Content uploaded by Anthony Cormier
Author content
All content in this area was uploaded by Anthony Cormier
Content may be subject to copyright.
The PN2-3 Domain of Centrosomal P4.1-associated Protein
Implements a Novel Mechanism for Tubulin Sequestration
*
□
S
Received for publication, October 28, 2008, and in revised form, January 6, 2009 Published, JBC Papers in Press, January 7, 2009, DOI 10.1074/jbc.M808249200
Anthony Cormier
‡1
, Marie-Jeanne Cle´ment
§1,2
, Marcel Knossow
‡3
, Sylvie Lachkar
¶
, Philippe Savarin
§
, Flavio Toma
§
,
Andre´ Sobel
¶
, Benoît Gigant
‡4
, and Patrick A. Curmi
§5
From the
‡
Laboratoire d’Enzymologie et Biochimie Structurales, CNRS, Baˆtiment 34, 1 avenue de la Terrasse, 91198 Gif-sur-Yvette, France,
§
INSERM, UMR829, Laboratoire Structure-Activite´ des Biomole´cules Normales et Pathologiques, Universite´ Evry-Val d’Essonne,
91025 Evry, France, and
¶
INSERM, UMR839, Institut du Fer a` Moulin, Universite´ Pierre et Marie Curie Paris 06, 75005 Paris, France
Microtubules are cytoskeletal components involved in multi-
ple cell functions such as mitosis, motility, or intracellular traf-
fic. In vivo, these polymers made of
␣
-tubulin nucleate mostly
from the centrosome to establish the interphasic microtubule
network or, during mitosis, the mitotic spindle. Centrosomal
P4.1-associated protein (CPAP; also named CENPJ) is a centro-
somal protein involved in the assembly of centrioles and impor-
tant for the centrosome function. This protein contains a micro-
tubule-destabilizing region referred to as PN2-3. Here we
decrypt the microtubule destabilization activity of PN2-3 at the
molecular level and show that it results from the sequestration
of tubulin by PN2-3 in a non-polymerizable 1:1 complex. We
also map the tubulin/PN2-3 interaction both on the PN2-3
sequence and on the tubulin surface. NMR and CD data on free
PN2-3 in solution show that this is an intrinsically unstructured
protein that comprises a 23-amino acid residue
␣
-helix. This
helix is embedded in a 76-residue region that interacts strongly
with tubulin. The interference of PN2-3 with well characterized
tubulin properties, namely GTPase activity, nucleotide ex-
change, vinblastine-induced self-assembly, and stathmin family
protein binding, highlights the

subunit surface located at the
intermolecular longitudinal interface when tubulin is embed-
ded in a microtubule as a tubulin/PN2-3 interaction area. These
findings characterize the PN2-3 fragment of CPAP as a protein
with an unprecedented tubulin sequestering mechanism dis-
tinct from that of stathmin family proteins.
Microtubules (MTs)
6
are major components of the cytoskel-
eton shaped as tubes whose walls are composed of
␣
-tubulin
heterodimers (tubulin). During interphase, they form a dy-
namic network that participates in the organization of the cell
architecture and serves as tracks for molecular motors that con-
vey intracellular cargos and organelles throughout the cyto-
plasm. In dividing cells, during the M phase, this network is
fully reorganized to form spindle MTs on which chromosome
pairs align and segregate. To fulfill this wide range of functions,
MTs alternate phases of growth and shrinkage in a process
known as dynamic instability. The architecture of the MT array
results from the action of endogenous proteins that affect MT
nucleation and dynamics. MTs are nucleated by the
␥
-tubulin
ring complex and the
␥
-tubulin small complex that, together
with proteins that regulate their effects, are localized at the
centrosome (1); in differentiated cells this is the primary MT
organizing center. Endogenous proteins that regulate MT dy-
namics include MT-associated proteins that stabilize MTs and
proteins that destabilize them like depolymerizing kinesins and
tubulin-sequestering proteins. One of the best characterized
families of tubulin-sequestering proteins is that of stathmin.
Stathmin, the founding member of the family, was shown to
regulate the amount of assembled MTs by binding tubulin and
preventing its self-assembly in microtubules (2, 3). This group
of proteins forms a tight ternary complex made of two tubulins
and one stathmin family protein (4, 5).
Centrosomal P4.1-associated protein (CPAP; also named
CENPJ) is a 1338-amino acid centrosomal protein identified as
a partner of the head domain of the cytoskeletal protein 4.1R-
135 (6). Homozygous mutations of the CPAP gene were found
to be associated with an autosomal recessive form of primary
microcephaly (7), suggesting that CPAP plays some key physi-
ological role. Observations have been made that identify CPAP
as an important factor of the centrosome cycle: it was observed
to be associated with centrosomes along the cell cycle (6), and
its depletion by RNA interference alters centrosome integrity
and induces multipolar spindles (8). CPAP also plays a role in
the centrosome function as anti-CPAP polyclonal antibodies
inhibit microtubule nucleation by isolated centrosomes as
observed with anti-
␥
-tubulin antibodies (6). Interestingly
CPAP comprises a region (referred to as PN2-3; amino acid
residues 311–422) that inhibits microtubule nucleation from
*This work was supported by INSERM, CNRS, Association pour la Recherche
sur le Cancer (to P. A. C. and A. S.), and Association Franc¸ aise contre les
Myopathies (to A. S.). The costs of publication of this article were defrayed
in part by the payment of page charges. This article must therefore be
hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
□
S
The on-line version of this article (available at http://www.jbc.org) contains
supplemental Fig. 1.
1
Both authors contributed equally to this work.
2
Recipient of a postdoctoral fellowship from Re´gion Ile de France.
3
Supported by La Ligue Contre Le Cancer (e´quipe labelise´e 2006).
4
To whom correspondence may be addressed. Tel.: 33-1-69-82-35-01; Fax:
33-1-69-82-31-29; E-mail: gigant@lebs.cnrs-gif.fr.
5
To whom correspondence may be addressed. Tel.: 33-1-69-47-03-23; Fax:
33-1-69-47-02-19; E-mail: pcurmi@univ-evry.fr.
6
The abbreviations used are: MT, microtubule; CPAP, centrosomal P4.1-
associated protein; MDD, microtubule-destabilizing domain; STD-NMR,
saturation transfer difference NMR spectroscopy; SLD, stathmin-like
domain; Tc, tubulin䡠colchicine complex; T
2
R, tubulin䡠RB3
SLD
complex;
T
2
S, tubulin䡠stathmin complex; T
2
SLD, tubulin䡠SLD complex; MES,
4-morpholineethanesulfonic acid; HSQC, heteronuclear single quan-
tum correlation; CD, circular dichroism; PIPES, 1,4-piperazinediethane-
sulfonic acid; SPR, surface plasmon resonance.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 11, pp. 6909 –6917, March 13, 2009
© 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
MARCH 13, 2009•VOLUME 284• NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 6909
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
http://www.jbc.org/cgi/content/full/M808249200/DC1
Supplemental Material can be found at:
the centrosome, impedes assembly of pure tubulin, and depo-
lymerizes Taxol-stabilized MTs (9). When PN2-3 is transiently
overexpressed, it localizes to the centrosome and in the cytosol
and inhibits MT reassembly after cold depolymerization as
does the full-length CPAP protein. Together these observations
show that the PN2-3 region contains a novel microtubule-de-
stabilizing domain (MDD) without homology with other
known MT destabilizers (9).
We undertook a biochemical and structural analysis of the
tubulin/PN2-3 interaction to help clarify its functioning at the
molecular level. We show that the microtubule destabilization
activity of PN2-3 results from its ability to sequester tubulin in
a 1:1 complex that does not polymerize. Combining NMR and
biochemical experiments, we identified the MDD of PN2-3 as a
76-amino acid region that targets a tubulin surface involving
the longitudinal interdimer interface of the

subunit. Our data
highlight the PN2-3 domain of CPAP as a unique tool to stabi-
lize a single tubulin heterodimer that will be useful in particular
for biochemical or structural purposes.
EXPERIMENTAL PROCEDURES
Proteins—Tubulin was purified from sheep brain crude ex-
tracts as described previously (10). Pure tubulin was stored at
⫺80 °C in 50 mMMES-K, pH 6.8, 0.5 mMEGTA, 0.25 mM
MgCl
2
, 0.05 mMEDTA, 33% glycerol, 0.1 mMGTP. Before use,
an additional cycle of assembly/disassembly was performed to
remove any non-functional protein. Tubulin concentration was
determined by spectrophotometry using an extinction coeffi-
cient of 1.2 mg
⫺1
⫻cm
2
at 278 nm (11).
Standard recombinant DNA techniques were carried out as
described previously (12). Restriction enzymes were from New
England Biolabs (Surrey, British Columbia, Canada). The
cDNA encoding the PN2-3 region of CPAP (amino acids 311–
422 of CPAP) was amplified from a human cDNA library by
PCR using the following primers: 5⬘-TATTATTCCATGGCA-
CAAAAACATGATGATTCCTCAGAAG (forward) and 5⬘-
TATTATAGGATCCTTACCGCTGGAGTTGCTGTCTATC
(reverse) and the High Expand Fidelity Enzyme (Stratagene, La
Jolla, CA). The PCR product was verified by sequencing
(Genome Express, Meylan, France) after cloning in the pET-3d
inducible expression vector (Novagen, Madison, WI). This
cDNA contained an additional alanine codon located in the 5⬘
region immediately after the ATG for better Escherichia coli
expression. PN2-3 amino acid residues were numbered with
respect to the amplified sequence (Ala
1
, Gln
2
, Lys
3
, His
4
,
Asp
5
,…,Arg
113
). PN2-3 was expressed in the BL21(DE3) E. coli
strain. Bacteria were grown in LB medium at 37 °C, and expres-
sion was induced with 0.4 mMisopropyl

-D-thiogalactoside
when A
600
reached ⬃0.5. Bacteria were pelleted 3 h later
(4000 ⫻gfor 15 min at 4 °C) and resuspended in 20 mMsodium
phosphate, pH 6.8, 1 mMEGTA containing the antiprotease
Complete mixture (Roche Applied Science). After 3 ⫻1-min
sonication on ice, the lysate was centrifuged again (4000 ⫻gfor
15 min at 4 °C), and the supernatant (S1) was boiled for 10 min
before another centrifugation step (100,000 ⫻gfor1hat4°C)
to yield the boiled S2 supernatant. The S2 supernatant was then
purified by cation-exchange chromatography on an SP-Sepha-
rose Fast Flow column (Amersham Biosciences) equilibrated
with 20 mMsodium phosphate, 1 mMEGTA, pH 6.8. Proteins
were eluted with a 0–1 MNaCl linear gradient in the same
buffer. The eluted fractions were analyzed by SDS-PAGE with
Coomassie Blue staining. PN2-3-positive fractions were pooled
and concentrated by ultrafiltration using a Centriprep 3000
device (Millipore, Bedford, MA). Finally protein extracts were
loaded on a Superdex 75 16/60 size exclusion chromatography
column (Amersham Biosciences) equilibrated with 20 mM
sodium phosphate, 200 mMNaCl, 1 mMEGTA, pH 6.8. Pure
PN2-3 fractions were detected by SDS-PAGE and concentrated
as above. Concentration of purified PN2-3 was determined by
amino acid analysis. For NMR analyses,
15
N-labeled PN2-3 or
15
N,
13
C-labeled PN2-3 were produced using standard proto-
cols in M9 medium supplemented with
15
NH
4
Cl or
15
NH
4
Cl/
D-[
13
C]glucose. The purification procedure and protein con-
centration determination were identical to those used for
unlabeled PN2-3.
The recombinant stathmin-like domain of RB3 (RB3
SLD
) and
stathmin were produced and purified as described previously
(4). The stathmin N-cap (also named I19L) is a peptide in the
N-terminal part of the stathmin protein capping the
␣
-tubu-
lin longitudinal interface (13). Its sequence (IQVKELE-
KRASGQAFELIL) corresponds to human stathmin residues
6–24. It was obtained by chemical synthesis from Epytop
(Nîmes, France).
In Vitro Tubulin Polymerization Assay—MT assembly was
monitored turbidimetrically at 350 nm in an Ultrospec 3000
spectrophotometer (GE Healthcare) thermostated at 37 °C
(1-cm light path). Experiments were carried out in 50 mM
MES-K, pH 6.8, 30% glycerol, 0.5 mMEGTA, 6 mMMgCl
2
, 0.5
mMGTP. Tubulin polymerization was evaluated in each sample
by the difference between the 37 °C steady state absorbance and
the residual absorbance after subsequent cold-induced depoly-
merization, which ensures that the absorbance at 350 nm taken
into account results from MT assembly and not from cold sta-
ble aggregates (3). Differences between the two values were
used to construct critical concentration plots representing the
amount of polymerized tubulin observed at steady state versus
the total concentration of tubulin measured in the absence or
presence of PN2-3 or stathmin as described previously (3).
NMR Spectroscopy—All
1
H NMR experiments were carried
out at 293 K on a Bruker Avance 600-MHz NMR spectrometer
equipped with a cryoprobe, and data were processed using
XWINNMR (Bruker) software. Sodium [3-trimethylsilyl-
2,2⬘,3,3⬘-
2
H
4
]propionate (TSP-d
4
) was used as an internal ref-
erence for proton chemical shifts.
Free and Tubulin-bound PN2-3—Spectra of PN2-3 free and
bound to tubulin were collected with 0.05 mM
15
N-labeled sam-
ples in 500-
l volumes. The tubulin/PN2-3 interaction was
studied with a molar ratio of 1:1. Buffer conditions were 50 mM
sodium phosphate, pH 6.8, 0.02% NaN
3
, 10% D
2
O supple-
mented with 150 mMNaCl for free PN2-3.
1
H-
15
N HSQC
experiments were carried out with 2048 data points ⫻1024
increments ⫻32 scans and a spectral width of 1500 and 1520
Hz for
1
H and
15
N dimensions, respectively. The data were
zero-filled to give a 4096 ⫻2048 data matrix prior to Fourier
transformation. Structures of PN2-3 were calculated using 50
torsion angle constraints derived from TALOS predictions
CPAP PN2-3 Sequesters Tubulin
6910 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 11•MARCH 13, 2009
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
(14). A total of 200 structures were generated with a standard
simulated annealing protocol using Crystallography and NMR
System (CNS) 1.1 (15). Of these calculated structures, the qual-
ity of the 15 structures with the lowest total energy was ana-
lyzed, and the seven best structures without torsion angle vio-
lations were selected and visualized with MOLMOL 2.6 (16).
Simultaneous Binding of PN2-3 and Stathmin N-cap to
Tubulin—60-
l samples containing 1 mMpeptide and 20
M
tubulin (50:1 peptide:protein ratio) in 50 mMsodium phosphate
buffer, pH 6.8 and 0.02% NaN
3
in 10% D
2
O were placed in a
1.7-mm-diameter capillary tube. One-dimensional proton
spectra were acquired with 64 scans and 16,000 data points.
One-dimensional saturation transfer difference NMR spec-
troscopy (STD-NMR) experiments (17) of stathmin N-cap in
interaction with tubulin preincubated or not with 50
M
PN2-3 or stathmin were recorded with 1024 scans. The pro-
tein resonances were saturated at 0 or 10 ppm (40 ppm for
reference spectra) with a cascade of 40 selective Gaussian-
shaped pulses of 50-ms duration with a 1-ms delay between
each pulse, resulting in a total saturation time of 2.04 s. Sub-
traction of saturated spectra from reference spectra was per-
formed by phase cycling.
Circular Dichroism—Far-UV circular dichroism (CD) spec-
tra and thermal unfolding profiles were recorded on a Jasco
J-810 spectropolarimeter equipped with a Peltier temperature-
controlled single cell holder. Measurements were done in a 0.1-
cm-path length quartz cell with 10
MPN2-3 in a 20 mM
sodium phosphate, pH 6.5, 1 mMEGTA, 1.65 mMNaCl buffer.
Spectra are the average of five accumulations from 260 to 185
nm, and the thermal unfolding profile was recorded at 222 nm
from 4 to 60 °C with a 1 °C min
⫺1
ramping rate. The CD signal
(millidegrees) was converted to mean residual ellipticity ([
],
degrees䡠cm
2
䡠dmol
⫺1
) defined as [
]⫽[
]
obs
(10cln)
⫺1
where
[
]
obs
(millidegrees) is the experimental ellipticity, c(mol䡠
dm
⫺3
) is the protein concentration, l(cm) is the cell path
length, and nis the number of residues in the protein. The
percentage of helix was calculated from the following equation:
f⫽([
]
222
⫺[
]
R
)/([
]
Hn
⫺[
]
R
) where fis the
␣
-helical fraction
of protein residues, [
]
222
is the mean residue ellipticity value at
222 nm, [
]
R
(1580) is the mean residue ellipticity for pure ran-
dom coil, and [
]
Hn
is the mean residue ellipticity for a helix of
length n. This last factor is derived from the equation [
]
Hn
⫽
[
]
H∞
(1 ⫺k/n) where [
]
H∞
(⫺39,500) is the mean residue
ellipticity for pure helix of infinite length and kis a wavelength-
dependent constant (2.57 for
⫽222 nm) (18).
Secondary Structure Prediction—The secondary structure of
PN2-3 was predicted using PROF (19), NNPREDICT (20),
PSIPRED (21), and PSA (22).
Tubulin䡠Colchicine GTPase Activity—Measurements of the
colchicine-enhanced GTPase activity of tubulin were per-
formed at a 20
Mtubulin concentration in 80 mMPIPES-K, pH
6.8, 1 mMMgCl
2
, 0.5 mMEGTA, 150
M[
␥
-
32
P]GTP (GE
healthcare). The tubulin䡠colchicine complex (Tc; prepared
as described previously (23)) was incubated with increasing
amounts of PN2-3 during 15 min at 4 °C. Measurements were
started after prewarming the corresponding samples for 6 min
at 37 °C. Free inorganic phosphate was quantified by extracting
it as a phosphomolybdate complex as described previously (24).
Briefly 50-
l aliquots were taken off in the time course and
mixed immediately with 1.5 ml of an ice-cold 10 mMammo-
nium molybdate solution in 1 MHCl and 4% HClO
4
.H
3
PO
4
(0.2
mM) was added as a carrier. After extraction by 3 ml of cyclo-
hexane:isobutyl alcohol:acetone (5:5:1) saturated with water, 1
ml of the organic phase was mixed with 10 ml of scintillation
solution for radioactivity counting. The radioactivity of 150
M
[
␥
-
32
P]GTP was taken as a reference to quantify GTP hydroly-
sis. During the 24-min time course in which the reaction was
monitored, the rate of GTP hydrolysis remained constant. The
total GTPase activity of each sample was deduced from the
slope of the plot of the concentration of inorganic phosphate as
a function of time, and the specific activity of tubulin was
derived by dividing the background-subtracted total activity by
the tubulin concentration.
Vinblastine-induced Tubulin Assembly—10
Mtubulin or
Tc with or without PN2-3 was incubated with 10–100
Mvin-
blastine for 20 min at room temperature in 15 mMPIPES-K, pH
6.8, 300
MMgCl
2
, 200
MEGTA, 100
MGDP. After high
speed centrifugation (300,000 ⫻gfor 15 min at 20 °C), the
supernatant and pellet were analyzed by SDS-PAGE on Coo-
massie Blue-stained gels.
Size Exclusion Chromatography—Samples were analyzed by
gel filtration at a 0.5 ml/min flow rate on a Superose 12 HR
10/30 column (GE Healthcare) previously equilibrated with 80
mMPIPES-K, pH 6.5, 1 mMEGTA, 5 mMMgCl
2
. The column
was calibrated with ribonuclease A (Stokes radius (R
S
)⫽16.4
Å), chymotrypsinogen A (R
S
⫽20.9 Å), ovalbumin (R
S
⫽30.5
Å), bovine serum albumin (R
S
⫽35.5 Å), aldolase (R
S
⫽48.1 Å),
catalase (R
S
⫽52.2 Å), ferritin (R
S
⫽61 Å), and thyroglobulin
(R
S
⫽85Å) (gel filtration calibration kit, GE Healthcare). 100-
l
samples at a 10
Mtubulin concentration either alone or with
RB3
SLD
and/or PN2-3 were analyzed. The elution profiles were
recorded at 280 nm where we essentially monitor tubulin
because RB3
SLD
and PN2-3 do not absorb light significantly at
this wavelength. The Stokes radius was determined graphically
on a plot of (⫺log K
av
)
1
⁄
2
as a function of the Stokes radius (25)
constructed with the above mentioned standard proteins.
K
av
is calculated as (V
e
⫺V
0
)/(V
t
⫺V
0
) where V
e
represents
the elution volume at the top of the peak, V
0
is the void
volume of the column (determined with blue dextran), and
V
t
is the total volume of the gel bed (determined as the elu-
tion volume of acetone).
Nucleotide Exchange—The exchange of GDP for GTP at the
nucleotide exchangeable site (on

-tubulin) was estimated by
measuring the displacement of “cold” GDP by [
␣
-
32
P]GTP fol-
lowing a procedure adapted from Bai et al. (26). GDP-tubulin
(10
M) was incubated for 5 min on ice with varying amounts of
PN2-3 in 80 mMPIPES-K, pH 6.9, 0.5 mMMgCl
2
.50
M
[
␣
-
32
P]GTP was added, and the reaction mixture was incubated
for an additional 15 min. Tubulin was separated from unbound
nucleotide by rapid gel filtration on a Micro Bio-Spin P6 col-
umn (Bio-Rad) previously equilibrated with the same buffer
(27). There is no release of tubulin-bound nucleotide during
centrifugation (28). We also quantified the free nucleotide that
was eluted from the column. The radioactivity of the tubulin-
containing eluted fraction was counted, corrected for eluted
CPAP PN2-3 Sequesters Tubulin
MARCH 13, 2009•VOLUME 284• NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 6911
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
free nucleotide, and compared with the radioactivity of an
[
␣
-
32
P]GTP sample of known concentration.
Surface Plasmon Resonance (SPR)—The BIAcore 2000 sys-
tem, sensor chips SA (i.e. streptavidin-coated, thus allowing
coupling with biotin), and HBS buffer (10 mMHEPES, pH 7.4,
150 mMNaCl, 3.4 mMEDTA, 0.005% (v/v) surfactant P20) were
from BIAcore AB (Uppsala, Sweden). One flow cell was used as
a reference. Another flow cell was coupled with 300 resonance
units of RB3
SLD
that was specifically biotinylated on an N-ter-
minal tag as described previously (29). To check whether PN2-3
binds to the tubulin䡠RB3
SLD
complex (T
2
R), the coupled sensor
chip was first loaded with 20
Mtubulin in 80 mMPIPES-K, pH
6.8, 1 mMEGTA, 5 mMMgCl
2
at a 10
l/min flow rate at 20 °C.
PN2-3 at concentrations ranging from 16 to 820 nMwas then
flowed over the sensor chip. As a control, stathmin was injected
at 1
Mconcentration. For analysis, the reference flow cell sen-
sorgram was subtracted from the corresponding sensorgrams
to take into account base-line drift, bulk, and nonspecific inter-
action contributions. The sensor chip was regenerated using 30
lof50mMHEPES, pH 7.4, 500 mMNaCl, 3 mMEDTA, 0.005%
surfactant P20.
RESULTS
PN2-3 Sequesters Tubulin in a 1:1 Complex—The effect of
PN2-3 on tubulin polymerization at steady state was quantified
using critical concentration plots derived from turbidimetric
measurements (Fig. 1). In the buffer used for this experiment,
the critical concentration of tubulin for microtubule assembly
was 2
M. In the presence of PN2-3, the critical concentration
plots were shifted while remaining parallel to the control
straight line observed with tubulin alone. This indicates that
PN2-3 prevents polymerization of the same amount of MTs at
all tubulin concentrations by sequestering tubulin in a non-
polymerizable state. The amount of unassembled tubulin in
complex with PN2-3 can be derived from the shift of the plot. In
the presence of 4 or 8
MPN2-3, the apparent critical concen-
tration increased to 5.5 and 10
M, respectively, in good agree-
ment with a stoichiometry of one tubulin sequestered per
PN2-3. As a control, we checked that the addition of 2
M
stathmin (known to form a 2:1 tubulin䡠stathmin complex (T
2
S))
results in a shift similar to that observed with 4
MPN2-3.
These data show that PN2-3 acts as a tubulin-sequestering pro-
tein forming with tubulin a binary 1:1 complex that does not
participate in microtubule assembly.
PN2-3 Folds into a Short Helical and Unstable Structure in
Solution—We used far-UV CD spectroscopy to characterize
the PN2-3 structure in solution. The spectrum recorded at
20 °C has one minimum centered at 222 nm characteristic of
proteins with
␣
-helical content (Fig. 2A). The mean residue
ellipticity value at 222 nm translates into about 20% helical con-
tent in PN2-3, corresponding to 23
␣
-helical residues. The
spectrum also displays strong negative values at 195–200 nm, a
feature characteristic of unfolded proteins (30). The largely
FIGURE 1. PN2-3 inhibits MT assembly by sequestering tubulin in a 1:1
complex. Critical concentration plots for microtubule assembly in the
absence (F) and in the presence of 4 (f)or8
M(⽧) PN2-3 or of 2
Mstathmin
(⫻) are displayed. Abs, absorbance.
FIGURE 2. CD analysis of PN2-3. A, far-UV CD spectrum of 10
MPN2-3
recorded at 20 °C. B, thermal unfolding profile of 10
MPN2-3 recorded at 222
nm. deg, degrees.
CPAP PN2-3 Sequesters Tubulin
6912 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 11•MARCH 13, 2009
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
unfolded nature of PN2-3 was fur-
ther confirmed by recording its
thermal unfolding profile from 4 to
60 °C. It shows a reversible (data not
shown) non-cooperative transition
(Fig. 2B), which means that PN2-3
unfolds non-cooperatively between
4 and 40 °C, a known behavior of
intrinsically unstructured proteins.
We also investigated the PN2-3
structure by NMR spectroscopy.
The two-dimensional
1
H-
15
N HSQC
of free PN2-3 revealed a weak disper-
sion of correlation peaks, another
indication that this subdomain does
not have a well defined tertiary struc-
ture when isolated in solution (Ref. 31
and Fig. 3A). The recent and mostly
complete
1
H-
15
N and
13
C free PN2-3
NMR assignments allowed us to
probe the presence of PN2-3 regions
containing regular secondary struc-
ture. Using the chemical shift devia-
tions from random coil values of C
␣
atoms (32), we delimitated a 25-
amino acid region (residues Phe
29
to
Glu
53
; PN2-3 numbering) containing
significant
␣
-helical structure (31).
Taking also the chemical shift devi-
ation values of H
␣
and carbonyl
atoms into account (supplemental
Fig. 1), we then determined the
␣
-helical region more accurately
and restricted it to residues Phe
29
to
Glu
51
in agreement with the helical
content determined by CD spec-
troscopy. An ensemble of PN2-3
structures calculated with TALOS
(14) torsion angle constraints reca-
pitulating these data is depicted in
supplemental Fig. 1B.
The secondary structure predic-
tions of PN2-3 using several algo-
rithms (19–22) point out additional
stretches that may fold into
␣
-heli-
ces (supplemental Fig. 1A). Overall
these programs predict an N-termi-
nal helix longer than the one exper-
imentally observed, from residues
Glu
9
to Ala
52
, and two additional
shorter ones in the C-terminal part
of the sequence (Leu
73
–Gln
84
and
Lys
105
–Leu
111
). To summarize, the
experimental CD spectroscopy and
NMR data indicate that PN2-3 has a
limited secondary structure con-
tent, whereas predictions suggest
more extensive
␣
-helical folding.
FIGURE 3. NMR analysis of the tubulin/PN2-3 interaction. A,
1
H-
15
N HSQC spectra of free PN2-3 (black;
the resonances of interacting residues are labeled) and bound to tubulin (red). B, sequence of PN2-3. The
tubulin-binding residues (Val
10
to Lys
85
) delimiting the PN2-3 MDD are in black.
CPAP PN2-3 Sequesters Tubulin
MARCH 13, 2009•VOLUME 284• NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 6913
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
A 76-amino Acid Region of PN2-3 Binds Strongly to Tubulin—
We investigated the interaction of PN2-3 with tubulin by chem-
ical shift perturbation mapping (33), i.e. by analyzing the modifi-
cations of the two-dimensional
1
H-
15
N HSQC NMR spectrum
(disappearances, attenuations, or shifts of cross-peaks)
of PN2-3 upon tubulin binding using
15
N-labeled PN2-3
and unlabeled tubulin. Because of the large size of the
tubulin䡠PN2-3 complex (⬃110 kDa), the PN2-3
1
H-
15
N cross-
peaks of residues that interact strongly with tubulin are
expected to become invisible. The comparison of the HSQC
spectrum of tubulin䡠PN2-3 at a 1:1 ratio with that of free PN2-3
(Fig. 3A) indicates that more than half of
1
H-
15
N cross-peaks
disappear. A peak by peak analysis using our assignment of free
PN2-3 (31) allowed us to determine that the resonances signif-
icantly affected in the presence of tubulin correspond to resi-
dues Val
10
to Lys
85
(Fig. 3B); they define the tubulin-binding
region of PN2-3. This 76-amino acid domain that interacts
strongly with tubulin encompasses the
␣
-helix region (residues
29–51) observed in free PN2-3. Interestingly it is predicted to
fold into two helices (Val
10
–Ala
52
and Leu
73
–Gln
84
) separated
by a proline-rich region (Pro
55
, Pro
57
, Pro
62
, and Pro
65
); it is
possible that these helical regions fold as predicted upon tubu-
lin binding.
PN2-3 Interferes with Tubulin Longitudinal Associations—
We next mapped the PN2-3 footprint on tubulin through its
interference with several well characterized tubulin properties.
We first evaluated its effect on the tubulin GTPase activity in
solution, a process that requires tubulin-tubulin longitudinal
associations (23). Whereas this activity is very low, it is en-
hanced to a measurable amount when tubulin is in complex
with colchicine (Tc) (34). We found the GTPase activity of Tc to
be 5.5 ⫾0.7 10
⫺3
min
⫺1
in good agreement with previous
results (23). This activity is inhibited by PN2-3, a stoichiometric
amount of which is sufficient for complete inhibition (Fig. 4A).
We checked that GTP hydrolysis did not differ whether GTP
was added to tubulin before or after PN2-3; as PN2-3 inhibits
nucleotide exchange (see below), this ensures that it also inhib-
its GTP hydrolysis.
We also studied the effect of PN2-3 on vinblastine-induced
tubulin self-assembly. Vinblastine induces the formation of spi-
rals (35) by promoting tubulin-tubulin longitudinal associa-
tions into curved assemblies (36). As this leads to large oli-
gomers, this process is conveniently monitored in spin-down
assays. Using a 10
Mtubulin concentration, we found that
about half of the tubulin is pelleted in the presence of 10
M
vinblastine and that this proportion increases at higher vinblas-
tine concentrations (Fig. 4B). In the presence of 10
MPN2-3,
tubulin remains soluble even at a 100
Mvinblastine concen-
tration (Fig. 4B). Identical results were obtained with Tc (data
not shown).
We draw three conclusions about the tubulin/PN2-3 inter-
action from these results. (i) They indicate that, in addition to
tubulin, PN2-3 also interacts with Tc as also confirmed by gel
filtration chromatography (data not shown). Therefore PN2-3
also interacts with tubulin maintained in a bent conformation
(37). (ii) The “titration-like” shape of the inhibition curve of the
GTPase activity of 20
MTc (Fig. 4A) implies that PN2-3 binds
to Tc with an affinity constant (K
a
) higher than 10
6
M
⫺1
. Inci-
dentally the stoichiometric inhibition fully confirms the 1:1
tubulin:PN2-3 stoichiometry derived from MT assembly inhi-
bition. (iii) Finally because the Tc GTPase activity and the vin-
blastine-induced assembly depend on tubulin-tubulin longitu-
FIGURE 4. PN2-3 prevents tubulin longitudinal associations. A, dose-de-
pendent effect of PN2-3 on the GTPase activity of 20
Mtubulin䡠colchicine.
Error bars were calculated from the deviations from a straight line of the vari-
ations of inorganic phosphate released as a function of time as described
previously (47). Below 20
MPN2-3 the data were fitted linearly and corre-
spond to the stoichiometric inhibition of the Tc GTPase activity by PN2-3.
Above 20
MPN2-3, there is no residual activity within experimental error.
B, inhibition of the vinblastine-induced tubulin helical assembly by PN2-3. The
vinblastine-dependent tubulin/tubulin association was assayed by analyzing
the tubulin content in the supernatant (S) and pellet (P) after centrifugation of
mixtures of the relevant proteins with vinblastine at the indicated concentra-
tions as described under “Experimental Procedures.” The vinblastine-induced
assembly (top) is inhibited by PN2-3 (bottom). C, PN2-3 interferes with the
binding of RB3
SLD
to tubulin. The gel filtration chromatography elution pro-
files of 10
Mtubulin either alone (continuous line), with 5
MRB3
SLD
(long
dashes), with 10
MPN2-3 (alternating short and long dashes), or with 5
M
RB3
SLD
and 10
MPN2-3 (short dashes) are displayed. Abs, absorbance; mAU,
milliabsorbance units.
CPAP PN2-3 Sequesters Tubulin
6914 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 11•MARCH 13, 2009
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
dinal associations (23, 36) our results indicate that PN2-3
prevents these associations.
One implication of these results is that any property that
depends on tubulin-tubulin longitudinal associations may be
affected by PN2-3. This is in particular the case of the formation
of tubulin䡠stathmin-like domain (SLD) complexes. SLDs form
with tubulin a protofilament-like 2:1 tubulin䡠SLD complex
(T
2
SLD) in which longitudinal interactions are established
between the two tubulin molecules (38, 39). We evaluated the
interference of PN2-3 with the formation of T
2
SLD by record-
ing in a gel filtration chromatography assay the partition of
tubulin among T
2
SLD and tubulin䡠PN2-3 in the presence of
variable amounts of PN2-3. In this experiment we used the
complex of tubulin with RB3
SLD
(T
2
R) as it does not dissociate
appreciably on a gel filtration column (4). When a sample
comprising 10
Mtubulin, 10
MPN2-3, and 5
MRB3
SLD
was analyzed, the gel filtration chromatogram displayed two
peaks (Fig. 4C). The first one elutes at the same volume as
T
2
R, and the second one elutes slightly before the tubulin
peak and corresponds to tubulin䡠PN2-3. We also checked
that the more PN2-3 we added the more the tubulin amount
eluting in the second peak increased. These results indicate
that PN2-3 binds tightly to tubulin in a way that prevents the
formation of the T
2
R complex. The observation that the
tubulin䡠PN2-3 peak is only slightly shifted from that of tubu-
lin (the Stokes radius changes from 44 to 48 Å) argues in
favor of the formation of a complex that comprises one tubu-
lin molecule.
PN2-3 Targets the

-Tubulin Longitudinal Interface—To
determine which of the
␣
or the

subunit longitudinal inter-
faces is targeted by PN2-3, we studied the effects of PN2-3 bind-
ing on two tubulin properties depending specifically on resi-
dues located at these interfaces. First we recorded the
interference of PN2-3 with the tubulin nucleotide exchange.
Whereas the
␣
-tubulin-bound GTP is non-exchangeable, the
guanine nucleotide bound to the

subunit is freely exchange-
able in solution (40). Moreover and as opposed to GTP hydrol-
ysis, this is a unimolecular process as it occurs at the solvent-
exposed nucleotide site in T
2
R, a complex that does not
undergo tubulin-like longitudinal associations (36). All the sol-
vent-exposed residues that constitute the exchangeable nucle-
otide binding site are located at the

-tubulin longitudinal
intermolecular interface where the opening of the site is found
(41); it is therefore expected that occluding this opening or
preventing movements of the loops surrounding this site,
which implies contacting this

subunit interface, inhibits
nucleotide exchange. Indeed the only compounds known to
inhibit nucleotide exchange completely and whose binding site
on tubulin has been defined bind to that interface (42). No effect
of PN2-3 on nucleotide exchange of 10
Mtubulin was detected
up to the addition of a nearly stoichiometric amount of PN2-3,
whereas we recorded a dose-dependent inhibition at higher
PN2-3 concentration (Fig. 5A). This means that, at substoi-
chiometric PN2-3 concentration and during the 15-min
incubation of the samples, each tubulin molecule is uncom-
plexed for a sufficient time for nucleotide exchange to hap-
pen. This is consistent with the known nucleotide dissocia-
tion kinetic constant (k
off
⫽0.1 s
⫺1
(43)) and shows that
PN2-3 dissociation from tubulin is not rate-limiting in our
experimental conditions. Inhibition of nucleotide exchange
by PN2-3 is evidenced by observations at higher PN2-3 con-
centrations with completeness being reached at 20
M
PN2-3. This strongly suggests that PN2-3 contacts the

-tu-
bulin longitudinal interface.
In a second experiment, we studied the interference between
PN2-3 and the stathmin N-terminal peptide (stathmin N-cap)
for tubulin binding; this peptide has been shown to interact
exclusively with the
␣
-tubulin longitudinal interface (13, 37).
This was investigated by STD-NMR, taking advantage of the
folding of the stathmin N-cap upon tubulin binding (13). This
technique allows characterization of the binding site of a ligand
in fast exchange with its receptor by saturating the receptor
FIGURE 5. PN2-3 targets the

-tubulin longitudinal interface. A, inhibition
by PN2-3 of tubulin nucleotide exchange. The variation of the amount of
exchanged nucleotide as a function of PN2-3 concentration is presented.
Error bars are standard deviations from triplicate experiments. The experi-
mental data points are joined by a smoothed curve. B, PN2-3 does not com-
pete with the stathmin N-cap for tubulin binding. The one-dimensional (1D)
1
H NMR spectrum of the stathmin N-cap in the presence of tubulin (top panel)
and the one-dimensional STD-NMR spectra of the stathmin N-cap in the pres-
ence of tubulin (second panel), of tubulin䡠PN2-3 (third panel), or of T
2
S(fourth
panel) are displayed.
CPAP PN2-3 Sequesters Tubulin
MARCH 13, 2009•VOLUME 284• NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 6915
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
protons (17). We previously used it to identify the protons of
the stathmin N-cap in contact with tubulin (13). We found that
the one-dimensional STD-NMR spectrum of the stathmin
N-cap in the presence of tubulin was not altered by PN2-3,
whereas it was dramatically flattened when stathmin was added
as a positive control for competition (Fig. 5B). Therefore PN2-3
does not compete with the stathmin N-cap for tubulin binding.
These results also suggest that PN2-3, the stathmin N-cap,
and tubulin associate into a ternary complex. Taken together
with the interference of PN2-3 with tubulin longitudinal
associations, they reinforce the argument based on nucleo-
tide exchange inhibition that PN2-3 targets the

-tubulin
longitudinal intermolecular interface.
As one such interface is exposed in T
2
R (37, 42), this raises the
possibility that T
2
R䡠PN2-3 complexes might form even though
apparently mutually exclusive T
2
R and tubulin䡠PN2-3 complexes
are detected by gel filtration (Fig. 4C). In an attempt to detect
trace amounts of these putative complexes, we turned to an
SPR experiment. T
2
R was immobilized through a biotiny-
lated RB3
SLD
onto a streptavidin-functionalized sensor chip
(29). When PN2-3 was injected, we did not observe any mass
increase (Fig. 6). This indicates that the T
2
R䡠PN2-3 complex,
if it forms, is not sufficiently abundant to be detected by this
technique. Instead and as compared with controls with
buffer alone or with stathmin, a dose-dependent decrease of
the signal related to the dissociation of tubulin from RB3
SLD
coupled to the sensor chip was observed. This suggests that
PN2-3 interferes with the T
2
R complex in a way that desta-
bilizes it, a finding that remains to be confirmed in solution
and will be investigated further.
DISCUSSION
The PN2-3 fragment of CPAP contains an MT destabilizing
motif that binds to
␣
-tubulin (9). The effect of PN2-3 on the
amount of polymerized tubulin provides a means to assess the
interference of PN2-3 with microtubule assembly quantitatively.
Critical concentration plots were derived from turbidimetric
measurements (Fig. 1). A quantitative analysis demonstrates that
PN2-3 sequesters tubulin in an unpolymerizable 1:1 complex and
that its effect is satisfactorily described by the following scheme.
Tubulin ºMTs
Tubulin ⫹PN2-3 ºTubulin 䡠PN2-3
SCHEME 1
The critical concentration for microtubule assembly is the
difference between the apparent critical concentration and
the concentration of the tubulin䡠PN2-3 complex. It appears
that it is not affected by PN2-3, suggesting that PN2-3 does
not interact with microtubules appreciably in agreement
with experimental results of the sedimentation of Taxol-sta-
bilized MTs (9).
To define the mechanism of action of PN2-3 further, we
characterized its structure in solution and mapped its interac-
tion with tubulin both on its sequence and on the tubulin sur-
face. NMR data show that PN2-3 does not fold into a well
defined tertiary structure but that a 23-residue region (from
residues 29 to 51) is predominantly
␣
-helical in agreement with
CD measurements. This helical content is very temperature-
sensitive as PN2-3 unfolds reversibly upon heating in a broad
and non-cooperative transition (Fig. 2B). Inspection of the
amino acid composition (Fig. 3B) reveals that the PN2-3
sequence has a strong bias toward small and/or polar residues
and a low content of hydrophobic amino acids: 73% of all resi-
dues are Gln, Asn, Ser, Pro, Glu, Lys, Gly, and Ala, whereas only
22% of all residues are Val, Leu, Ile, Met, Phe, Tyr, and Trp.
Therefore both its sequence signature and its conformational
behavior classify PN2-3 as an intrinsically disordered protein
(44). Intrinsically disordered proteins have been found to fall in
five broad categories, one of them being constituted of effectors
that regulate large multiprotein complexes such as the ribo-
some or the cytoskeleton (45). The
1
H-
15
N HSQC spectrum of
a 1:1 mixture of PN2-3 with tubulin indeed shows that a 76-res-
idue-long PN2-3 region (residues 10 –85) binds tightly to tubu-
lin (Fig. 3). Consistently we found that the PN2-3 10–85 frag-
ment recapitulates all the functional properties of PN2-3
interaction with tubulin: it inhibits MT assembly and the tubu-
lin GTPase activity, interferes with RB3
SLD
for tubulin binding,
and inhibits vinblastine-mediated association as well as nucle-
otide exchange (data not shown); it defines the MDD of CPAP.
This fragment is very similar to a 70-residue-long fragment of
PN2-3 (residues 11–81 in our numbering) very recently shown
to inhibit MT nucleation from centrosomes, and its limits are
consistent with the observation that residues Lys
68
and Arg
69
are essential for tubulin binding (46). Interestingly the PN2-3
MDD comprises the isolated PN2-3
␣
-helix but is also pre-
dicted by several algorithms to contain an additional short helix
(residues 73–84; supplemental Fig. 1) separated from the first
one by a proline-rich region (Pro
55
, Pro
57
, Pro
62
, and Pro
65
). It is
likely that it folds into a defined tertiary structure upon tubulin
binding, and it is possible that this folded conformation has a
higher helical content than isolated PN2-3, reminiscent of a
number of unstructured proteins that fold only upon binding to
their physiological partner (44). Finally we note that the NMR
and the GTPase activity inhibition data demonstrate that the
tubulin/PN2-3 association is tight (K
a
⬎10
6
M
⫺1
), suggesting
that soluble
␣
-tubulin is the physiological target of PN2-3.
Because another CPAP domain binds autonomously to MTs
FIGURE 6. SPR investigation of the interaction of PN2-3 with T
2
R. Net sensor-
grams after background subtraction are displayed. The sensor chip with immo-
bilized RB3
SLD
was first loaded with 20
Mtubulin (between points Aand B) and
then washed with buffer (until point C). Between Cand D, stathmin (1
M)or
PN2-3 (at concentrations ranging from 16 to 820 nM) were injected following
which a final buffer wash was performed.
CPAP PN2-3 Sequesters Tubulin
6916 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284•NUMBER 11•MARCH 13, 2009
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
(46) and because the whole protein has been shown to interact
with
␥
-tubulin (6), CPAP emerges as a potential multifunc-
tional MT regulator.
To get insight into the regions of tubulin that interact with
PN2-3, we measured the PN2-3 interference with well charac-
terized tubulin properties. We first showed that PN2-3 inter-
feres with the longitudinal interactions of tubulin. The simplest
explanation, involving only local effects, is that PN2-3 contacts
tubulin residues in its longitudinal intermolecular interfaces
either in the
␣
or in the

subunit. To discriminate between
these two possibilities, we checked the competition for tubulin
binding of PN2-3 with the stathmin N-cap and evaluated the
effect of PN2-3 on tubulin nucleotide exchange. Taken to-
gether, the results of these two experiments strongly suggest
that PN2-3 contacts residues of the

-tubulin intermolecular
longitudinal interface. Targeting that surface is an efficient
mechanism for inhibition of MT growth and for interference
with the formation of T
2
R as these two tubulin assemblies
require proper longitudinal interactions to be established. We
showed that PN2-3 sequesters tubulin away from these assem-
blies. The only other tubulin-sequestering proteins that have
been extensively studied thus far belong to the stathmin family
(4). They sequester tubulin by maintaining it in a curved assem-
bly consisting of two heterodimers and by capping
␣
-tubulin at
one end of this assembly (37). The PN2-3 fragment of CPAP
differs from them in two respects: it sequesters a single tubulin
heterodimer and does so, at least in part, by capping its

sub-
unit longitudinal interface.
In conclusion, this work validates PN2-3 and its 10–85
region as a single tubulin heterodimer-sequestering motif, a
finding that, to the best of our knowledge, is not shared by other
proteins. As such it is a valuable tool for the study and handling
of unassembled tubulin, a protein well known to be fragile when
kept in this state. In addition, as
␣
-tubulin is abundant in the
pericentriolar material throughout the cell cycle, its sequestra-
tion by PN2-3 is likely to be important for the function of CPAP
in the centrosome.
Acknowledgments—The Re´gion Ile de France, the Conseil Ge´ne´ral de
l’Essonne, Genopole威, Direction des Sciences du Vivant/Commissariat a`
l’Energie Atomique, and the Association Franc¸aise contre les Myopathies
are acknowledged for contributions to the NMR equipment.
REFERENCES
1. Schiebel, E. (2000) Curr. Opin. Cell Biol. 12, 113–118
2. Belmont, L. D., and Mitchison, T. J. (1996) Cell 84, 623– 631
3. Jourdain, L., Curmi, P., Sobel, A., Pantaloni, D., and Carlier, M. F. (1997)
Biochemistry 36, 10817–10821
4. Charbaut, E., Curmi, P. A., Ozon, S., Lachkar, S., Redeker, V., and Sobel, A.
(2001) J. Biol. Chem. 276, 16146–16154
5. Steinmetz, M. O. (2007) J. Struct. Biol. 158, 137–147
6. Hung, L. Y., Tang, C. J., and Tang, T. K. (2000) Mol. Cell. Biol. 20,
7813–7825
7. Bond, J., Roberts, E., Springell, K., Lizarraga, S. B., Scott, S., Higgins, J.,
Hampshire, D. J., Morrison, E. E., Leal, G. F., Silva, E. O., Costa, S. M.,
Baralle, D., Raponi, M., Karbani, G., Rashid, Y., Jafri, H., Bennett, C., Corry,
P., Walsh, C. A., and Woods, C. G. (2005) Nat. Genet. 37, 353–355
8. Cho, J. H., Chang, C. J., Chen, C. Y., and Tang, T. K. (2006) Biochem.
Biophys. Res. Commun. 339, 742–747
9. Hung, L. Y., Chen, H. L., Chang, C. W., Li, B. R., and Tang, T. K. (2004)
Mol. Biol. Cell 15, 2697–2706
10. Castoldi, M., and Popov, A. V. (2003) Protein Expr. Purif. 32, 83– 88
11. Detrich, H. W., III, and Williams, R. C. (1978) Biochemistry 17, 3900 –3907
12. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY
13. Clement, M. J., Jourdain, I., Lachkar, S., Savarin, P., Gigant, B., Knossow, M.,
Toma, F., Sobel, A., and Curmi, P. A. (2005) Biochemistry 44, 14616 –14625
14. Cornilescu, G., Delaglio, F., and Bax, A. (1999) J. Biomol. NMR 13,
289–302
15. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P.,
Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S.,
Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta
Crystallogr. Sect. D Biol. Crystallogr. 54, 905–921
16. Koradi, R., Billeter, M., and Wuthrich, K. (1996) J. Mol. Graph. 14, 51–55
17. Mayer, M., and Meyer, B. (1999) Angew. Chem. Int. Ed. Engl. 38,
1784–1788
18. Chen, Y. H., Yang, J. T., and Chau, K. H. (1974) Biochemistry 13,
3350–3359
19. Ouali, M., and King, R. D. (2000) Protein Sci. 9, 1162–1176
20. Kneller, D. G., Cohen, F. E., and Langridge, R. (1990) J. Mol. Biol. 214,
171–182
21. McGuffin, L. J., Bryson, K., and Jones, D. T. (2000) Bioinformatics 16,
404–405
22. Stultz, C. M., White, J. V., and Smith, T. F. (1993) Protein Sci. 2, 305–314
23. Wang, C., Cormier, A., Gigant, B., and Knossow, M. (2007) Biochemistry
46, 10595–10602
24. Carlier, M. F., Didry, D., and Pantaloni, D. (1987) Biochemistry 26,
4428–4437
25. Siegel, L. M., and Monty, K. J. (1966) Biochim. Biophys. Acta 112, 346 –362
26. Bai, R. L., Pettit, G. R., and Hamel, E. (1990) J. Biol. Chem. 265,
17141–17149
27. Penefsky, H. S. (1977) J. Biol. Chem. 252, 2891–2899
28. Caplow, M., and Zeeberg, B. (1980) Arch. Biochem. Biophys. 203, 404 – 411
29. Jourdain, I., Lachkar, S., Charbaut, E., Gigant, B., Knossow, M., Sobel, A.,
and Curmi, P. A. (2004) Biochem. J. 378, 877–888
30. Martin, S. R., and Schilstra, M. J. (2008) Methods Cell Biol. 84, 263–293
31. Clement, M. J., Savarin, P., Coutant, J., Toma, F., and Curmi, P. (2008)
Biomol. NMR Assign. 2, 115–117
32. Wishart, D. S., Sykes, B. D., and Richards, F. M. (1992) Biochemistry 31,
1647–1651
33. Zuiderweg, E. R. (2002) Biochemistry 41, 1–7
34. David-Pfeuty, T., Simon, C., and Pantaloni, D. (1979) J. Biol. Chem. 254,
11696–11702
35. Weisenberg, R. C., and Timasheff, S. N. (1970) Biochemistry 9, 4110 – 4116
36. Gigant, B., Wang, C., Ravelli, R. B., Roussi, F., Steinmetz, M. O., Curmi,
P. A., Sobel, A., and Knossow, M. (2005) Nature 435, 519–522
37. Ravelli, R. B., Gigant, B., Curmi, P. A., Jourdain, I., Lachkar, S., Sobel, A.,
and Knossow, M. (2004) Nature 428, 198–202
38. Gigant, B., Curmi, P. A., Martin-Barbey, C., Charbaut, E., Lachkar, S., Lebeau,
L., Siavoshian, S., Sobel, A., and Knossow, M. (2000) Cell 102, 809–816
39. Steinmetz, M. O., Kammerer, R. A., Jahnke, W., Goldie, K. N., Lustig, A.,
and van Oostrum, J. (2000) EMBO J. 19, 572–580
40. Weisenberg, R. C., Borisy, G. G., and Taylor, E. W. (1968) Biochemistry 7,
4466–4479
41. Lowe, J., Li, H., Downing, K. H., and Nogales, E. (2001) J. Mol. Biol. 313,
1045–1057
42. Cormier, A., Marchand, M., Ravelli, R. B., Knossow, M., and Gigant, B.
(2008) EMBO Rep. 9, 1101–1106
43. Amayed, P., Carlier, M. F., and Pantaloni, D. (2000) Biochemistry 39,
12295–12302
44. Dyson, H. J., and Wright, P. E. (2005) Nat. Rev. Mol. Cell Biol. 6, 197–208
45. Tompa, P. (2002) Trends Biochem. Sci. 27, 527–533
46. Hsu, W. B., Hung, L. Y., Tang, C. J., Su, C. L., Chang, Y., and Tang, T. K.
(2008) Exp. Cell Res. 314, 2591–2602
47. Bevington, P. R., and Robinson, K. D. (1992) Data Reduction and Error
Analysis for the Physical Sciences, 2nd Ed., McGraw-Hill, New York
CPAP PN2-3 Sequesters Tubulin
MARCH 13, 2009•VOLUME 284• NUMBER 11 JOURNAL OF BIOLOGICAL CHEMISTRY 6917
at University of California, Berkeley on September 8, 2009 www.jbc.orgDownloaded from
