faster progression to AIDS in HBV-HIV co-infected individuals.
... The signaling mechanism for chemokines was by phosphorylation of protein tyrosine kinase. Tat, a protein inducer of many pro-inflammatory cytokines, activates viral replication by regulating transcriptional factors NF-κβ, NF-AT, Sp1, and C/EBPβ families (Ruocco et al. 1996;Vlach et al. 1995). Activation of NF-κβ by Tat protein is a prerequisite for PKR and the process occurs via IKK is active in the cells infected by HIV. ...
Cytokines are cell signaling polypeptides. They regulate and promote immune response, mostly related to autoimmunity. Role of cytokines in viral disease as cytokine biology in recent studies shows multifaceted interactions that are directly involved in the advancement of disease pathogenesis. Viruses induce the expression of numerous cytokine protein genes that are activated from the dormant state, and can also stimulate the expression or replication of extremely identical cytokines. Cytokines are also involved in treating viral diseases, especially human interferons. The ongoing developmental swift in the area of cytokines has led to the eventual growth of new antiviral therapeutic approaches rooted in mimicking the cytokine network. Some cytokines, especially IL-12 in combination with interferon γ, decrease the pathogenicity of viruses. Likewise, cytokines induce or increase the viral pathogenicity, for instance, Leishmania major, where IL-4 has a deleterious effect. This chapter details the salient features of cytokines, classification, inter-relation of cytokines- viral expression and signaling pathways of viruses inducing cytokines production.
... Ces résultats conduisent à proposer le modèle de régulation illustré sur lafigure 2. – Enfin, troisième mécanisme, les phosphatases PP2A interviennent dans la régulation de la transcription virale. Divers travaux fondés sur l'utilisation de l'AO et de l'antigène petit t de SV40 ont clairement établi que PP2A est un régulateur majeur de l'activité de plusieurs facteurs de transcription cellulaires (figure 3), dont NF-κΒ [17], et Sp1 [18], qui contrôlent l'expression de nombreux gènes viraux et la réplication de plusieurs virus. SV40 et d'autres papovae virus ont été particulièrement intéressants pour mieux comprendre l'importance de PP2A en virologie. ...
... In fact, some conjugation activity was observed with the full-length SUMO-1, but nents. Thus, ⌬B HIV-LTR can still be activated by okadaic acid (Vlach et al., 1995). Like the 3enh conA luc it is thought that this is due to the presence of a SUMO-1 C-terminal hydrolase in the column fractions, which reporter, the HIV LTR is activated by TNF (12-fold), IL-1 (35-fold), and okadaic acid (11-fold), and the activation cleaves the C terminus of SUMO-1 after G97 to generate the active form of the protein ( Figure 4A). is reduced by cotransfection of plasmids expressing IB␣ or SUMO-1. ...
... Also, phosphorylation of Sp1 was found to be necessary for its binding to the Sp1 binding element present in the ␣ 2 -integrin core promoter (44). Phosphorylation of Sp1 induced by okadaic acid is shown to facilitate the formation of basal transcription complex and induce expression of HIV LTR in T lymphocytes (45). Similar induction of Sp1 activity by okadaic acid was also observed in U937 leukemic cells (46). ...
The serum amyloid A (SAA) protein has been implicated in the progression and pathogenesis of rheumatoid arthritis through induction of collagenase activity in synovial fibroblast cells that line the joint tissues. We demonstrate that SAA is synergistically induced in synovial cells by interleukin (IL)-1 and IL-6 that are present at significantly high level in the synovial fluid of arthritis patients. These cytokines induced phenotypic changes in synovial cells, promoting protrusion and increased cellular contact. Induction of SAA under this condition is mediated by promoter elements located between −254 and −226, which contains binding sites for transcription factors Sp1 and SAA activating sequence binding factor (SAF). Mutation of these sequences abolishes SAA promoter response to IL-1 and IL-6. The role of Sp1 in SAA induction was demonstrated by increased DNA binding activity, phosphorylation, and increased protein content of Sp1 during cytokine treatment. Sp1 interacts with the SAA promoter in association with SAF as an SAF·Sp1 heteromeric complex. Furthermore, using a phosphatase inhibitor, we demonstrated increased transactivation potential of both Sp1 and SAF as a consequence of a phosphorylation event. These results provide first evidence for cytokine-mediated activation of Sp1 in synovial fibroblast cells and its participation in regulating SAA expression by acting in conjunction with SAF.
... In fact, some conjugation activity was observed with the full-length SUMO-1, but nents. Thus, ⌬B HIV-LTR can still be activated by okadaic acid (Vlach et al., 1995). Like the 3enh conA luc it is thought that this is due to the presence of a SUMO-1 C-terminal hydrolase in the column fractions, which reporter, the HIV LTR is activated by TNF (12-fold), IL-1 (35-fold), and okadaic acid (11-fold), and the activation cleaves the C terminus of SUMO-1 after G97 to generate the active form of the protein ( Figure 4A). is reduced by cotransfection of plasmids expressing IB␣ or SUMO-1. ...
Activation of NF-κB is achieved by ubiquitination and proteasome-mediated degradation of IκBα. We have detected modified IκBα, conjugated to the small ubiquitin-like protein SUMO-1, which is resistant to signal-induced degradation. In the presence of an E1 SUMO-1-activating enzyme, Ubch9 conjugated SUMO-1 to IκBα primarily on K21, which is also utilized for ubiquitin modification. Thus, SUMO-1-modified IκBα cannot be ubiquitinated and is resistant to proteasome-mediated degradation. As a result, overexpression of SUMO-1 inhibits signal-induced activation of NF-κB-dependent transcription. Unlike ubiquitin modification, which requires phosphorylation of S32 and S36, SUMO-1 modification of IκBα is inhibited by phosphorylation. Thus, while ubiquitination targets proteins for rapid degradation, SUMO-1 modification acts antagonistically to generate proteins resistant to degradation.
... The A subunit acts as a scaffold to which the B and catalytic C subunits bind. Many reports evidence that PP2A might play a role in regulating HIV-1 transcription and virus replication [28,69,85,87]. Ruediger et al. [69] demonstrated that increasing the ratio of PP2A core enzyme to holoenzyme resulted in a decrease in Tat-mediated HIV-1 transcription and virus production. ...
Astrocyte infection in HIV has been associated with rapid progression of dementia in a subset of HIV/AIDS patients. Astrogliosis and microglial activation are observed in areas of axonal and dendritic damage in HIVD. In HIV-infected astrocytes, the regulatory gene tat is over expressed and mRNA levels for Tat are elevated in brain extracts from individuals with HIV-1 dementia. Tat can be detected in HIV- infected astrocytes in vivo. The HIV-1 protein Tat transactivates viral and cellular gene expression, is actively secreted mainly from astrocytes, microglia and macrophages, into the extracellular environment, and is taken up by neighboring uninfected cells such as neurons. The HIV-1 protein Tat released from astrocytes reportedly produces trimming of neurites, mitochondrial dysfunction and cell death in neurons, while protecting its host, the astrocyte. We utilized proteomics to investigate protein expression changes in human astrocytes intracellularly expressing Tat (SVGA-Tat). By coupling 2D fingerprinting and identification of proteins by mass spectrometry, we identified phosphatase 2A, isocitrate dehydrogenase, nuclear ribonucleoprotein A1, Rho GDP dissociation inhibitor a, h-tubulin, crocalbin like protein/ calumenin, and vimentin/a-tubulin to have decreased protein expression levels in SVGA-Tat cells compared to the SVGA-pcDNA cells. Heat shock protein 70, heme oxygenase-1, and inducible nitric oxide synthase were found to have increased protein expression in SVGA-Tat cells compared to controls by slotblot technique. These findings are discussed with reference to astrocytes serving as a reservoir for the HIV virus and how Tat promotes survival of the astrocytic host. D 2004 Elsevier B.V. All rights reserved. Theme: Disorders of the nervous system Topic: Infectious Infectious diseases
... Our lack of complete understanding of P-TEFb regulation of HIV-1 transcription is reflected in the mixed results investigators have obtained in global inhibition of PP2A using pharmacological inhibitors like okadaic acid. Some studies have demonstrated induction of HIV-1 expression in chronically infected cell lines, whereas others have shown inhibition (Epie et al., 2006;Vlach et al., 1995). Thus, P-TEFb still presents itself as a promising target; a complete understanding of its role in HIV-1 transcription is required before it can be used as a targeted therapy. ...
Despite the success of highly active antiretroviral therapy in combating human immunodeficiency virus type 1 (HIV-1) infection, the virus still persists in viral reservoirs, often in a state of transcriptional silence. This review focuses on the HIV-1 protein and regulatory machinery and how expanding knowledge of the function of individual HIV-1-coded proteins has provided valuable insights into understanding HIV transcriptional regulation in selected susceptible cell types. Historically, Tat has been the most studied primary transactivator protein, but emerging knowledge of HIV-1 transcriptional regulation in cells of the monocyte-macrophage lineage has more recently established that a number of the HIV-1 accessory proteins like Vpr may directly or indirectly regulate the transcriptional process. The viral proteins Nef and matrix play important roles in modulating the cellular activation pathways to facilitate viral replication. These observations highlight the cross talk between the HIV-1 transcriptional machinery and cellular activation pathways. The review also discusses the proposed transcriptional regulation mechanisms that intersect with the pathways regulated by microRNAs and how development of the knowledge of chromatin biology has enhanced our understanding of key protein-protein and protein-DNA interactions that form the HIV-1 transcriptome. Finally, we discuss the potential pharmacological approaches to target viral persistence and enhance effective transcription to purge the virus in cellular reservoirs, especially within the central nervous system, and the novel therapeutics that are currently in various stages of development to achieve a much superior prognosis for the HIV-1-infected population.
... Exactly how these interactions are regulated and how they might relate to transcription have not been clearly defined. Potentially, phosphorylation plays a role in Sp1 activity since there is strong circumstantial evidence that phosphorylated Sp1 represents the active moiety in transcription (2,50,73,105). ...
We previously reported (K. T. Jeang, R. Chun, N. H. Lin, A. Gatignol, C. G. Glabe, and H. Fan, J. Virol. 67: 6224-6233, 1993) that human immunodeficiency virus type 1 (HIV-1) Tat and Sp1 form a protein-protein complex. Here, we have characterized the physical interaction and a functional consequence of Tat-Sp1 contact. Using in vitro protein chromatography, we mapped the region in Tat that contacts Sp1 to amino acids 30 to 55. We found that in cell-free reactions, Tat augmented double-stranded DNA-dependent protein kinase (DNA-PK)-mediated Sp1 phosphorylation in a contact-dependent manner. Tat mutants that do not bind Sp1 failed to influence phosphorylation of the latter. In complementary experiments, we also found that Tat forms protein-protein contacts with DNA-PK. We confirmed that in HeLa and Jurkat cells, Tat expression indeed increased the intracellular amount of phosphorylated Sp1 in a manner consistent with the results of cell-free assays. Furthermore, using two phosphatase inhibitors and a kinase inhibitor, we demonstrated a modulation of reporter gene expression as a consequence of changes in Sp1 phosphorylation. Taken together, these findings suggest that activity at the HIV-1 promoter is influenced by phosphorylation of Sp1 which is affected by Tat and DNA-PK.
... Presently, we do not know the reasons, nor the implications for this discrepancy, but in the study by Ammendola et al., the protein level (measured by Western blot analysis) was not affected by age, and full DNA binding activity could be restored upon addition of reducing agents (21). Additionally, as mentioned above for AP-1, the DNA binding activity of Sp-1 can be increased by phosphorylation (43,44), and the presence of a phosphatase inhibitor in our extracts may also have preserved a greater amount of this activity. ...
The process of aging is accompanied by many changes in gene expression, occurring in virtually all organs of the affected individual. Here we report on the relative changes in DNA binding activity of a panel of 15 different transcription factors in the liver of adult (15-month-old) and old (25-month-old) Sprague-Dawley rats. When expressed as a function of nuclear protein concentration, a great majority of the transcription factors analyzed do not show significant differences in DNA binding activities as a function of age, except activator protein 1 (AP-1) and nuclear factor-kappa B, both of which show increased activities in the older animals, and hepatocyte nuclear factor-3, which undergoes a switch from predominantly alpha and beta subspecies in the adults, to predominantly gamma subspecies in the old animals. Further examination of some of the members of the AP-1 complex using Western blot analysis indicates that the increase in binding activity of this particular complex might be due to an increase in the relative mass of Jun B, presumably resulting in a switch from predominantly c-Fos/Jun D in the young to c-Fos/Jun B complexes in the old animals. Nuclear extracts prepared from the liver of old animals yield less proteins per mass of DNA than similar extracts prepared from younger animals. Accordingly, if the data are analyzed as a function of genomic DNA, our results indicate that aging results in a consistent, but generally not statistically significant decrease in most transcription factor DNA binding activities, with AP-1, nuclear factor-kappa B, and transcription factor II D being the exception to this decline.
... PP1 and PP2A have been implicated in these processes. Global inhibition of PP2A by pharmacologic inhibitors such as okadaic acid has produced mixed results, inducing HIV-1 expression in some chronically infected cell lines while blunting its expression in others (141,142). More careful research is needed to fully understand how, when, and which phosphatase causes the activation of P-TEFb. ...
HIV-1 infection persists even after years of antiretroviral therapy (ART). Although ART can halt viral replication and thereby reduce viremia to clinically undetectable levels, proviral latency established within the host genome remains largely unaffected by ART and can replenish systemic infection following interruption of therapy. Pharmacologic strategies, which not only target viral replication but also deplete proviral infection, are required for successful clearance of HIV-1 infection. This review highlights the current understanding of molecular mechanisms that establish and maintain HIV-1 latency in its major reservoir, the resting memory CD4(+) T cell. We also identify the molecular targets that might be exploited to induce HIV-1 expression, remove epigenetic restrictions, or enhance effective transcription. Finally, we discuss the potential pharmacologic approaches toward targeting viral persistence in different cellular and anatomical reservoirs to achieve a cure of HIV-1 infection.
... There is evidence that phosphorylation of Sp1 can, in fact, alter its transcriptional activity. Okadaic acid stimulates the human immunodeficiency virus long terminal repeat through Sp1 sites, yet the binding characteristics of Sp1 to the promoter are unchanged (34). Using Western blotting, it was observed that okadaic acid treatment resulted in the complete conversion of Sp1 from the hypophosphorylated state (95 kDa) to the hyperphosphorylated state (105 kDa). ...
The GADD153 promoter is transcriptionally activated by paclitaxel-induced injury. Promoter deletion from −786 to −85 base pairs relative
to the start of transcription had no significant effect on activation, but deletion to the TATA box abolished it. Placement
of the 39 bases from −74 to the TATA box (cellular injury response element, CIRE) upstream of the adenovirus E4 TATA box conferred
paclitaxel inducibility. The only consensus sequence present in the CIRE is an Sp1 site; mutation of this site inhibited paclitaxel
activation. Paclitaxel failed to activate a SV40-driven luciferase construct containing five Sp1 sequences, and Sp1 sites
further upstream in the GADD153 promoter were not essential for activation. Pure Sp1 and nuclear extracts from uninjured and paclitaxel-injured cells protected
the same region from −62 to −48 bases on the noncoding strand and −74 to −53 on the coding strand. Nuclear extracts shifted
the CIRE to the same extent as purified Sp1 but had no effect on a CIRE with a mutated Sp1 site in gel shift assays. Immunodepletion
of Sp1 abolished the shift; antibody to Sp1 produced a supershift. These data indicate that paclitaxel activates the GADD153 promoter through a constitutively occupied Sp1 site at −61 bases.
... Duplication of NF-B binding sites can enhance both LTR-driven reporter gene activity and viral replication (11,25,31,36), whereas its deletion can impair viral replicative capacity in a variety of cell types such as peripheral blood mononuclear cells (PBMCs), CD4 lymphocytes, monocytic cell line U937, and lymphoblastoid T-cell lines CEM and 11.8 (1,12,14,21,23,35,42). In contrast, other reports have demonstrated that mutated HIV-1 missing one or both NF-B binding sites is still capable of efficient replication in stimulated PBMCs, although a 2-to 4-day delay in peak virus production was observed in CEM and MT-4 cells (11,25,36,40). Moreover, a prerequisite for HIV-1 with an NF-B binding site deleted to replicate is the presence of three Sp1 binding sites (25). ...
Multiple human immunodeficiency virus type 1 (HIV-1) sequences with deletions of NF-kappaB binding sites at both the 5' and 3' long terminal repeats (LTRs) were identified in serial samples collected from an infected individual. The effect of this deletion on the level of transcription was studied by transient transfection of an LTR-driven luciferase reporter gene and by infection with a full-length recombinant HIV-1 containing a luciferase reporter (HIVHXBluc). Detectable levels of gene expression were found in both systems, in the presence or absence of the viral transactivator Tat. Interestingly, a duplication of a putative TCF-1alpha motif was found in place of the NF-kappaB elements in these viruses. Higher transcriptional activity was observed with HXBLTR (NF-kappaB intact) than with the patient's LTR (NF-kappaB deleted), suggesting that the NF-kappaB binding sites may promote optimal levels of viral gene transcription. The ability of these viruses with NF-kappaB deleted to replicate and cause substantial decline in CD4 cell counts demonstrates that the NF-kappaB binding sites are not absolutely required for viral replication or pathogenicity in vivo. These results are consistent with the notion that the HIV-1 LTR possesses functional redundancy which allows it to interact with multiple transcription factors, thereby ensuring viral replication in a variety of cell types.
... A second cell division inhibitor (C di) gene, the p15I N K4B gene, the product of which inhibits C dk4 and C dk6, is activated by TGF via Sp1 sites . Although phosphorylation is implicated during regulation by other agents (Jackson et al., 1990;Vlach et al., 1995), the mechanism of control by NGF is not known. Either Sp1 itself or a factor that interacts f unctionally may be modified, and other transcription factors may also contribute. ...
The PC12 pheochromocytoma cell line responds to nerve growth factor (NGF) by gradually exiting from the cell cycle and differentiating to a sympathetic neuronal phenotype. We have shown previously () that NGF induces the expression of the p21 WAF1/CIP1/Sdi1 (p21) cyclin-dependent kinase (Cdk) inhibitor protein and the G1 phase cyclin, cyclin D1. In this report, we show that induction is at the level of transcription and that the DNA elements in both promoters that are required for NGF-specific induction are clusters of binding sites for the Sp1 transcription factor. NGF also induced a synthetic promoter with repeated Sp1 sites linked to a core promoter, and a plasmid regulated by a chimeric transactivator in which the Gal4 DNA binding domain is fused to the Sp1 transactivation domain, indicating that this transactivation domain is regulated by NGF. Epidermal growth factor, which is a weak mitogen for PC12, failed to induce any of these promoter constructs. We consider a model in which the PC12 cell cycle is arrested as p21 accumulates and attains inhibitory levels relative to Cdk/cyclin complexes. Sustained activation of p21 expression is proposed to be a distinguishing feature of the activity of NGF that contributes to PC12 growth arrest during differentiation
... In fact, some conjugation activity was observed with the full-length SUMO-1, but nents. Thus, ⌬B HIV-LTR can still be activated by okadaic acid (Vlach et al., 1995). Like the 3enh conA luc it is thought that this is due to the presence of a SUMO-1 C-terminal hydrolase in the column fractions, which reporter, the HIV LTR is activated by TNF (12-fold), IL-1 (35-fold), and okadaic acid (11-fold), and the activation cleaves the C terminus of SUMO-1 after G97 to generate the active form of the protein ( Figure 4A). is reduced by cotransfection of plasmids expressing IB␣ or SUMO-1. ...
Activation of NF-kappaB is achieved by ubiquitination and proteasome-mediated degradation of IkappaBalpha. We have detected modified IkappaBalpha, conjugated to the small ubiquitin-like protein SUMO-1, which is resistant to signal-induced degradation. In the presence of an E1 SUMO-1-activating enzyme, Ubch9 conjugated SUMO-1 to IkappaBalpha primarily on K21, which is also utilized for ubiquitin modification. Thus, SUMO-1-modified IkappaBalpha cannot be ubiquitinated and is resistant to proteasome-mediated degradation. As a result, overexpression of SUMO-1 inhibits signal-induced activation of NF-kappaB-dependent transcription. Unlike ubiquitin modification, which requires phosphorylation of S32 and S36, SUMO-1 modification of IkappaBalpha is inhibited by phosphorylation. Thus, while ubiquitination targets proteins for rapid degradation, SUMO-1 modification acts antagonistically to generate proteins resistant to degradation.
... Therefore, the bulk CTD phosphorylation promoted by these drugs may bypass the requirement in the viral protein Tat to recruit kinases to phosphorylate the CTD on the HIV LTR. Osmotic shock (64), UV irradiation (64), DNA damage (85), heat shock (68,86), okadaic acid treatment (67), and peroxovanadium compounds (69) have been shown to activate the HIV LTR transcription. Interestingly enough, osmotic shock, peroxovanadate, UV irradiation (data not shown), okadaic acid, and heat shock (8,80) all promote CTD phosphorylation in vivo. ...
Actinomycin D and alpha-amanitin are commonly used to inhibit transcription. Unexpectedly, however, the transcription of the human immunodeficiency virus (HIV-1) long terminal repeats (LTR) is shown to be activated at the level of elongation, in human and murine cells exposed to these drugs, whereas the Rous sarcoma virus LTR, the human cytomegalovirus immediate early gene (CMV), and the HSP70 promoters are repressed. Activation of the HIV LTR is independent of the NFkappaB and TAR sequences and coincides with an enhanced average phosphorylation of the C-terminal domain (CTD) from the largest subunit of RNA polymerase II. Both the HIV-1 LTR activation and the bulk CTD phosphorylation enhancement are prevented by several CTD kinase inhibitors, including 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole. The efficacies of the various compounds to block CTD phosphorylation and transcription in vivo correlate with their capacities to inhibit the CDK9/PITALRE kinase in vitro. Hence, the positive transcription elongation factor, P-TEFb, is likely to contribute to the average CTD phosphorylation in vivo and to the activation of the HIV-1 LTR induced by actinomycin D.
... Changes in phosphorylation status are observed for some of these proteins. For example, Sp1 DNA binding activity is decreased by phosphorylaton in a number of systems (94)(95)(96)(97)(98)(99). Sp1 is phosphorylated, and thus presumably inactivated by phosphorylation upon oocyte maturation, but an increase in hypophosphorylated Sp1 is observed between G1 and G2 of the 1-cell stage (91), and this pool of Sp1 may become activated later. ...
Genome activation is one of the first critical events in the life of the new organism. Both the timing of genome activation and the array of genes activated must be controlled correctly. Genome activation occurs in a stepwise manner, with some genes being transcribed well in advance of the major genome activation event, in which most housekeeping genes become activated. Changes in chromatin protein content, particularly histone proteins, and chromatin structure appear to regulate the availability of the genome for transcription and provide for specificity of transcription. Gene enhancers are not initially required for transcription, but become necessary as the chromatin structure is modified. Changes in transcription factor content or activity are also required, and protein synthesis is essential for genome activation during both early and later phases of transcriptional activation. Both the changes in chromatin structure and availability of transcription factors are regulated by cell cycle-dependent mechanisms, thus providing the necessary coordination between these processes and other processes such as DNA replication and cleavage.
... In terminally differentiated liver cells, casein kinase II phosphorylation was also found to cause a down-regulation of Sp1 activity (29). In contrast, inhibition of Sp1 dephosphorylation may underlie the mechanism of the human immunodeficiency virus gene expression (30). Interestingly, v-Raf-induced activation of the mdr1 and rep-3b gene promoters, which are serum-inducible, is Sp1-dependent (31). ...
We reported previously that nerve growth factor (NGF) up-regulates activity of the N-methyl-D-aspartate receptor 1 (NR1) promoter. We have explored the pathways and nuclear targets of NGF signaling in regulating the NR1 promoter. PD98059 and wortmannin, but not rapamycin, significantly attenuated NGF-induced transcriptional activity from an NR1 promoter-luciferase construct. Coexpressing constitutively active forms of Ras, Raf, or MAPK/ERK kinase 1 (MEK1) increased promoter activity dramatically. The MEK1-induced increase was largely prevented by mutations of the tandem GC boxes in the promoter. Promoter activity was also increased significantly by coexpressed GC box-binding proteins (Sp1, 3, or 4) in nonstimulated PC12 cells. Either an extracellular signal-regulated kinase-1 (ERK1)- or Sp1-specific antibody coprecipitated Sp1 with ERKs, and the coprecipitation was enhanced significantly by NGF treatment of PC12 cells. ERK2 also incorporated radioactivity of [gamma(32)P]ATP into recombinant Sp1. However, ERK2-treated Sp1 and PC12 nuclear extracts or nuclear extracts from NGF-treated cells exhibited reduced binding to the promoter or a consensus GC box. Our results suggest that NGF utilizes both the Ras/ERK and phosphatidylinositol 3-kinase pathways to up-regulate NR1 promoter activity and that Sp1 is a novel substrate of NGF-activated ERKs. NGF-increased NR1 promoter activity may involve a complicated mechanism of Sp1 phosphorylation and possible transcription factor exchange.
The solution structures of two DNA non-palindromic duplexes of 24 base pairs and corresponding to the 3′ NF-κB-binding site and the adjacent 5′ Sp1-binding site of the HIV-1 long terminal repeat (5′LTR) were analyzed by proton two-dimensional nuclear magnetic resonance spectroscopy. The first sequence d(GGGGACTTTCCAGGGAGGCGTGGC):d(GCCACGCCTCCCTGGAAAGTCCCC) corresponds to the wild-type LTR duplex (24mer-N), and the second sequence d(GCTCACTTTCCAGGGAGGCGTGGC): d(GCCACGCCTCCCTGGAAAGTGAGC) (24mer-M) contains a specific mutation (lightface letters) abolishing NF-κB binding. Assignment of protons essential for structure determination were obtained and structural features of both duplexes were analyzed. The overall structure of the duplex is of the B form but several significant local structural deviations were found. First, from analysis of NOE cross-peak intensities between adenine H2 base protons and sugar H1′ protons, it was found that the CTC mutation results in widening of the minor groove with presumably narrowing of the major groove, thus impairing the binding of NF-κB to its responsive element in the HIV LTR. Second from chemical shift analysis of H1′ sugar protons, some unusual structural features were found at the junction between the homopurine:homopyrimidine stretches, that is, at the junction of the NF-κB and Sp1 sites, consistent with the known synergism between NF-κB and Sp1 functions in the HIV LTR. The scopes and limitations of DNA fragment studies of such a size are discussed.
During the cartilage-to-bone transition, participating chondrocytes eventually undergo hypertrophy and are replaced by bone
and marrow. Type X collagen is synthesized by chondrocytes specifically when they become hypertrophic, and this specificity
is primarily regulated at the level of transcription. Previously, we demonstrated that a proximal promoter region from nucleotide
−562 to +86 contained cis-acting elements that directed high level expression of a reporter gene in a cell-specific manner (Long, F., and Linsenmayer,
T. F. (1995) J. Biol. Chem. 270, 31310–31314). In the present study, we have further dissected this region by generating a series of constructs and examining
their expression in hypertrophic versusnonhypertrophic chondrocytes. Several positive and negative elements have been delineated within the proximal promoter region
to mediate the regulation of transcription in hypertrophic chondrocytes. Most notably, a sequence from nucleotide −139 to
+5 was sufficient to direct high level expression in this cell type. Electrophoresis mobility shift assay and supershift experiments
identified within this sequence two 10-base pair noncanonical binding sites for Sp1 proteins. Mutations within the Sp1 binding
sites either diminished or abolished the expression driven by the sequence from −139 to +5. These results indicate that the
Sp1 proteins mediate the cell-specific expression of type X collagen.
Sp1 is a ubiquitously expressed transcription factor involved in the regulation of a large number of genes including housekeeping genes as well as actively regulated genes. Although Sp1 was discovered nearly three decades ago, its functional diversity is still not completely understood. One of the ways that make Sp1 versatile in transcriptional regulation is its post-transcriptional modification, which alters Sp1 structure in different cells and at different times. Compared to other types of modifications of the Sp1 protein, phosphorylation has been studied far more extensively. This review focuses on the inducers, pathways, enzymes, and biological effects of Sp1 phosphorylation. Recent data are beginning to reveal the biological significance and universal presence of Sp1 phosphorylation-related cell/molecular responses. Studies in this field provide a quick glance at how a simple chemical modification of a transcription factor could produce significant functional diversity of the protein.
Cells use phosphorylation/dephosphorylation mechanisms to regulate the activity of several proteins required to transmit information from the cell surface to the nucleus. Recent studies have significantly increased our knowledge regarding the structure/function of one major regulator of cell phosphorylation: protein phosphatase 2A (PP2A). This review will discuss the role of PP2A in virology and parasitology.
Human immunodeficiency virus type 1 (HIV-1) has been shown to replicate productively in cells of the monocyte-macrophage lineage, although replication occurs to a lesser extent than in infected T cells. As cells of the monocyte-macrophage lineage become differentiated and activated and subsequently travel to a variety of end organs, they become a source of infectious virus and secreted viral proteins and cellular products that likely initiate pathological consequences in a number of organ systems. During this process, alterations in a number of signaling pathways, including the level and functional properties of many cellular transcription factors, alter the course of HIV-1 long terminal repeat (LTR)-directed gene expression. This process ultimately results in events that contribute to the pathogenesis of HIV-1 infection. First, increased transcription leads to the upregulation of infectious virus production, and the increased production of viral proteins (gp120, Tat, Nef, and Vpr), which have additional activities as extracellular proteins. Increased viral production and the presence of toxic proteins lead to enhanced deregulation of cellular functions increasing the production of toxic cellular proteins and metabolites and the resulting organ-specific pathologic consequences such as neuroAIDS. This article reviews the structural and functional features of the cis-acting elements upstream and downstream of the transcriptional start site in the retroviral LTR. It also includes a discussion of the regulation of the retroviral LTR in the monocyte-macrophage lineage during virus infection of the bone marrow, the peripheral blood, the lymphoid tissues, and end organs such as the brain. The impact of genetic variation on LTR-directed transcription during the course of retrovirus disease is also reviewed.
Sp-family transcription factors are widely expressed in human tissues and involved in the regulation of many cellular processes and response to cellular microenvironment. These responses appear to be mediated by alterations in transcription factor affinity for DNA rather than altered protein level. How might such changes be effected? This review will identify the range of known post-translational modifications (PTMs) of Sp-factors and the sometimes conflicting literature about the roles of PTMs in regulating activity. We will speculate on the interaction between cell environment, chromatin microenvironment and the role of PTM in governing functionality of the proteins and the complexes to which they belong.
Transcription of the integrated HIV provirus is subject to regulation by chromatin organization and must employ host cell transcription factors and chromatin modifying complexes to promote the formation of latency, and then reverse this process to replicate in response to T cell activation. The repressed latent HIV-1 proviral 5' LTR is organized into a defined structure where two de-acetylated and positioned nucleosomes flank the enhancer region, presumably imposing a block to transcriptional initiation and elongation. LTR-associated nucleosomes undergo further histone H3 K9 trimethylation, to cause silencing by recruitment of HP1. In this article, we review current understanding of how the transcriptionally silenced provirus might be established through the function of transcription factors that bind conserved cis-elements, including SP1, YY1, NF-kappaB, CBF-1 and RBF-2 (USF/TFII-I), and propose mechanisms by which factors bound to the repressed LTR can enable reactivation in response to cell signaling.
This work aimed to ascertain the role of kappaB-responsive elements of the human immunodeficiency virus type 1 (HIV-1) enhancer not only in early initiation but also in long-term maintenance of proviral transcription in cells of the monocytic lineage. For this purpose, we used three main approaches. The first was to abruptly terminate tumor necrosis factor-induced NF-kappaB binding to the enhancer sequences in U1 monocytic cells, using a short pulse of exogenous tumor necrosis factor. This resulted in concomitant decrease in nuclear NF-kappaB DNA-binding activity and endogenous long terminal repeat transcriptional activity. The second was to suppress the permanent NF-kappaB translocation induced by HIV-1 replication itself in chronically infected U937 cells, using a specific proteasome inhibitor (Z-LLL-H). As early as 2 h after addition of the inhibitor to the culture medium, there was an inhibition of both constitutive activation of NF-kappaB and HIV-1 genome expression. The third approach was to monitor the replication competence in U937 cells of an infectious HIV-1 provirus carrying point mutations in the kappaB-responsive elements of both long terminal repeats. Compared with its wild-type counterpart, this mutated provirus showed a profoundly decreased, Z-LLL-H-insensitive transcriptional and replicative activity in U937 monocytes. Together, our results indicate that occupancy of the viral enhancer by NF-kappaB (p50/p65) heterodimers is required for ongoing transcription of integrated HIV provirus in monocytes, even in cells chronically infected and permanently producing functional HIV Tat protein. Thus, the ability of HIV-1 replication to activate NF-kappaB is crucial to the intense self-perpetuated viral transcription observed in cells of the monocytic lineage.
Expression of type I collagen genes is highly regulated and becomes abnormal in various pathological conditions, from excessive collagen production in fibrotic diseases to their downregulation in transformed cells. Some inflammatory cytokines and other ligands, capable of eliciting intracellular phosphorylation, can profoundly alter collagen gene expression. We investigated the role of serine/threonine protein phosphatases (PP) in the regulation of collagen gene expression. Biosynthesis of the endogenous type I procollagen, and expression of Pro alpha 1(I) promoter-luciferase (Luc) constructs transfected in NIH3T3 fibroblasts, were evaluated in response to PP2A and PP1 inhibitor okadaic acid (OA) and exogenously expressed PP catalytic subunits. OA suppressed type I collagen gene expression as judged by reduced rates of protein synthesis, steady state levels of Pro alpha 1(I) collagen mRNA and expression of Luc driven by Pro alpha 1 (I) collagen promoter in OA-treated cells. Co-transfection of Pro alpha 1(I)-Luc with expression vectors containing PP2A, but not PP1, stimulated collagen promoter activity. These results strongly suggest that OA acts via PP2A-mediated dephosphorylation of an unidentified transcription factor(s) or cofactor(s) needed to activate Pro alpha 1(I) collagen promoter.
Using flow channel, we report that the application of a laminar shear stress induced a transient increase of tissue factor (TF) procoagulant activity in human umbilical vein endothelial cells (HUVEC), which was accompanied by a rapid and transient induction of the TF mRNA in the HUVEC. Functional analysis of the 2.2 kb TF 5' promoter indicated that a GC-rich region containing three copies each of the EGR-1 and Sp1 sites was required for induction. Mutation of the Sp1 sites, but not the EGR-1 sites, attenuated the response of TF promoter to shear stress. Thus, Sp1 is a newly defined shear stress responsive element. Electrophoretic mobility shift assays showed there was no increase in binding of nuclear extracts from sheared cells to an Sp1 consensus site. In contrast, immunoblotting of these nuclear extracts with antibody against transcription factor Sp1 demonstrated that shear stress increased the phosphorylation of Sp1. We also showed that shear stress, like the phosphatase inhibitor okadaic acid, increased the transcriptional activity of Sp1. These findings suggest that the shear stress induction of TF gene expression is mediated through an increased Sp1 transcriptional activity with a concomitant hyperphosphorylation of Sp1.
The HIV Tat protein is a transcriptional transactivator of the HIV-1 long terminal repeat (LTR) promoter element. Its activity depends on its direct interaction with the trans-activation response (TAR) element, although TAR-independent activation by Tat has been demonstrated in different cells. Herpesviruses in general and human cytomegalovirus (HCMV) in particular are often isolated from HIV-1-infected patients and could play a role in the activation of latent HIV and in a subsequent increase in HIV replication. HCMV immediate early gene products (IE1 and IE2) are nuclear phosphoproteins that play a pivotal role in HCMV replication and have been shown to transregulate both viral and cellular gene expression. It has repeatedly been shown that HCMV IE1/IE2 can independently transactivate HIV-1 LTR. The aim of this study was to investigate IE1/IE2 transactivation of HIV-1 LTR in a CD4+ T-cell line in the absence and presence of HIV-1 Tat to establish whether IE1/IE2 can synergize with Tat.
HIV-1 LTR transactivation by HCMV IE1/IE2 in the presence and absence of HIV-1 Tat was determined by transient transfection experiments of J-Jhan lymphoblastoid cells with a series of different expression vectors.
We found a strong synergistic transactivation between HIV Tat and the IE1-IE2 complex on HIV LTR activity using vectors driven either by wild-type LTR or by the nuclear factor NF-kappa(B) response element-mutated HIV LTR. IE1/IE2 synergism with HIV Tat was also observed in Sp1 binding site-mutated for TAR-deleted LTR, which cannot be activated by Tat alone. This cooperation is abolished when the region in IE2 that binds the TATA box binding protein is deleted.
The results obtained indicate that Sp1-binding and TAR sequences are not strictly required for Tat responsiveness when Tat is directed to the HIV promoter by HCMV IE1-IE2. This synergistic effect is mediated by the IE2 and TATA-binding region, and could play a major role in HIV activation when cells are infected by both viruses, a feature often observed in AIDS patients.
Embryonic genome activation (EGA) occurs by the 2-cell stage in mouse embryos. To understand the molecular basis of EGA, it is important to determine whether EGA can be supported by maternally inherited factors or if it requires the synthesis of additional transcription factors. We used a quantitative reverse transcription-polymerase chain reaction (RT-PCR) method to test whether protein synthesis is required for the transcriptional activation of six housekeeping genes (U2afbp-rs, Hprt, Pdha1, Prps1, Odc, and Cox7c). Cycloheximide treatment reduced the expression of these mRNAs in 2-cell embryos to the same degree as alpha-amanitin treatment. Cycloheximide treatment did not reduce the expression of maternally inherited mRNAs, indicating that its effect is specific for transcription-dependent gene expression. These results contrast with earlier results reported for the Hsp70 gene. This difference may reflect differences in promoter requirements. We conclude that protein synthesis is required for the activation of most, if not all, housekeeping genes in the mouse embryo, and that the time of EGA may be controlled, in part, by the regulated recruitment of maternal mRNAs encoding key transcription factors.
We demonstrated previously that PP2A exists in many cell types as two abundant forms: (1) holoenzyme composed of two regulatory subunits, A and B, and a catalytic subunit C; and (2) core enzyme consisting of the A and C subunits. These two forms have different substrate specificities. Since published data suggested that HIV-1 transcription may be regulated by a cellular protein phosphatase, it was of interest to determine whether changing the ratio between PP2A core and holoenzyme affects HIV-1 gene expression. This question was addressed by expression in COS cells of an N-terminal mutant of the A subunit, A delta 5, which binds the C but not the B subunit. This resulted in an increase in the amount of core enzyme and a decrease in the amount of holoenzyme concomitant with the expected change in phosphatase activity. Tat-stimulated transcription from the HIV-1 LTR was inhibited 5-fold by mutant A delta 5, whereas mRNA synthesis directed by the actin promoter was not affected. Furthermore, virus production in COS, HeLa, and Jurkat T cells was inhibited 45-, 5-, and 3-fold, respectively, by mutant A delta 5. These results demonstrate that the balance between PP2A holoenzyme and core enzyme is important for HIV-1 gene expression and virus production.
Gene activation by NF-κB/Rel transcription factors is modulated by synergistic or antagonistic interactions with other promoter-bound
transcription factors. For example, Sp1 sites are often found in NF-κB-regulated genes, and Sp1 can activate certain promoters
in synergism with NF-κB through nonoverlapping binding sites. Here we report that Sp1 acts directly through a subset of NF-κB
binding sites. The DNA binding affinity of Sp1 to these NF-κB sites, as determined by their relative dissociation constants
and their relative efficiencies as competitor DNAs or as binding site probes, is in the order of that for a consensus GC box
Sp1 site. In contrast, NF-κB does not bind to a GC box Sp1 site. Sp1 can activate transcription through immunoglobulin kappa-chain
enhancer or P-selectin promoter NF-κB sites. p50 homodimers replace Sp1 from the P-selectin promoter by binding site competition
and thereby either inhibit basal Sp1-driven expression or, in concert with Bcl-3, stimulate expression. The interaction of
Sp1 with NF-κB sites thus provides a means to keep an elevated basal expression of NF-κB-dependent genes in the absence of
activated nuclear NF-κB/Rel.
Leptin is a hormone produced in adipose cells that regulates energy expenditure, food intake, and adiposity. To understand leptin's transcriptional regulation, we are studying its promoter. Four conserved and functional regions were identified. Mutations in the C/EBP and TATA motifs each caused an approximately 10-fold decrease in promoter activity. The C/EBP motif bound recombinant C/EBP alpha and mediated trans-activation by C/EBP alpha, -beta, and -delta. Mutation of a consensus Sp1 site reduced promoter activity 2.5-fold and abolished binding of Sp1. Mutation of a fourth factor-binding site, denoted LP1, abolished protein binding and reduced promoter activity 2-fold. Factor binding to the LP1 motif was observed with adipocyte, but not with nonadipocyte extracts. Adipocytes from fa/fa Zucker rats transcribed the reporter plasmids more efficiently than did control adipocytes. No effect on the transient expression of leptin was noted upon treatment with a thiazolidinedione, BRL49653, or upon cotransfection with peroxisome proliferator-activated receptor-gamma/retinoid X receptor-alpha or sterol response element-binding protein-1. Mutations of the Sp1, LP1, and C/EBP sites in pairwise combinations diminished promoter activity to the extent predicted assuming these motifs contribute independently to leptin promoter function. Our identification of motifs regulating leptin transcription is an important step in the elucidation of the mechanisms underlying hormonal and metabolic regulation of this gene.
Approximately 38% of human immunodeficiency virus type 1 (HIV-1)-infected patients within the Vancouver Lymphadenopathy-AIDS Study have proviruses bearing partial 15- to 34-nucleotide duplications upstream of the NF-kappaB binding sites within the 5' long terminal repeat (LTR). This most frequent naturally occurring length polymorphism (MFNLP) of the HIV-1 5' LTR encompasses potential binding sites for several candidate transcription factors, including TCF-1alpha/hLEF, c-Ets, AP-4, and Ras-responsive binding factor 2 (RBF-2) (M. C. Estable et al., J. Virol. 70:4053-4062, 1996). RBF-2 and an apparently related factor, RBF-1, bind to at least four cis elements within the LTR which are required for full transcriptional responsiveness to protein-tyrosine kinases and v-Ras (B. Bell and I. Sadowski, Oncogene 13:2687-2697, 1996). Here we demonstrate that representative MFNLPs from two patients specifically bind RBF-2. In both cases, deletion of the MFNLP caused elevated LTR-directed transcription in cells expressing RBF-2 but not in cells with undetectable RBF-2. RBF-1, but not RBF-2, appears to contain the Ets transcription factor family member GABPalpha/GABPbeta1. Taken together with the fact that every MFNLP from a comparative study of over 500 LTR sequences from 42 patients contains a predicted binding site for RBF-2, our data suggest that the MFNLP is selected in vivo because it provides a duplicated RBF-2 cis element, which may limit transcription in monocytes and activated T cells.
We compared the Sp1 binding activity of Rat2 fibroblasts in nuclear extracts prepared from quiescent cells and cells stimulated with 20% serum. Increased DNA-binding activity was observed in extracts from serum-stimulated cells when an Sp1 oligonucleotide was used as radiolabeled probe in electrophoretic mobility shift assays. This increase in Sp1 DNA-binding activity is not due to changes in the amount of Sp1 in the nucleus as shown by immunoblot analysis. The transcriptional activity of a reporter construct containing six Sp1 sites upstream of a minimal adenovirus promoter or an Sp1-dependent promoter such as ornithine decarboxylase (ODC) containing Sp1 sites was enhanced following serum stimulation in transient transfection assays. Dephosphorylation of the nuclear extracts with potato acid phosphatase abolished the Sp1 DNA-binding activity, demonstrating a possible correlation between phosphorylation of Sp1 and DNA-binding activity. These results implicate a potential role for Sp1 in mediating signal transduction pathways in response to mitogenic signals.
Leptin is the adipocyte-specific product of the ob gene. Expression of leptin in fully fed animals reflects adipocyte size and body-fat mass. Leptin signals the status of body energy stores to the brain, where signals emanate to regulate food intake and whole-body energy expenditure. The leptin gene was identified in the leptin-deficient, obese ob/ob mouse by positional cloning techniques. Recently, leptin has been cloned in domestic species including pigs, cattle, and chickens. The leptin receptor has at least five splice variants; the long form of the receptor is primarily expressed in the hypothalamus and is thought to be the predominant signaling isoform. Leptin receptors are members of the cytokine family of receptors and signal via janus-activated kinases (JAK)/signal transducers and activators of transcription (STAT) and mitogen-activated protein kinase (MAPK) pathways. Mutations in the leptin or leptin receptor genes results in morbid obesity, infertility, and insulin resistance in rodents and humans. Leptin regulates food intake and energy expenditure via central and peripheral mechanisms. Leptin receptors are expressed in most tissues, and in vitro evidence suggests that leptin may have direct effects on some tissues such as adipose tissue, the adrenal cortex, and the pancreatic beta-cell. Leptin is thought to influence whole-body glucose homeostasis and insulin action. Studies are underway to determine the role that leptin plays in the biology of domestic animals.
Addition of nerve growth factor (NGF) to PC12 cells promotes neuronal differentiation while inhibiting cell proliferation. In order to understand how NGF exerts its antimitogenic effect during differentiation, we have studied the mechanism by which this factor activates the promoter of the CDK inhibitor p21W4F1/CIP1. The minimal region of the p21 promoter required for the NGF-induction was mapped to a contiguous stretch of 10 bp located 83 bases upstream of the transcription initiation site. This GC-rich region was shown to interact specifically with the transcription factor Sp1 and the related protein Sp3, in either exponentially-growing or NGF-treated PC12 cells. The addition of NGF resulted in an accumulation of the transcriptional co-activator p300 in complexes associated with the NGF-responsive region. Transcriptional activity of Sp1, Sp3 and p300 was specifically induced by NGF in a Gal4-fusion assay, indicating that induction of p21 during neuronal differentiation may involve regulation of the activity of these factors by NGF. Furthermore, p300 was able to act as a co-activator for Sp1-mediated transcriptional activation in PC12 cells, suggesting that p300 and Sp1 may cooperate in activating p21 transcription during the withdrawal of neuronal precursors from the cell cycle. This hypothesis is supported by experiments showing that p300 and Sp1 form complexes in PC12 cells.
Direct interaction between transcription factors may provide a mechanism for the regulatory function of these proteins on transcription of the responsive genes. These interactions may be facilitated if the target DNA sequences for the participant regulatory proteins are overlapped or positioned in close proximity to each other within the promoter of the responsive genes. In earlier studies, we identified a cellular protein, named Puralpha, which upon binding to the MB1 regulatory DNA sequence of the myelin basic protein (MBP) gene, stimulates its transcription in central nervous system (CNS) cells. Here, we provide evidence for binding of the ubiquitous DNA binding transcription factor, Sp1, to the MB1 DNA motif at the region that partially overlaps with the Puralpha binding site. We demonstrate that binding of Puralpha to its target sequence is enhanced by inclusion of Sp1 in the binding reaction. Under this condition, binding of Sp1 to the MB1 regulatory sequence remained fairly unchanged, and no evidence for the formation of Puralpha:MB1:Sp1 was observed. This observation suggests that transient interaction of Puralpha and Sp1 may result in stable association of Puralpha and the MB1 element. In support of this notion, results from immunoprecipitation/Western blot studies have established association of Puralpha and Sp1 in nuclear extracts from mouse brain. Of interest, Puralpha appears to bind to the phosphorylated form of Sp1 which is developmentally regulated and that coincides with the periods when MBP gene expression is at its maximum level. Results from cotransfection studies revealed that ectopic expression of Puralpha and Sp1 synergistically stimulates MBP promoter activity in CNS cells. The importance of these findings in stage-specific expression of MBP during brain development is discussed.
Activation of transcription within the embryonic genome (EGA) after fertilization is a complex process requiring a carefully coordinated series of nuclear and cytoplasmic events, which collectively ensure that the two parental genomes can be faithfully reprogrammed and restructured before transcription occurs. Available data indicate that inappropriate transcription of some genes during the period of nuclear reprogramming can have long-term detrimental effects on the embryo. Therefore, precise control over the time of EGA is essential for normal embryogenesis. In most mammals, genome activation occurs in a stepwise manner. In the mouse, for example, some transcription occurs during the second half of the one-cell stage, and then a much greater phase of genome activation occurs in two waves during the two-cell stage, with the second wave producing the largest onset of de novo gene expression. Changes in nuclear structure, chromatin structure, and cytoplasmic macromolecular content appear to regulate these periods of transcriptional activation. A model is presented in which a combination of cell cycle-dependent events and both translational and posttranslational regulatory mechanisms within the cytoplasm play key roles in mediating and regulating EGA.
PKR is a cellular serine/threonine kinase that phosphorylates eukaryotic translation initiation factor 2alpha (eIF2alpha) to regulate protein synthesis. PKR also plays a role in the regulation of transcription, programmed cell death and the cell cycle, processes which likely involve other substrates. In a yeast two-hybrid screen, we isolated human protein phosphatase 2A (PP2A) regulatory subunit B56alpha as a PKR-interacting protein. The interaction between B56alpha and PKR was confirmed by in vitro binding assays as well as by in vivo coimmunoprecipitation, and this interaction is dependent on the catalytic activity of PKR. Moreover, recombinant B56alpha was efficiently phosphorylated by PKR in vitro and an isoelectric point shift in B56alpha was detected in extracts from cells induced with the PKR activator pIC. An in vitro dephosphorylation assay showed that when B56alpha was phosphorylated by PKR, the activity of PP2A trimeric holoenzyme was increased. A functional interaction between B56alpha and PKR was observed in cotransfection assays, where a B56alpha-mediated increase in luciferase expression was inhibited by cotransfection with wild-type PKR. This is likely due to a decreased level of eIF4E phosphorylation caused by an increase in PP2A activity following PKR phosphorylation of B56alpha. Taken together, our data indicate that PKR can modulate PP2A activity by phosphorylating B56alpha to regulate cellular activities.
Virus infections induce a proinflammatory response including expression of cytokines and chemokines. The subsequent leukocyte recruitment and antiviral effector functions contribute to the first line of defense against viruses. The molecular virus-cell interactions initiating these events have been studied intensively, and it appears that viral surface glycoproteins, double-stranded RNA, and intracellular viral proteins all have the capacity to activate signal transduction pathways leading to the expression of cytokines and chemokines. The signaling pathways activated by viral infections include the major proinflammatory pathways, with the transcription factor NF-kappaB having received special attention. These transcription factors in turn promote the expression of specific inducible host proteins and participate in the expression of some viral genes. Here we review the current knowledge of virus-induced signal transduction by seven human pathogenic viruses and the most widely used experimental models for viral infections. The molecular mechanisms of virus-induced expression of cytokines and chemokines is also analyzed.
Human immunodeficiency virus type 2 (HIV-2) gene expression is regulated by upstream promoter elements, including the peri-Ets (pets) site, which mediate enhancer stimulation following treatment with the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA). We previously showed that the oncoprotein DEK binds to the pets site in a site-specific manner. In this report, we show that binding to the HIV-2 pets site is modulated by treatment of U937 monocytic cells with TPA, an activator of protein kinase C. TPA treatment resulted in a reduction in the levels of DEK and the formation of a faster migrating pets complex in gel shift assays. We show further that the actions of TPA on pets binding can be duplicated by phosphatase treatment of nuclear proteins and is blocked with okadaic acid, a protein phospatase-2A (PP2A) inhibitor. Finally, we demonstrate that ectopic expression of the catalytic domain of PP2A can activate the HIV-2 enhancer/promoter alone or in synergy with TPA, an effect mediated in part through the pets site. These results suggest that, through an interaction with the protein kinase C pathway, PP2A is strongly involved in regulating HIV-2 enhancer-mediated transcription. This is a consequence of its effects on DEK expression and binding to the pets site, as well as its effects on other promoter elements. These findings have implications not only for HIV-2 transcription but also for multiple cellular processes involving DEK or PP2A.
Children with chronic inflammatory diseases experience growth failure and wasting. This may be due to growth hormone resistance caused by cytokine-induced suppression of growth hormone receptor (GHR) gene expression. However, the factors governing inflammatory regulation of GHR are not known. We have reported that Sp1 and Sp3 regulate hepatic GHR expression. We hypothesized that TNF-alpha suppresses GHR expression by inhibiting Sp1/Sp3 transactivators. LPS administration significantly reduced murine hepatic GHR expression, as well as Sp1 and Sp3 binding to GHR promoter cis elements. TNF-alpha was integral to this response, as LPS did not affect hepatic Sp1/Sp3 binding or GHR expression in TNF receptor 1-deficient mice. TNF-alpha treatment of BNL CL.2 mouse liver cells reduced Sp1 and Sp3 binding to a GHR promoter cis element and downregulated activity of a GHR promoter-driven luciferase reporter. Combined mutations within adjacent Sp elements eliminated GHR promoter suppression by TNF-alpha without affecting overall nuclear levels of Sp1 or Sp3 proteins. These studies demonstrate that murine GHR transcription is downregulated by LPS, primarily via TNF-alpha-dependent signaling. Evidence suggests that inhibition of Sp transactivator binding is involved. Further investigation of these mechanisms may identify novel strategies for preventing inflammatory suppression of growth.
The outcome of a viral infection ranges from benign to fatal with the clinical pictures being very diverse. This is largely due to the virus-cell interactions that occur in the infected organism. Rapidly after infection, cells initiate a first line of defense against the virus. The cells sense viruses through several mechanisms. Among these the ability to respond to accumulation of double-stranded RNA has been particularly well studied and seems to be of importance. On the other hand, the close co-existence of virus and host has allowed viruses to develop mechanisms to down-modulate the initial reaction or to exploit this proinflammatory response in its own advance. This review describes how virus infections affect cellular signal transduction and the mechanisms through which certain viruses modulate this response to dampen the immune response or prevent cell death.
The human positive transcription elongation factor P-TEFb, consisting of a CDK9/cyclin T1 heterodimer, functions as both a general and an HIV-1 Tat-specific transcription factor. P-TEFb activates transcription by phosphorylating RNA polymerase (Pol) II, leading to the formation of processive elongation complexes. As a Tat cofactor, P-TEFb stimulates HIV-1 transcription by interacting with Tat and the transactivating responsive (TAR) RNA structure located at the 5' end of the nascent viral transcript. Here we identified 7SK, an abundant and evolutionarily conserved small nuclear RNA (snRNA) of unknown function, as a specific P-TEFb-associated factor. 7SK inhibits general and HIV-1 Tat-specific transcriptional activities of P-TEFb in vivo and in vitro by inhibiting the kinase activity of CDK9 and preventing recruitment of P-TEFb to the HIV-1 promoter. 7SK is efficiently dissociated from P-TEFb by treatment of cells with ultraviolet irradiation and actinomycin D. As these two agents have been shown to significantly enhance HIV-1 transcription and phosphorylation of Pol II (refs 6,7,8), our data provide a mechanistic explanation for their stimulatory effects. The 7SK/P-TEFb interaction may serve as a principal control point for the induction of cellular and HIV-1 viral gene expression during stress-related responses. Our studies demonstrate the involvement of an snRNA in controlling the activity of a Cdk-cyclin kinase.
Human immunodeficiency virus type-1 (HIV-1) gene expression is known to be affected by numerous cytokines or growth factors. However, the effect of granulocyte-macrophage colony-stimulating factor (GM-CSF) on long terminal repeat (LTR)-mediated transcription of HIV-1 still remains unknown. By transient transfection experiments with HIV-1 LTR reporter constructs, we showed that strong LTR-mediated activation was induced by GM-CSF in mouse Ba/F3 cells expressing human GM-CSF receptors (GM-CSFR). Mutational analysis of the HIV-1 LTR reporters revealed that both NF-kappaB and Sp1 binding sites play important roles as positive regulatory elements. Analysis of various mutants of the cytoplasmic region of GM-CSFR indicated that both the conserved membrane proximal region and tyrosine residues located in the distal part of the beta subunit were required for HIV-1 LTR activation. Possible involvement of MAPK and PI3-K signalling pathways was suggested by the partial inhibition by wortmannin, a specific inhibitor of the PI3-K pathway, and enhancement by constitutively active MEK1, of HIV-1 LTR activation. However, the MEK1 pathway is not essential since MEK1 inhibitor PD98059 did not suppress GM-CSF-induced HIV-1-LTR activation. Further analyses of GM-CSFR mutants suggested that some other unknown signalling pathway also participates in GM-CSF-induced HIV-1 LTR activation. Taken together, the data suggest that GM-CSF could upregulate the LTR-driven transcription of HIV-1 through modulation of NF-kappaB and SP1 by multiple signalling pathways.
To better understand the basis for human immunodeficiency virus type 1 (HIV-1) persistence and latency, the form in which
viral DNA exists in the peripheral T lymphocyte reservoir of infected individuals was investigated. In asymptomatic individuals,
HIV-1 was harbored predominantly as full-length, unintegrated complementary DNA. These extrachromosomal DNA forms retained
the ability to integrate upon T cell activation in vitro. In patients with acquired immunodeficiency syndrome (AIDS), there
was an increase in integrated relative to extrachromosomal DNA forms. By analysis of DNA from patient lymphocyte subpopulations
depleted of human lymphocyte antigen-Dr receptor-positive cells, quiescent T cells were identified as the source of extrachromosomal
HIV-1 DNA. Thus quiescent T lymphocytes may be a major and inducible HIV-1 reservoir in infected individuals.
The expression of transiently transfected expression vectors under the control of the long terminal repeat (LTR) of the human immunodeficiency virus (HIV) or its enhancer sequence and the translocation of the HIV enhancer-binding protein NF-kappa B were analyzed in two human T-cell clones stimulated through their T-cell receptor complex or by tumor necrosis factor or phorbol 12-myristate 13-acetate. We found a dissociation of NF-kappa B translocation from transactivation of either the HIV LTR or the HIV enhancer. Interleukin 2 induced proliferation but not NF-kappa B translocation or LTR transactivation. Phorbol ester or specific antigen recognition induced HIV LTR transactivation, whereas stimulation with tumor necrosis factor or antibody to CD3 did not. The two latter signals were nevertheless able to induce NF-kappa B translocation with a pattern in the band-shift assay indistinguishable from that observed using phorbol ester. Our finding that induction of NF-kappa B by tumor necrosis factor or antibody to CD3 is not sufficient to induce HIV enhancer-dependent transcription in cloned T cells contrasts with results obtained in most lymphoblastoid T-cell lines and indicates that normal T lymphocytes differ from tumoral T cells in terms of requirements for HIV LTR activation. Furthermore, our results suggest that events linked to T-cell activation, in addition to NF-kappa B translocation per se, induce functional interactions of the NF-kappa B complex with the HIV enhancer.
The interplay between proteins of the NF-ηB/rel and IηB families is a tightly regulated process that ensures appropriate responses to specific environmental and developmental signals. Various mechanisms are utilized in regulating NF-ηB/rel and IxB activities, some unique to this transcription factor system. All of these regulatory strategies converge towards one purpose, namely the controlled nuclear translocation of activated NF-ηB/rel protein complexes. The variety of rel-related and ankyrin repeat containing subunits makes regulation of this system both rich and complicated.
Treatment of human B lymphocytes with an optimal concentration of okadaic acid, an inhibitor of phosphatases 1 and 2A, resulted in the induction of the transcription factor, AP-1 and a marked increase in NF-kappa B levels. In contrast, no effect on the levels of the octamer binding proteins, Oct-1 or Oct-2, were found. Since both AP-1 and NF-kappa B have been reported to be important in the induction of the tumor necrosis factor-alpha (TNF-alpha) gene we examined the effects of okadaic acid on TNF-alpha mRNA levels. Treatment with okadaic acid resulted in a striking increase in TNF-alpha mRNA transcripts within 1 h of stimulation and large amounts of TNF-alpha were released into the culture media. Although okadaic acid provides a potent inductive signal for AP-1 and NF-kappa B it did not induce either B cell proliferation or immunoglobulin secretion.
Permissiveness to replication of human immunodeficiency virus (HIV) differs in T lymphocytes and macrophages. In T cells, HIV transcription is poorly detected in vivo. Cloned, normal T lymphocytes show very little, if any, basal activity of the HIV enhancer and low nuclear expression of NF-kappa B, a potent transcriptional activator of the HIV enhancer. In contrast, fixed tissue macrophages express detectable HIV proteins, indicating permanent virus transcription. One explanation for the perpetuation of virus infection in macrophages could be sustained nuclear NF-kappa B expression. However, the U937 monocytic cell line, which is fully permissive to HIV replication, is known to express only low levels of nuclear NF-kappa B. We show here that chronic HIV infection results in both induction of a nuclear factor with antigenic properties indistinguishable from those of NF-kappa B and permanently increased HIV enhancer activity. This phenomenon, which is independent of tumour necrosis factor, is associated with HIV replication, and is thus likely to explain at least in part the perpetuation of HIV infection in monocytes.
Efficient transcription of SV40 early genes requires transcription factor Sp1. Here, we report that SV40 infection induces Sp1 phosphorylation. While characterizing this modification, we discovered that Sp1 becomes quantitatively phosphorylated in an in vitro transcription extract. Multiple processive phosphorylation of Sp1 depends on binding of Sp1 to GC box-containing DNA. Cell fractionation and column chromatography reveal that the Sp1 kinase is a nuclear DNA binding protein that corresponds to a previously identified DNA-dependent protein kinase. Because only some trans-activators are phosphorylated by this kinase, Sp1 belongs to a specific subgroup of factors that are phosphorylated upon binding to promoter sequences. Finally, efficient phosphorylation of Sp1 requires both a functional DNA binding domain and a region containing the transcriptional activation domains. Coupling of phosphorylation to DNA binding may represent a novel mechanism for regulating transcriptional initiation.
A microtransfection method, using either the DEAE-dextran or the Ca.phosphate procedure has been developed. A plasmid expressing the luciferase-encoding gene under the control of the human immunodeficiency virus (HIV) LTR promoter was constructed. Transfections were performed in 96-well plates, allowing statistical evaluation of the results. This microtransfection method requires the use of 100- to 1000-fold less plasmid and cells than in a conventional chloramphenicol acetyl transferase (CAT) assay. A Luciferase index which takes into account cell viability after transfection has been defined using a semi-automated absorbance assay. A 20-h incubation period post-transfection is sufficient for optimal results. Basal long terminal repeat activity and autologous Tat transactivation were studied in various lymphoid, monocytic and adherent human cell lines. Infection of microtransfected cells by HIV activated luc expression. This assay can thus also be used for rapid detection and quantitation of HIV. Antiviral activities of drugs can be assessed in a two-day test.
The ubiquitous Oct-1 and lymphoid Oct-2 POU homeodomain transcription factors bind to the same DNA sequence but differ in their activation potential. Oct-2 is a positive, negative, or neutral regulator of beta-globin transcription depending on the position and sequence of multimerized binding sites. To activate transcription, Oct-2 relies on two interdependent nonacidic domains, an N-terminal glutamine-rich region and a C-terminal serine-, threonine-, and proline-rich region. Oct-1 also contains a functional glutamine-rich region but fails to activate beta-globin transcription in our assay because the Oct-1 C-terminus is inactive, indicating that differential activation by Oct-1 and Oct-2 is determined by the combination of multiple activation domains. Oct-2 displays a unique phosphorylation pattern that is absent from molecules lacking one or the other activation domain, suggesting the activation domains have a role in inducing protein phosphorylation.
Expression of the human immunodeficiency virus type 1 (HIV-1) genome is greatly dependent on the viral trans-activator protein Tat. Tat functions through the TAR element, which is represented in both viral DNA and RNA. At present, there is no definitive evidence that determines whether Tat acts through a DNA or RNA form of TAR. We have used an intramolecular mutagenesis approach to change selectively the RNA secondary structure of TAR without affecting its primary sequence. We show that a specific RNA secondary structure for TAR is needed for biological activity. Furthermore, transcripts that only transiently form a native TAR RNA hairpin, which is not maintained in the mature mRNA, are completely trans-activated by Tat, suggesting that TAR is recognized as a nascent RNA.
A native gel electrophoresis DNA binding assay was used to resolve complexes formed on the adenovirus Major Late Promoter by general transcription factors and RNA polymerase II. Five sets of complexes containing distinct components were identified. These complexes were generated by sequential binding of TFIID, TFIIA, TFIIB, RNA polymerase II, and TFIIE. The relative positions of each of the factors in the complexes were determined by DNAase I footprint analysis. TFIIA, derived from yeast or mammalian cells, formed a complex with yeast TFIID and the TATA element. TFIIB bound to this complex and probably acts as a "bridge" to the polymerase and the initiation site. The addition of ATP or dATP, necessary for "activation" of transcription, resulted in an alteration of the footprint in the +20 to +30 region, the same area protected upon addition of TFIIE to the initiation complex. Addition of ribonucleotide triphosphates generated new complexes that contained accurately initiated transcripts associated with the transcription machinery and the template DNA. A model for the interactions of components in initiation of transcription by RNA polymerase II is proposed.
The nature and position of transcriptional control elements responsible for the expression of genes encoded by the retrovirus associated with acquired immune deficiency syndrome (AIDS) have not been precisely defined. In this study it is shown that the mammalian Sp1 transcription factor binds to promoter sequences within the AIDS retrovirus long terminal repeat (LTR) and activates RNA synthesis five- to eightfold in reconstituted reactions in vitro. Experiments in which regions of DNA were protected from added reagents by specifically bound proteins (footprinting) indicated that the upstream promoter region of the AIDS virus LTR lies between -45 and -77 (relative to the RNA start site, +1) and contains three tandem, closely spaced SP1 binding sites of variable affinity. Base-substitution mutations targeted to one or all three Sp1 binding sites were found both to eliminate the binding of Sp1 and to cause up to a tenfold reduction in transcriptional efficiency in vitro. These findings suggest that one important component of the AIDS virus transcriptional control region interacts with a cellular transcription factor, Sp1, and that this factor must function in conjunction with transcriptional elements located downstream of the RNA cap site to mediate the response of the LTR to viral trans-activation.
Human immunodeficiency virus (HIV) production from latently infected T lymphocytes can be induced with compounds that activate the cells to secrete lymphokines. The elements in the HIV genome which control activation are not known but expression might be regulated through a variety of DNA elements. The cis-acting control elements of the viral genome are enhancer and promoter regions. The virus also encodes trans-acting factors specified by the tat-III and art genes. We have examined whether products specific to activated T cells might stimulate viral transcription by binding to regions on viral DNA. Activation of T cells, which increases HIV expression up to 50-fold, correlated with induction of a DNA binding protein indistinguishable from a recognized transcription factor, called NF-kappa B, with binding sites in the viral enhancer. Mutation of these binding sites abolished inducibility. That NF-kappa B acts in synergy with the viral tat-III gene product to enhance HIV expression in T cells may have implications for the pathogenesis of AIDS (acquired immune deficiency syndrome).
The general transcription factor TFIID is a multiprotein complex containing the TATA-binding protein and several associated factors (TAFs), some of which may function as coactivators that are essential for activated, but not basal, transcription. Here we describe the isolation and characterization of the first gene encoding a TAF protein. The deduced amino acid sequence of TAF110 revealed the presence of several glutamine- and serine/threonine-rich regions reminiscent of the protein-protein interaction domains of the regulatory transcription factor Sp1 that are involved in transcription activation and multimerization. In both Drosophila cells and yeast, TAF110 specifically interacts with the glutamine-rich activation domains of Sp1. Moreover, purified Sp1 selectively binds recombinant TAF110 in vitro. These findings taken together suggest that TAF110 may function as a coactivator by serving as a site of protein-protein contact between activators like Sp1 and the TFIID complex.
The activation of several transcription factors in response to extracellular stimuli is fairly well understood. In all cases, activation is mediated through phosphorylation by signal responsive protein kinases. The specificity of transcription factor phosphorylation is likely to be ensured by physical interactions between the protein kinases and their substrates. Distinct biological responses are likely to be mediated through activation of different constellations of protein kinases, resulting in phosphorylation of different transcription factors.
The tat gene of the human immunodeficiency virus (HIV) plays a central role in the activation and life cycle of HIV. The tat protein (Tat) specifically transactivates HIV transcription in vivo and in vitro, exerting its effects at the level of transcriptional initiation and elongation. Here we report that Tat binds directly to the basal transcription factor TFIID. The transcriptional activity of HeLa extracts was depleted after chromatography on a Tat affinity column, which specifically retained the polymerase II-specific factor TFIID. Direct interaction of Tat with holo-TFIID, composed of TATA-binding protein (TBP) and associated factors (TAFs), was observed. Tat binds, through amino acids 36-50, directly to the TBP subunit of TFIID. Our results suggest that Tat may transduce upstream or downstream regulatory signals by direct interaction with the basal transcription factor TFIID.
Expression of the human immunodeficiency virus type 1 (HIV-1) provirus in T lymphocytic and monocytic cells can be induced by treatment with hexamethylene bisacetamide (HMBA). The induction occurs at the transcriptional level within 1 to 3 h after the addition of the drug, and is not associated with detectable changes in the binding of transcription factors to the enhancer, TATA box or other regulatory regions of the HIV-1 long terminal repeat (LTR). Using the 5' deletion mutants of HIV-1 LTR controlling the expression of the chloramphenicol acetyltransferase gene, we found that the deletion of the kappa B enhancer did not affect HIV-1 inducibility, whereas the deletion of the Sp1 binding sites abolished transcriptional activation. However, the presence of the HIV-1 LTR Sp1 binding sites in the context of the heterologous promoter did not induce responsiveness to HMBA. We conclude that HMBA increases transcription through the secondary modification of the basal transcription complex suggesting the existence of a regulatory pathway that circumvents the requirement for the induction of NF-kappa B or other DNA-specific binding proteins.
The human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2) Tat proteins are related transcriptional activators whose effects are likely to be mediated by a cellular factor. Using an in vitro kinase assay, we have shown that the Tat protein of HIV-2 and the activation domain of the Tat protein of HIV-1 specifically bind to a cellular protein kinase. Mutations in Tat that abolish transactivation activity in vivo abrogate the ability of the mutants to bind to the kinase in vitro. This is the first demonstration of a cellular factor that binds to Tat that is specific for a functional activation domain of Tat and that displays a biochemical activity. Additionally, we show that the Tat protein of HIV-2 serves as a substrate of the kinase in vitro. Consistent with the in vitro results, the Tat protein of HIV-2 interacts with a cellular kinase in HIV-2 Tat-transfected cells and is phosphorylated in vivo. These results suggest that a cellular serine/threonine kinase may act as a mediator of Tat function.
Inducible gene expression in eukaryotes is mainly controlled by the activity of transcriptional activator proteins, such as NF-kappa B (refs 1-3), a factor activated upon treatment of cells with phorbol esters, lipopolysaccharide, interleukin-1 and tumour necrosis factor-alpha. Activation of NF-kappa B involves release of the inhibitory subunit I kappa B from a cytoplasmic complex with the DNA-binding subunits Rel-A (formerly p65) and p50 (refs 6, 7). Cell-free experiments have suggested that protein kinase C and other kinases transfer phosphoryl groups onto I kappa B causing release of I kappa B and subsequent activation of NF-kappa B. Here we report that I kappa B-alpha (formerly MAD-3) is degraded in cells after stimulation with phorbol ester, interleukin-1, lipopolysaccharide and tumour necrosis factor-alpha, an event coincident with the appearance of active NF-kappa B. Treatment of cells with various protease inhibitors or an antioxidant completely prevented the inducible decay of I kappa B-alpha as well as the activation of NF-kappa B. Our findings suggest that the activation of NF-kappa B relies on an inducible degradation of I kappa B-alpha through a cytoplasmic, chymotrypsin-like protease. In intact cells, phosphorylation of I kappa B-alpha is apparently not sufficient for activation of NF-kappa B.
The c-Rel protein is able to associate in vitro and in vivo with the TATA-binding protein (TBP) of the TFIID complex. Coexpression of TBP with c-Rel augments transactivation from the kappa B site in Drosophila Schneider cells. DNA-binding mutants of TBP not only fail to cooperate, but they repress transactivation by c-Rel. There may be a direct communication between kappa B enhancer binding proteins and basal transcription factors which leads to enhanced transcription.