Content uploaded by Aparna Khanna
Author content
All content in this area was uploaded by Aparna Khanna
Content may be subject to copyright.
STEM CELLS AND DEVELOPMENT 15:29–39 (2006)
© Mary Ann Liebert, Inc.
Original Research Report
Role of Smad- and Wnt-Dependent Pathways in Embryonic
Cardiac Development
RAJARSHI PAL and APARNA KHANNA
ABSTRACT
The development of the heart is essential for embryogenesis and precedes development of other or-
gans. However, the mechanisms involved in embryonic cardiac development are ill-defined. Recent
evidence suggests that Smad and Wnt signaling pathways are important in stem cell fate determi-
nation and their commitment to cardiovascular differentiation. We have previously reported that
bone morphogenetic proteins (BMP)-2, -5, and -7 and fibroblast growth factors (FGF)-2 and -4 se-
creted from the adjoining endodermal cells favor cardiac differentiation in murine embryonic stem
(ES) cells. Here, we demonstrate that BMP-2, -5, and -7 stimulate receptor-activated Smad1, 5, and
8, which in turn causes oligomerization of Smad4 in the nucleus. We further delineate the role of
Wnt signaling pathway as evidenced by induction of Wnt3 and Wnt8b, stimulation of FRP-1, inhi-
bition of GSK-B, accumulation of cytosolic -catenin, and transcription of target genes, including
c-myc and cyclin-D1. We also ascertained the specificity of BMP- and Wnt-evoked activation of sig-
naling cascades. Our data are consistent with the hypothesis that BMP-dependent activation of tran-
scription factors including GATA-4, Nkx2.5, and MEF-2C augments cardiac differentiation mediated
by cooperative control of Smad and Wnt signaling pathways. Our results provide a solid foundation
for further study of the biochemistry of cardiac differentiation from stem cells.
29
INTRODUCTION
E
MBRYONIC STEM
(ES)
CELLS
are a population of multi-
potent, self-renewing cells that are derived from the
epiblast of mammalian blastocyst embryos and retain this
developmental identity even after prolonged culture in vitro
(1). The recent isolation and culture of human embryonic
stem (hES) cells (2) attracts two important considerations.
The first is their potential application in regenerative med-
icine, and the second is their experimental usefulness in de-
lineating important developmental signaling pathways, and
the potential they offer for regenerative medicine, as well
as the delineation of the events involved in early human
development and the signaling pathways activated during
development. Pluripotent ES cells can be induced to dif-
ferentiate into a myriad of tissues belonging to the three
germ layers, including ectoderm, mesoderm and endoderm
in vitro after aggregation into three-dimensional structures
termed embryoid bodies (EBs) (3). EBs give rise to a va-
riety of specialized cell types, including cardiomyocytes,
that manifest by the appearance of spontaneously contract-
ing foci (4). Thus, cardiac differentiation of EBs is a suit-
able in vitro model to study the signaling pathways in heart
development from mouse ES cells.
The heart is one of the first organs to develop in a de-
veloping embryo and ensures the distribution of vital nu-
trients within the growing organism. Truly, the well-or-
chestrated morphological and molecular events that result
in the formation of this complex organ are intriguing. Al-
though the cardiac-promoting role of many growth fac-
tors has been thoroughly investigated, our current knowl-
edge about regulatory events leading to heart formation
is mostly based on previously characterized transcription
factors that belong to very different gene families. One
Embryonic Stem Cell Group, Reliance Life Sciences, Ltd., Navi Mumbai-400 701, India.
of the biggest challenges now is to identify molecules
that regulate these cardiac transcription factors and to un-
derstand their intertwined regulatory relationships.
Dissecting the genetic pathways involved in cardio-
genesis has revealed crucial roles for members of vari-
ous growth factor families in this process. For example,
the combination of bone morphogenetic proteins 2/4
(BMP-2/4) belonging to the transforming growth factor-
(TGF-) family, and fibroblast growth factor-4 (FGF-
4) is capable of converting avian posterior mesoderm,
which normally does not contribute to the heart, into car-
diac tissue (5,6). Similarly, FGF/FGFR signaling also
plays important functions in heart formation and devel-
opment (7).
Likewise, various growth factors appear to exert ef-
fects in early hepatogenesis through similar tissue inter-
actions. Studies have shown that the cardiogenic meso-
derm, which is transiently opposed to the prospective
hepatic endoderm, provides a signal that induces liver
progenitors in the endoderm (8). Although this inductive
property of the precardiac mesoderm was necessary for
determining the hepatic lineage commitment, it was not
sufficient for hepatocyte differentiation. Furthermore,
during induction of the endoderm with the intervention
of precardiac mesoderm via reciprocal signaling, GATA-
4 and HNF-3B are key transcription factors that lead to
induction of downstream effectors of hepatic differenti-
ation (9).
Members of the TGF- family control growth and dif-
ferentiation and have important functions during embry-
onic development (10,11). BMPs are a subclass of the
TGF- superfamily active in the developing heart (12).
BMPs bind to and activate different serine/threonine ki-
nase receptors (BMPR-I and BMPR-II). Upon activation,
BMP receptors recruit and phosphorylate several recep-
tor-regulated Smad transcription factors (Smad1, Smad5,
or Smad-8), which then interact with Smad4, followed
by translocation of the heteromeric Smad complex to the
nucleus where it associates with other transcription fac-
tors to activate specific BMP-responsive genes (13–15).
Three classes of Smads have been defined: the receptor-
regulated Smads (R-Smads); the co-Smads (Smad-4), and
the inhibitory Smads (I-Smads). Smad proteins are re-
cruited to specific target genes via their interactions with
distinct transcriptional cofactors. Investigating the mech-
anism that mediates the selective response of the embry-
onic mesoderm to BMP signaling is likely to provide in-
valuable insight into the molecular basis of cardiac
specification, which is poorly understood. Furthermore,
a separate pathway involving the TGF--activated kinase
1 (TAK1) and p38 mitogen-activated protein kinase
(MAPK) is reportedly activated by BMPs in some cells
(16,17).
In contrast to the well-investigated roles of the signal-
ing molecules described above, the function of Wnt fam-
ily members in vertebrate cardiogenesis is currently un-
der investigation. Wnt/Wg genes, related to wingless in
Drosophila, encode a number of secreted proteins that
play critical roles in the development of many organisms,
especially in cell fate and patterning (18–20). Once Wnt
molecules have bound to their receptors, the cytosolic
phosphoprotein Dsh or Frz becomes activated, which, in
turn, leads to inactivation of GSK-3. Inhibition of GSK-
3 leads to elevated levels of cytosolic -catenin. GSK-3
inhibits the Wnt pathway, by phosphorylating amino-ter-
minal -catenin residues, directing -catenin toward the
degradation pathway. In regulating the stability of cy-
tosolic -catenin, GSK-3 is accompanied by at least three
different molecules: adenomatous polyposis coli (APC),
Axin (also known as conductin), and GSK-3 binding pro-
tein (GBP). APC contains a -catenin, as well as a GSK-
3 binding domain (21). But the role of Wnt proteins in
heart development is complex, which arises from the ex-
istence of different Wnt signal transduction cascades. To
date, only Wnt-3, Wnt-8, and Wnt-11 have been ascribed
a promoting role in cardiac differentiation from the
mouse embryonic carcinoma stem cell line P19 (22,23).
However, this does not exclude positive regulatory roles
for other Wnt proteins expressed in cardiac tissue. Tar-
geted gene disruptions of different Wnt genes in mice
suggest that the functions of these proteins are inter-
changeable.
Almost all of the reports on the reciprocal signaling of
the endodermal derivatives in cardiogenesis are based on
tissue explant systems in chick, quail, or Xenopus. In our
previous study, we have shown a simple and effective
strategy for co-differentiation of mouse ES cells into car-
diac myocytes and hepatocyte-like cells without using
exemplary cardiotrophic factors and also without em-
ploying an in vitro co-culture system. We have also dem-
onstrated that BMPs and FGFs secreted from the sur-
rounding hepatocyte-like cells play the role of intrinsic
signals in differentiation of cardiomyocytes (24).
In light of the above considerations, we undertook the
present study to define further the obligatory role of Smad
molecules as effectors of downstream events leading to
cardiac differentiation from mouse ES cells. The activa-
tion of Wnt signaling pathway in cardiogenic develop-
ment is implicated by our results.
MATERIALS AND METHODS
Mouse ES cell culture, co-differentiation of
cardiomyocytes, and hepatocyte-like cells
J1 mouse ES cells (ATCC, Manassas, VA) were grown
on a mitotically inactivated (mitomycin-c) mouse embry-
onic fibroblast feeder layer. The medium consisted of Dul-
becco’s modified Eagle medium (DMEM) (no-pyruvate,
PAL AND KHANNA
30
high-glucose formulation; GIBCO-BRL, Grand Island, NY)
supplemented with 15% fetal bovine serum (FBS; Hyclone,
Logan, UT); 1 nonessential amino acids, 2.0 mM gluta-
mine, 1,000 U/ml mouse LIF/ESGRO
®
, 100 M 2-mer-
captoethanol, 100 U penicillin, and 100 g/ml streptomycin
(all from GIBCO-BRL). This medium inhibits differentia-
tion of ES cells and is used until differentiation is initiated.
To initiate differentiation, cells were first cultured on 0.1%
gelatin- (Sigma, St. Louis, MO) coated plates without feeder
layers. For differentiation of ES cells, EBs were generated
by the hanging drop method in suspension culture for 4 days
in the absence of leukemia inhibitory factor (LIF). After
their generation, 10–15 EBs were seeded onto 35-mm tis-
sue culture plates (Nunc, Roskilde, Denmark) precoated
with 0.5% poly-
L
-lysine (Sigma) in DMEM medium sup-
plemented with 15% FBS, 50 nM basic FGF (R&D Sys-
tems, Minneapolis, MN). Rhythmic beating of EB out-
growths, surrounded by oval-shaped hepatocyte-like cells,
was observed on days 8–9 of differentiation, and the cells
continued to beat for more than 30 days in culture.
RNA extraction and RT-PCR analysis
Total RNA was isolated by the TRIzol method (Invit-
rogen) according to the manufacturer’s protocol. A total
of 1 g of RNA treated with RNase-OUT ribonuclease in-
hibitor (Invitrogen, Carlsbad, CA) was used for cDNA syn-
thesis. Reverse-transcription using Superscript reverse
transcriptase-II (Invitrogen) and oligo(dT) (Invitrogen)
was carried out to prime the reaction. PCR primers were
selected to distinguish between cDNA and genomic DNA
by using individual primers specific for different exons.
cDNA (2 l) was amplified by PCR using Abgene 2
PCR master mix (Abgene: Advanced Biotechnologies,
Ltd., Epsom, Surrey, UK) and appropriate primers (see
Table 1). The expression of genes such as GAPDH, TTR,
AFP, albumin, cTnT, -MHC, MLC-2v, Smad-1 and -5,
Smad-4, GATA-4, Nkx2.5, MEF-2C, Wnt8b, Wnt3, -
catenin, c-myc, cyclin-D1, BMP-2, BMP-5, and FGFR-4
were checked. For all of the genes, PCR was performed
for 35 cycles, consisting of an initial denaturation at 94°C
for 1 min, then 94°C for 30 sec, an annealing temperature
of the respective gene primer for 45 sec (for T
m
values of
individual primers, see Table 1), 72°C for 1 min, and was
terminated by final extension at 72°C for 5 min.
Immunochemistry
The differentiated cells were tested for cytoplasmic and
nuclear markers by immunofluorescence analysis as de-
scribed in our earlier report (24). Briefly, EB outgrowths
were mechanically dissected, enzymatically dispersed us-
ing trypsin-EDTA (0.5% trypsin, 0.53 mM EDTA; Life
Technologies, Inc., Grand Island, NY) for 5 min at 37°C;
plated on poly-
L
-lysine-coated two-well-chambered glass
slides, and incubated for 48 h. After fixing the cells with
4% paraformaldehyde, the cells were permeabilized with
0.2% Triton X-100 for 5 min at room temperature. The cells
were then blocked with phosphate-buffered saline (PBS)
containing 1% bovine serum albumin (BSA) for 1 h at room
temperature and were incubated with primary antibody so-
lutions (Smad-4, Santa Cruz, Santa Cruz, CA; -catenin,
Santa Cruz; -MHC, Chemicon, Temecula, CA) diluted
with 1% BSA in PBS overnight at 4°C followed by incu-
bation with secondary antibody solution, coupled with a
fluorescent label fluorescein isothiocyanate (FITC) at room
temperature for 1 h on a rocker. Additionally, cells were
counterstained with DAPI (1 g/ml; Sigma). The slides
Smad AND Wnt SIGNALING IN CARDIAC DIFFERENTIATION
31
T
ABLE
1. D
ETAILS OF
P
RIMER
U
SED
Name of Annealing Product
gene temp (C°) Primer sequence (5-3) size (bp)
Smad-1/5 63 ATGAATGTGACCAGCTTGTTT 349
CTGCTTGGAACCAAATGGGAA
Smad-4 55 AAGGTGGGGAAAGTGAAAC 250
ATGCTTTAGTTCATTCTTGTG
Wnt-3 60 ACACTTGAGCAGAACGGATACA 207
TGGATACAGCAGGTTGGTAGG
Wnt-8b 55 AATGTCTGACTTGAAATGAAA 190
AATGGTTAGAAGAGGTTGGC
-Catenin 62 GCCTGCAGAACTCCAGAAAG 135
GTGGCAAAAACATCAACGTG
Cyclin-D1 62 TCTCCTGCTACCGCACAAC 749
TTCCTCCACTTCCCCCTC
c-myc 60 CGCGCCCAGTGAGGATATC 281
CCACATACAGTCCTGGATGAT
For details of the other primer pairs used, please refer to our previous report (24).
were then mounted with DPX mountant and examined un-
der an inverted fluorescence microscope (Nikon Eclipse
E600, Kanagawa, Japan).
Cell fractionation and western blotting of
EB outgrowths
Spontaneously beating EB outgrowths, each compris-
ing of at least 10
3
cells, were harvested, washed twice
with PBS, and then lysed using M-PER mammalian cell
extraction buffer (Pierce, Rockford, IL). Whole-cell
lysates were centrifuged at 120,000 g for 30 min at
4°C, and the resulting supernatant leaving the debris was
collected. Protein concentrations were determined using
Bradford method (BioRad, Hercules, CA), and 25-g
samples of soluble proteins were boiled in 2% sodium
dodecyl sulfate (SDS) sample buffer (with 1 mM -mer-
captoethanol) for 5 min, then separated on 12% SDS-
polyacrylamide gel electrophoresis (PAGE) gels and
electrically transferred to polyvinylidene fluoride (PVDF)
membranes (Pall Corp., Mumbai, India). Blots were
stained with Red Ponceau-S stain to verify the loading
and transfer of the proteins, blocked with 10% skim milk
in tris-buffered saline-Tween (TBST), and sequentially
probed with a 1:500 dilution of indicated primary anti-
bodies, including Smad-1, -5, and -8, Smad-4, Wnt-3, Wnt-
8b, FRP-1, GSK-3, -catenin (Santa Cruz) overnight at
4°C. Bound antibody was visualized using appropriate
secondary horseradish peroxidase (HRP) or alkaline
phosphatase (ALP) conjugates. The signals were devel-
oped using a 3,3-diaminobenzidine tetrahydrochloride
(DAB) kit (Vector Laboratories, Burlingame, CA) and or
BCIP/NBT alkaline phosphatase substrate tablets (Sigma).
RESULTS
Differentiation of cardiomyocytes interspersed
with hepatocyte-like cells
In our earlier report, we showed the generation of spon-
taneously beating cardiomyocytes surrounded by hepato-
cyte-like cells. Using the same methodology, we used
phase-contrast microscopy, which revealed the appearance
of spontaneously beating EB outgrowths at days 8–10 of
differentiation (Fig. 1A). The rate of the contraction of the
cells was recorded to be at its maximum on the 15th day
of differentiation, and the cardiomyocytes were able to re-
tain the contractility up to 30 days or longer in culture.
Polyhedral to oval-shaped hepatocyte-like cells were con-
firmed to be present surrounding the cardiac bodies (Fig.
1B). The identity of both of the cell types was ascertained
by reverse transcriptase (RT)-PCR (Fig. 1C) using tissue-
specific markers like transthyretin (TTR), alpha feto-pro-
tein (AFP), and albumin for liver-specific gene expression
and cTnT, -MHC, and MLC-2V for heart-specific gene
expression respectively.
Signaling mechanisms induced by BMP-2, -5, and
-7 are mediated through Smad-1, -5, and -8
Smad proteins are important mediators of signaling in-
duced by TGF- family members. It is also known that
Smad-1, -5, and -8 are involved in the TGF- pathway
evoked by BMP and it subsequently binds to the serine/thre-
onine kinase receptors BMPR types I and II. Therefore, we
looked for the activation status of these proteins in in vitro
cardiogenesis in response to the intrinsic signals like BMPs
and FGFs. In our earlier experiments, we have reported the
up-regulation in mRNA levels of BMP-2, -5, and -7 along
with FGFR-2 and -4 stimulated by the adjacent hepatocyte-
like cells. We further investigated the molecular mecha-
nisms behind the initial activation of these signaling mol-
ecules. In our study, we have used noggin, a potent inhibitor
of the BMP/Smad pathway. Noggin at high concentration
is capable of binding BMP ligand with high affinity and
can abolish BMP activity by blocking its binding to a cog-
nate cell-surface receptor (25). Therefore, we treated the
cells with 500 ng/ml of noggin/Fc chimeric protein (Sigma)
on the 4th day of differentiation to antagonize the effect of
PAL AND KHANNA
32
FIG. 1. Co-differentiation of cardiomyocytes and hepatocyte-
like cells from mouse ES cells. Phase-contrast micrographs
showing day-15 contracting cardiomyocytes (A) and oval-
shaped hepatocyte-like cells (B). Scale bars, 50 m. (C) Gene
expression analysis of differentiated cells with liver and cardiac
tissue-specific primers including TTR, AFP, albumin, cTnT,
-MHC, and MLC-2V, respectively. GAPDH is used as a
housekeeping gene control.
intrinsic BMP signaling and to examine the changes in the
downstream events. We had observed that lower concen-
trations of noggin (100 or 200 ng/ml) were not able to block
BMP activity (data not shown). The EB outgrowths were
harvested and used for immunofluorescence and gene ex-
pression analysis, as described in the earlier report. For
western blotting, the cells were lysed in M-PER mammalian
cell extraction buffer. Equal amounts of proteins were sep-
arated by electrophoresis and were transferred to a PVDF
membrane. The membranes were then probed with suitable
antibodies. The actin levels were used as loading controls.
We observed enhanced expression of the Smad-1, -5,
and -8 and Smad-4 on the 15th day of differentiation in
comparison to the undifferentiated mouse ES cells (Fig.
2A,B). After the treatment of the cells with noggin chi-
meric protein, the up-regulation of Smad proteins was re-
verted back to basal levels, as determined by both gene
expression and protein analysis (Fig. 2A,B). Furthermore,
a positive expression of cytoplasmic Smad-4 protein in day
15 differentiated cells was demonstrated by immunostain-
ing with less or no expression in the cells exposed to nog-
gin (Fig. 2C,D,E). Mouse embryonic fibroblast (MEF)
cells were used as a negative control (Fig. 2F).
The results clearly indicate that in response to BMP-
2, -5, and -7 secreted by the hepatocyte-like cells, BMP
receptors recruit Smad-1, -5, and -8, which in turn
translocate to the nucleus and activate the common Smad,
Smad-4. Blocking BMP signaling by application of ex-
ogenous noggin reverses the regulation of the Smad pro-
teins and its downstream effectors.
Activation of cardiogenic transcription factors by
Smad-4 in the nucleus
Upon activation, receptor-activated Smad proteins
(Smad-1, -5, -8) are translocated to the nucleus and in-
teract with the common Smad (Smad-4). In the next step,
Smad-4 oligomer binds to the DNA of the target genes
like GATA-4, Nkx2.5, and MEF-2C, which thereafter
play a pivotal role in specification of the cardiac fate and
morphogenesis of the heart.
Hence, we examined the levels of GAT-4, Nkx2.5, and
Smad AND Wnt SIGNALING IN CARDIAC DIFFERENTIATION
33
FIG. 2. Differential activation of Smad proteins in cardiac differentiation. (A) RT-PCR analysis shows the modulation of Smad-
1 and -5, Smad-4, and the subsequent up-regulation of their downstream effectors like GATA-4, Nkx2.5, and MEF-2C. (B) The
response of Smad-1, -5, and -8, and Smad-4 proteins to the intrinsic BMP signaling could be reversed by the application of nog-
gin, a potent inhibitor of BMP ligand as detected by western blotting. The intensities of the protein expression were normalized
against signals obtained with -actin. (C) Immunochemistry shows cytoplasmic localization of Smad-4 in day-15 differentiated
cells whereas cells treated with noggin (D) were devoid of positively stained cells. (E) Presence of cells was confirmed by coun-
terstaining with the nuclear stain DAPI (1 g/l). (F) MEF cells were stained with goat anti-Smad-4 immunoglobulinG (IgG)
to ascertain the specificity of the antibody. Scale bars, 50 m.
A
B
MEF-2C mRNA in the cells before and after exposure to
noggin. We observed that there was a transient increase
in the expression of these three transcription factors co-
incident with the onset of cardiac differentiation and was
reversible with the treatment of the BMP antagonist.
These data indicate that BMPs favor the commitment of
mouse ES cells into cardiac phenotype via Smad proteins.
Wnt/-catenin pathway is activated at the early
stage of differentiation
Upon Wnt signaling, the constitutive kinase activity of
GSK-3 is inhibited and allows the accumulation of -
catenin in the nucleus. The frizzled form of the trans-
membrane proteins functions as a receptor for the Wnt
family members and aids in the regulation of intracellu-
lar levels of -catenin. -Catenin is essential for the tran-
scriptional activity of TCF/lymphoid enhancing factor
(LEF). TCF-1 and LEF-1 have been shown to be ex-
pressed in largely overlapping, complex patterns during
embryogenesis. Among the number of TCF/LEF target
genes identified (26), we concentrated on c-myc and cy-
clin-D1, both of which have important implications in
understanding the role of Wnt signaling.
We first used RT-PCR analysis to detect the temporal
changes of Wnt-3 and Wnt-8b in the differentiated cells.
Wnt-3 and Wnt-8b exhibited early expression in the un-
differentiated cells. However, both were induced to ele-
vated levels within 15 days of differentiation (Fig. 3A).
Likewise, data from protein analysis by western blotting
support the gene expression results (Fig. 3B). Further-
more, FRP-1, a secreted frizzled-related protein, which
PAL AND KHANNA
34
FIG. 3. Wnt signaling mediates in vitro cardiogenesis from mouse ES cells. (A) RT-PCR analysis confirms the activation of
Wnt-3, Wnt-8b, and -catenin followed by subsequent upregulation of the TCF/LEF target genes like c-myc and cyclin-D1. (B)
Likewise, protein analysis by western blotting supported the transcriptional profiling. FRP-1, being a receptor to Wnt family
members, is up-regulated followed by the down-regulation of GSK-3 in two isoforms, GSK-3, and GSK-3 (52 and 40 kD).
Upon addition, Fz-8/Fc chimeric protein, being an inhibitor of Wnt, was able to block the Wnt signaling and the downstream
events thereafter, as determined by the identifying the reduced levels of the related proteins. (C) -Catenin, the key player in
canonical Wnt signaling, is shown to accumulate in the cells on the 15th day of differentiation and was reduced to lower levels
post Fz-8/Fc treatment as detected by immunochemistry (D). (E) Cells were similarly counterstained with DAPI (1 g/l). (F)
MEF was used to evaluate the specificity of goat anti--catenin IgG. Scale bars, 50 m.
A
B
acts as receptor to Wnt family of proteins, was shown to
be up-regulated on day 15 of differentiation (Fig. 3B).
We extended our examination to check the regulation of
GSK-3, a serine/threonine-directed kinase in this system.
Intriguingly, we observed the presence of two related
forms of GSK-3, GSK-3 and GSK-3 by western blot-
ting in the undifferentiated cells through the differentia-
tion of cardiomyocytes surrounded by hepatocyte-like
cells (Fig. 3B).
To assess whether functional signaling is activated at
the time of Wnt induction, we examined cytosolic -
catenin, the crux of the canonical Wnt signal transduc-
tion pathway (22,27). Wnt stimulated the accumulation
of soluble -catenin (Fig. 3A,B). Simultaneous treatment
with 500 ng/ml Fz-8/Fc chimeric protein (R&D Systems,
USA), an antagonist for Wnt-8a and potentially for other
Wnt proteins (22), decreased -catenin to a basal level
(Fig. 3A,B), as evidenced by RT-PCR and western blot-
ting of whole-cell lysates. This indicates that the accu-
mulation of -catenin is regulated by an autocrine or
paracrine circuit in the system, involving endogenous
Wnt proteins. Conversely, as expected, -catenin was de-
creased upon inhibition of Wnt signaling, as determined
by immunochemistry. As a third criterion, to confirm the
activation of the canonical Wnt pathway, TCF/LEF-de-
pendent transcription of the target genes like c-myc and
cyclin-D1 was evaluated. Recruitment of Wnt proteins
induced a considerable increase in the mRNA levels of
both the genes on day 15 of differentiation (Fig. 3A).
Wnt/-catenin signaling is required to
enhance cardiac differentiation
To understand the possible role of Wnt-mediated sig-
naling in early cardiogenesis, we further monitored dif-
ferentiation induced by the adjoining endodermal cells,
with or without Fz-8/Fc. Treatment with soluble Wnt in-
hibitor prevented GATA-4, Nkx2.5, MEF-2C, and -
MHC induction at least through day 15 of differentiation
(Fig. 4A). Likewise, Fz-8/Fc inhibited the expression of
BMP-2, BMP-5, and FGFR-4 (Fig. 4A), which indicates
that the Wnt pathway lies upstream to the induction of
these cardiac differentiation factors. We extended our ex-
amination to ascertain the direct implication of Wnt in-
duction in cardiac differentiation. We counted the num-
ber of beating regions and found that there was a
significant reduction in the total number of contracting
cardiac bodies on days 9 through 15 in differentiation af-
ter application of Fz-8/Fc (Fig. 4B). Although, there was
also a small decrease in the beating rate in terms of the
beats/minute, no major alteration in the phenotype of the
beating cardiomyocytes was observed. Furthermore, im-
munofluorescence analysis shows that -MHC, a marker
for mature cardiac muscle, is comprehensively expressed
in day-15 beating cardiomyocytes but disappears with the
exposure of Fz-8/Fc inhibitor (Fig. 4C,D). Thus, Wnt sig-
naling plays a critical role not only in early cardiogene-
sis but also in the formation of mature spontaneously
beating cardiomyocytes from ES cells.
Smad AND Wnt SIGNALING IN CARDIAC DIFFERENTIATION
35
FIG. 4. Activation of Wnt signaling modulates the regulation of its target genes. (A) By RT-PCR analysis, a transient increase
in the mRNA levels of the cardiogenic transcription factors like GATA-4, Nkx2.5, MEF-2C, and -MHC was demonstrated. In-
terestingly, Fz-8/Fc was also seen to have an inducing effect on BMP-2, BMP-5, and FGFR-4 expression. (B) Effect of
Fz-8/Fc inhibitor on the number of beating regions. (C) Immunofluorescence analysis shows presence of -MHC protein in day-
15 cardiomyocytes whereas (D) little or no positive expression of the same protein could be detected post Fz-8 treatment. Scale
bars, 50 m.
B
A
C
D
DISCUSSION
The heart is perhaps the first organ to be formed in the
vertebrate embryo. Development and acquisition of a car-
diac fate by embryonal mesodermal cells is a fundamen-
tal step in heart formation, which is crucial for further
development. Several discrete steps initiate heart devel-
opment in general. Commitment to cardiac fate results
from inductive interactions during gastrulation. In am-
phibian and avian embryos, the endoderm adjacent to the
mesodermal cardiac precursors is the source of instruc-
tive signaling capable of specifying a cardiac fate
(28–30). Likewise, most of the recent work on the
prospective role of endoderm-derived growth factors be-
longing to the TGF- superfamily in cardiac develop-
ment has been performed in avian species or primitive
species, such as chick, quail, and Xenopus (12,31). There-
fore, it is important to elucidate when, where, and how
mesodermal cells are instructed to assume the cardiac fate
for understanding the entire body of mechanisms that op-
erate later in heart development. To date, this problem
remains elusive and undefined.
In our earlier report, we demonstrated that during dif-
ferentiation of ES cells, the hepatocyte-like cells appear-
ing adjacent to the spontaneously beating “cardiac bod-
ies” play an important role in regulating the fate of the
ES cells toward the cardiac phenotype by providing nec-
essary intrinsic signals in form of BMPs and FGFs (24).
Prior to this, exogenous application of BMP-2 and -4 was
demonstrated to induce commitment of ES cells to car-
diac differentiation within EBs (32). Conversely, we
demonstrated the differentiation of spontaneously beat-
ing cardiomyocytes authenticated by the expression of
cardiac tissue-specific genes, including cTnT, -MHC,
and MLC-2V (Fig. 1A,C) without using exogenous
BMPs or any other cardiotropic factors.
The Smad signaling pathway is critical for transmit-
ting TGF- superfamily signals from the cell surface to
the nucleus (33,34). TGF- family members initiate their
cellular responses by binding to distinct receptors with
intrinsic serine/threonine kinase activity and activation of
specific downstream intracellular effects termed Smad
proteins. Smad proteins relay the signal from the cell
membranes to the nucleus, where they effect the tran-
scription of target genes by recruiting co-activators and
co-repressors to a wide array of DNA-binding partners
(Fig. 5). The different members of the TGF- family
make use of specific Smad proteins to achieve specificity
(15). BMP usually is shown to induce Smad-1, -5, and
-8 as its downstream effector, whereas TGF-
1
is com-
monly known to stimulate Smad-2 and -3. Thus, we
looked at the activity of Smad-1, -5, and -8 in our in vitro
system. As expected, we noticed increased levels of
Smad-7, -5, and -8 and the common Smad Smad-4 (Fig.
2A,B), which is in concurrence with the earlier reports.
Furthermore, we checked the mRNA and protein levels
of the cardiogenic transcription factors like GATA-4,
Nkx2.5, and MEF-2C as a downstream event. These tran-
scription factors are known to activate the promoters of
several cardiac genes, such as myosin light chain, tro-
ponin T, tropinin I, -MHC, and ANP. Interestingly, we
observed a significant increase in these target molecules,
which may be consequential in inducing formation of
beating cardiomyocytes.
As a third criterion, we verified the involvement of BMPs
in this signaling pathway. To do so, we used a noggin chi-
meric protein to block the BMP activity on day 4 of dif-
ferentiation and checked the endogenous BMP levels (data
not shown) and the downstream regulators of BMP at pro-
gressive days of differentiation. We observed that noggin
was able to recover the elevated levels of Smad-1, -5, and
-8, Smad-4, and the target genes such as GATA-4, Nkx2.5,
and MEF-2C to basal levels (Fig. 2A–C) as studied by RT-
PCR, western blotting, and immunofluorescence analyses.
Our results indicate that during differentiation in response
to BMPs secreted by the adjacent hepatocyte-like cells,
Smad proteins are recruited, thus activating the key car-
diogenic transcription factors favoring formation of spon-
taneously beating cardiomyocytes. However, experiments
are in progress to show the specific binding of Smad
oligomers to the DNA-binding proteins.
BMP has been reported to activate the transcription of
Wnt genes in certain cells (35,36). Recent studies in chick
embryos revealed that Wnt signaling could dictate bio-
logical fate in which BMP signaling is required but not
sufficient, such as neural inhibition of ectoderm, neural
crest induction, and apoptosis (37–39). In addition, Hus-
sein and co-workers have delineated the molecular mech-
anism underlying the induction of Msx2 promoter by co-
operative activation of Wnt and BMP signaling pathways
through the interaction of Smad-4 with the LEF1 tran-
scription factor (40). On the basis of these reports, we
have speculated that convergence of the BMP and Wnt
signaling pathways is also required to enhance the ex-
pression of cardiogenic transcription factors such as
GATA-4, Nkx2.5, and MEF-2C, which in turn may in-
duce cardiac differentiation.
Activation of the Wnt/-catenin signaling cascade was
an early event in cardiac differentiation of pluripotent J1
mouse ES cells, as measured by Wnt-3 and Wnt-8b in-
duction, FRP-1 stimulation, GSK-3 down-inhibition,
accumulation of -catenin, and transcription of TCF/LEF
target genes including c-myc and cyclin-D1 (Fig. 3A–C).
Blocking Wnt receptor interactions with soluble Fz pro-
teins largely or completely blocked the cardiogenic path-
way, including induction of the earliest markers of car-
diac differentiation like GATA-4, Nkx2.5, MEF-2C, and
even -MHC, a late cardiac muscle-specific marker (Fig.
4A). The effect of the activation of these early-stage car-
diac transcription factors on cardiac differentiation was
PAL AND KHANNA
36
ascertained by the decrease in the number of beating re-
gions (Fig. 4B) and subsequent depletion of -MHC
protein expression (Fig. 4C,D) with Fz-8/Fc chimeric
protein. Thus, endogenous Wnt proteins mediate cardio-
genesis in mouse ES cells and do so via the canonical -
catenin pathway. Fz-8 protein itself had an inducing ef-
fect on BMP-2, BMP-5, and FGFR-4, indicating an
indirect role of endogenous BMPs in this system. How-
ever, our conclusions differ from inhibitory roles found
for Wnt-3a and Wnt-8 in Xenopus and chicks (41–43).
We emphasize that apart from potential phylogenetic dis-
similarities, the studies also differ inherently (cultured
cells vs. explants and embryos) in the stage of matura-
tion, perturbations, and diversity of the cell types pres-
ent. But, our results are in agreement with the report by
Pandur and co-workers, showing the stimulation of car-
diogenesis by Wnt-11 via the noncanonical pathway in
Xenopus and P19 EC cells (23). Therefore, BMPs via
Smad signaling and Wnt proteins via accumulation of cy-
tosolic -catenin exert a tight control over mammalian
cardiogenesis at least in mouse ES cells.
Hence, this dual regulation of Wnt and BMP appears
to be frequent in mammalian development. Moreover,
Wnt proteins and BMPs are expressed in many overlap-
ping tissues and, being morphogens, this is consistent
with the idea that a formation of a gradient of ligand
would result in graded expression of common target
genes. But, given the extraordinary diversity and over-
lapping expression of the Wnt ligands and receptors, a
complete genetic analysis of the Wnt family, associated
downstream events and interactions, even confined to the
potential involvement of Wnt proteins in cardiogenesis
is far from being straightforward and comprehensive.
CONCLUSION
The present study was undertaken to understand the
molecular mechanisms behind the inductive role of en-
dodermal derivatives in early cardiogenesis of mouse ES
cells. In summary, our results demonstrate the BMP-2,
-5, and -7 and FGF-2 and -4 secreted by the hepatocyte-
like cells mediate the simultaneous activation of Smad
and Wnt signal transduction pathways and their down-
stream events, leading to enhancement of cardiac myo-
genesis. However, the function of endogenous Smad and
Wnt proteins emerge more clearly from inhibitor studies.
To our knowledge, this is the first report where we have
elucidated the obligatory role of interactive signaling
pathways in in vitro cardiogenesis, thereby posing im-
Smad AND Wnt SIGNALING IN CARDIAC DIFFERENTIATION
37
FIG. 5. Schematic illustration of representative signaling pathways in cardiac myogenesis. Sequential activation of various
genes/proteins at different stages of the Smad signaling cascade is elucidated, which ultimately leads to the regulation of the tar-
get genes in early cardiogenesis like GATA-4, Nkx2.5, and MEF-2C.
portant questions for ES cell biology and mammalian car-
diac development. Further experiments to identify other
players and their relationships in these pathways are in
progress.
ACKNOWLEDGMENTS
The authors are thankful to the Therapeutic Proteins
and Gene Therapy Group (R.L.S.) for providing ALP
conjugates and the developing reagent (Sigma, USA). We
thank Dr. Mahendra S. Rao for his critical review of the
manuscript and helpful suggestions. The authors grate-
fully acknowledge Reliance Life Sciences (http://www.
relbio.com) for providing an opportunity to work on this
project.
REFERENCES
1. Rossant J. (2001). Stem cells from mammalian blastocyst.
Stem Cells 19:477–482.
2. Thomson JA, J Itskovitz-Eldor, SS Shapiro, MA Waknitz,
JJ Swiergiel, VS Marshall and JM Jones. (1998). Embry-
onic stem cell lines derived from human blastocysts. Sci-
ence 282:1145–1147.
3. Desbaillets I, U Ziegler, P Groscurth and M Gassmann.
(2000). Embryoid bodies: an in vitro model of mouse em-
bryogenesis. Exp Physiol 85:645–651.
4. Maltsev VA, J Rohwedel, J Hescheler and AM Wobus.
(1993). Embryonic stem cells differentiate in vitro into car-
diomyocytes representing sinusnodal, atrial and ventricu-
lar cell types. Mech Dev 44:41–50.
5. Lough J, M Barron, M Brogley, Y Sugi, DL Bolender and
X Zhu. (1996). Combined BMP-2 and FGF-4, but neither
factor alone, induces cardiogenesis in non-precardiac em-
bryonic mesoderm. Dev Biol 178:198–202.
6. Barron M, J Gao and J Lough. (2000). Requirement for
BMP and FGF signaling during cardiogenic induction in
non-precardiac mesoderm is specific, transient, and coop-
erative. Dev Dyn 8:383–393.
7. Powers CJ, SW McLeskey and A Wellstein. (2000). Fi-
broblast growth factors, their receptors and signaling. En-
docr Relat Cancer 7:165–197.
8. Le Douarin NM and FV Jotereau. (1975). Tracing of cells
of the avian thymus through embryonic life in interspecific
chimeras. J Exp Med 142:17–40.
9. Zaret KS. (2002). Regulatory phases of early heart develop-
ment: paradigms of organogenesis. Nature Rev 3:499–512.
10. Derynck R, RJ Akhurst and A Balmain. (2001). TGF-beta
signaling in tumor suppression and cancer progression. Na-
ture Genet 29:117–129.
11. Massague J and D Woton. (2000). Transcriptional control
by the TGF-beta/Smad signaling system. EMBO J
19:1745–1754.
12. Schultheiss TM, JB Burch and AB Lassar. (1997). A role
of bone morphogenetic proteins in the induction of cardiac
myogenesis. Genes Dev 11:451–446.
13. Derynck R, Y Zhang and XH Fang. (1998). Smads: tran-
scriptional activators of TGF-beta responses. Cell 95:737–740.
14. Heldin CH, K Miyazono and P ten Dijke. (1997). TGF-
beta signalling from cell membrane to nucleus through
SMAD proteins. Nature 390:465–471.
15. Massague J and YG Chen. (2000). Controlling TGF-beta
signaling. Genes Dev 14:627–644.
16. Eggen BJ, GF Benus, S Folkertsma, LJ Jonk and W Krui-
jer. (2001). TAK1 activation of the mouse JunB promoter
is mediated through a CCAAT box and NF-Y. FEBS Lett
506:267–271.
17. Goswami M, AR Uzgare and AK Sater. (2001). Regula-
tion of MAP kinase by the BMP-4/TAK1 pathway in Xeno-
pus ectoderm. Dev Biol 236:259–270.
18. Arias AM, AM Brown and K Brennan. (1999). Wnt signalling:
pathway or network? Curr Opin Genet Dev 9:447–454.
19. Bejsovec A. (1999). Wnt signaling shows its versatility.
Curr Biol 9:R684–R687.
20. Moon RT, B Bowerman, M Boutros and N Perrimon.
(2002). The promise and perils of Wnt signaling through
beta-catenin. Science 296:1644–1646.
21. Molenaar Mand Destree O. (1999). A tight control over
Wnt action. Int J Dev Biol 43:675–680.
22. Nakamura T, M Sano, Z Songyang and MD Schneider.
(2003). A Wnt- and beta-catenin-dependent pathway for
mammalian cardiac myogenesis. Proc Natl Acad Sci USA
100:5834–5839.
23. Pandur P, M Lasche, LM Eisenberg and M Kuhl. (2002).
Wnt-11 activation of a non-canonical Wnt signalling path-
way is required for cardiogenesis. Nature 418:636–641.
24. Pal R and A Khanna. (2005). Role of hepatocyte-like cells
is differentiation of cardiomyocytes from mouse embryonic
stem cells. Stem Cells Dev 14:153–161.
25. McMahon JA, S Takada, LB Zimmerman, CM Fan, RM
Harland and AP McMahon. (1998). Noggin-mediated an-
tagonism of BMP signaling is required for growth and
patterning of the neural tube and somite. Genes Dev
12:1438–1452.
26. Giles RH, JH van Es and H Clevers. (2003). Caught up in
a Wnt storm: Wnt signaling in cancer. Biochim Biophys
Acta 1653:1–24.
27. Papkoff J, B Rubinfeld, B Schryver and P Polakis. (1996).
Wnt-1 regulates free pools of catenins and stabilizes APC-
catenin complexes. Mol Cell Biol 16:2128–2134.
28. Sugi Y and J Lough. (1994). Anterior endoderm is a spe-
cific effector of terminal cardiac myocyte differentiation of
cells from the embryonic heart-forming region. Dev Dyn
200:155–162.
29. Nascone M and M Mercola. (1995). An inductive role for
the endoderm in Xenopus cardiogenesis. Development
121:515–523.
30. Schultheiss TM, S Xydas and AB Lassar. (1995). Induc-
tion of avian cardiac myogenesis by anterior endoderm. De-
velopment 121:4203–4214.
31. Antin PB, TG Taylor and T Yatskievych. (1994). Precar-
diac mesoderm is specified during gastrulation in quail.
Dev Dyn 200:144–154.
PAL AND KHANNA
38
32. Behfar A, LV Zingman, DM Hodgson, JM Rauzier, GC
Kane, A Terzie and M Puccat. (2002). Stem cell differen-
tiation requires a paracrine pathway in the heart. FASEB J
16:1558–1566.
33. Ten Dijke P, MJ Goumans, F Itoh and S Itoh. (2002). Reg-
ulation of cell proliferation by Smad proteins. J Cell Phys-
iol 191:1–16.
34. Attisano L and JL Wrana. (2002). Signal transduction by
the TGF-beta superfamily. Science 296:1646–1647.
35. Hoppler S and RT Moon. (1998). BMP-2/-4 and Wnt-8 co-
operatively pattern the Xenopus mesoderm. Mech Dev
71:119–129.
36. Fischer L, G Boland and RS Tuan. (2002). Wnt-3A en-
hances bone morphogenetic protein-2-mediated chondro-
genesis of murine C3H10T1/2 mesenchymal cells. J Biol
Chem 277:30870–30878.
37. Kudoh T, SW Wilson and IB Dawid. (2002). Distinct roles
for Fgf, Wnt and retinoic acid in posteriorizing the neural
ectoderm. Development 129:4335–4346.
38. Garcia-Castro MI, C Marcelle and M Bronner-Fraser.
(2002). Ectodermal Wnt function as a neural crest inducer.
Science 297:848–851.
39. Ellies DL, V Church, P Francis-West and A Lumsden.
(2000). The WNT antagonist cSFRP2 modulates pro-
grammed cell death in the developing hindbrain. Develop-
ment 127:5285–5295.
40. Hussein SM, EK Duff and C Sirard. (2003). Smad4 and
beta-catenin co-activators functionally interact with lym-
phoid-enhancing factor to regulate graded expression of
Msx2. J Biol Chem 278:48805–48814.
41. Schneider M and M Mercola. (2001). Wnt antagonism
initiates cardiogenesis in Xenopus laevis. Genes Dev
15:304–315.
42. Marvin MJ, G Di Rocco, A Gardiner, SM Bush and AB
Lassar. (2001). Inhibition of Wnt activity induces heart for-
mation from posterior mesoderm. Genes Dev 15:316–327.
43. Tzahor E and AB Lassar. (2001). Wnt signals from the neural
tube block ectopic cardiogenesis. Genes Dev 15:255–260.
Address reprint requests to:
Dr. Aparna Khanna
Dhirubhai Ambani Life Sciences Center, South Block
R-282, TTC Industrial area of MIDC
Thane-Belapur Road, Rabale
Navi Mumbai-400 701
India
E-mail: aparna_khanna@relbio.com
Received September 5, 2005; accepted December 5,
2005.
Smad AND Wnt SIGNALING IN CARDIAC DIFFERENTIATION
39
This article has been cited by:
1. Lisa K. Martin , Nadejda V. Mezentseva , Momka Bratoeva , Ann F. Ramsdell , Carol A. Eisenberg , Leonard M. Eisenberg .
2011. Canonical WNT Signaling Enhances Stem Cell Expression in the Developing Heart Without a Corresponding Inhibition
of Cardiogenic Differentiation. Stem Cells and Development 20:11, 1973-1983. [Abstract] [Full Text] [PDF] [PDF Plus]
[Supplementary material]
2. Jin-Yong Yook , Min-Jeong Kim , Myung Jin Son , Seokyoung Lee , Yoonkey Nam , Yong-Mahn Han , Yee Sook Cho . 2011.
Combinatorial Activin Receptor-Like Kinase/Smad and Basic Fibroblast Growth Factor Signals Stimulate the Differentiation
of Human Embryonic Stem Cells into the Cardiac Lineage. Stem Cells and Development 20:9, 1479-1490. [Abstract] [Full
Text] [PDF] [PDF Plus] [Supplementary material]
3. Takatoshi Tsuchihashi, Jun Maeda, Chong H. Shin, Kathryn N. Ivey, Brian L. Black, Eric N. Olson, Hiroyuki Yamagishi,
Deepak Srivastava. 2011. Hand2 function in second heart field progenitors is essential for cardiogenesis. Developmental
Biology 351:1, 62-69. [CrossRef]
4. Santiago Roura, Jordi Farré, Leif Hove-Madsen, Cristina Prat-Vidal, Carolina Soler-Botija, Carolina Gálvez-Montón, Marta
Vilalta, Antoni Bayes-Genis. 2010. Exposure to cardiomyogenic stimuli fails to transdifferentiate human umbilical cord
blood-derived mesenchymal stem cells. Basic Research in Cardiology 105:3, 419-430. [CrossRef]
5. Min Young Lee, Hyun Woo Lim, Sang Hun Lee, Ho Jae Han. 2009. Smad, PI3K/Akt, and Wnt-Dependent Signaling Pathways
Are Involved in BMP-4-Induced ESC Self-Renewal. Stem Cells 27:8, 1858-1868. [CrossRef]
6. R. Buesen, E. Genschow, B. Slawik, A. Visan, H. Spielmann, A. Luch, A. Seiler. 2009. Embryonic Stem Cell Test Remastered:
Comparison between the Validated EST and the New Molecular FACS-EST for Assessing Developmental Toxicity In Vitro.
Toxicological Sciences 108:2, 389-400. [CrossRef]
7. L. Lin, L. Cui, W. Zhou, D. Dufort, X. Zhang, C.-L. Cai, L. Bu, L. Yang, J. Martin, R. Kemler, M. G. Rosenfeld, J. Chen, S.
M. Evans. 2007. beta-Catenin directly regulates Islet1 expression in cardiovascular progenitors and is required for multiple
aspects of cardiogenesis. Proceedings of the National Academy of Sciences 104:22, 9313-9318. [CrossRef]
8. Rajarshi Pal, Aparna Khanna. 2007. Similar pattern in cardiac differentiation of human embryonic stem cell lines, BG01V
and ReliCell # hES1, under low serum concentration supplemented with bone morphogenetic protein-2. Differentiation 75:2,
112-122. [CrossRef]
9. Rajarshi Pal, Geeta Ravindran. 2006. Assessment of pluripotency and multilineage differentiation potential of NTERA-2 cells
as a model for studying human embryonic stem cells. Cell Proliferation 39:6, 585-598. [CrossRef]
10. Deepak Srivastava, Kathryn N. Ivey. 2006. Potential of stem-cell-based therapies for heart disease. Nature 441:7097,
1097-1099. [CrossRef]
11. 2006. Correction. Stem Cells and Development 15:3, 471-471. [Citation] [PDF] [PDF Plus]
12. Denis English , Paul R. Sanberg . 2006. Neural Specification of Stem Cell Differentiation. Stem Cells and Development 15:2,
139-140. [Citation] [PDF] [PDF Plus]
