Content uploaded by Morten Lindow
Author content
All content in this area was uploaded by Morten Lindow
Content may be subject to copyright.
Available via license: CC BY-NC 2.0
Content may be subject to copyright.
Published online 23 December 2007 Nucleic Acids Research, 2008, Vol. 36, No. 4 1153–1162
doi:10.1093/nar/gkm1113
Antagonism of microRNA-122 in mice by systemically
administered LNA-antimiR leads to up-regulation of
a large set of predicted target mRNAs in the liver
Joacim Elme
´
n
1
, Morten Lindow
1
, Asli Silahtaroglu
2
, Mads Bak
2
, Mette Christensen
2
,
Allan Lind-Thomsen
2
, Maj Hedtja
¨
rn
1
, Jens Bo Hansen
1
, Henrik Frydenlund Hansen
1
,
Ellen Marie Straarup
1
, Keith McCullagh
1
, Phil Kearney
1
and Sakari Kauppinen
1,2,
*
1
Santaris Pharma, Bøge Alle
´
3, DK-2970 Hørsholm and
2
Wilhelm Johannsen Centre for Functional Genome
Research, Department of Cellular and Molecular Medicine, University of Copenhagen, Blegdamsvej 3,
DK-2200 Copenhagen N, Denmark
Received June 28, 2007; Revised November 27, 2007; Accepted November 28, 2007
ABSTRACT
MicroRNA-122 (miR-122) is an abundant liver-spe-
cific miRNA, implicated in fatty acid and cholesterol
metabolism as well as hepatitis C viral replication.
Here, we report that a systemically administered
16-nt, unconjugated LNA (locked nucleic acid)-
antimiR oligonucleotide complementary to the 5’
end of miR-122 leads to specific, dose-dependent
silencing of miR-122 and shows no hepatotoxicity
in mice. Antagonism of miR-122 is due to formation
of stable heteroduplexes between the LNA-antimiR
and miR-122 as detected by northern analysis.
Fluorescence in situ hybridization demonstrated
uptake of the LNA-antimiR in mouse liver cells,
which was accompanied by markedly reduced
hybridization signals for mature miR-122 in treated
mice. Functional antagonism of miR-122 was
inferred from a low cholesterol phenotype and de-
repression within 24 h of 199 liver mRNAs showing
significant enrichment for miR-122 seed matches in
their 3’ UTRs. Expression profiling extended to 3
weeks after the last LNA-antimiR dose revealed that
most of the changes in liver gene expression were
normalized to saline control levels coinciding with
normalized miR-122 and plasma cholesterol levels.
Combined, these data suggest that miRNA antago-
nists comprised of LNA are valuable tools for
identifying miRNA targets in vivo and for studying
the biological role of miRNAs and miRNA-
associated gene-regulatory networks in a physiolo-
gical context.
INTRODUCTION
MicroRNAs (miRNAs) are an abundant class of short
endogenous non-coding RNAs that act as important post-
transcriptional regulators of gene expression by base-
pairing to their target mRNAs, thereby mediating mRNA
cleavage or translational repression (1). An increasing
body of research shows that animal miRNAs play funda-
mental roles in cell growth, development and differentia-
tion (1,2). Recent data suggest that miRNAs are
aberrantly expressed in many human cancers and that
they may play significant roles as oncogenes or tumour
suppressors (3–6). Apart from cancer, miRNAs have also
been linked to several other diseases. For example, a
mutation in the target site of miR-189 in the human
SLITRK1 gene was shown to be associated with
Tourette’s syndrome (7), while other recent studies have
implicated miRNAs in controlling HIV replication (8) and
in coronary artery disease (9). Hence, disease-associated
human miRNAs could represent a novel group of viable
targets for therapeutic intervention. One such example is
miR-122, an abundant liver-specific miRNA, with sug-
gested roles in cholesterol, fatty acid and lipid metabolism
(10,11). It has also been shown that miR-122 interacts
with the hepatitis C virus genome facilitating viral
replication in the host cell (12).
A major challenge in understanding the biological func-
tions of miRNAs in animal development and human
disease is to identify their target mRNAs. Although
computational analyses suggest that miRNAs may be
responsible for regulating up to 30% of the human
protein-coding genes (13–15), only a few target genes
have been experimentally confirmed (16). Microarray
expression profiling has been used to detect genes
*To whom correspondence should be addressed. Tel: +45 45 17 98 38; Fax: +45 45 17 98 98; Email: sk@santaris.com
ß 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
down-regulated in response to exogenous miRNAs (17).
However, introduction of an exogenous miRNA into cells
that do not normally express it may lead to identification
of non-physiological targets. In contrast, specific inhibi-
tion of endogenous miRNAs in vivo using chemically
modified antisense oligonucleotides has the potential to
pinpoint the physiological targets and their sequence
determinants. Furthermore, development of miRNA-
targeting oligonucleotides with enhanced pharmacological
activity and optimized pharmacokinetic properties holds
promise as therapeutic agents against disease-associated
miRNAs. LNAs (locked nucleic acids) comprise a class of
bicyclic conformational analogues of RNA, which exhibit
high binding affinity to complementary RNA target
molecules and high stability in blood and tissues in vivo
(18,19). The unprecedented thermal stability of short
LNA-modified oligonucleotide probes together with their
improved mismatch discrimination has enabled sensitive
and specific miRNA detection by northern blot analysis
and by in situ hybridization (ISH) in developing animal
embryos and tissue sections (20–24). LNA oligonucleo-
tides have also been shown to mediate potent and specific
inhibition of miRNA function in vitro (25–27). In the
present study, we set out to assess the utility of LNA-
modified oligonucleotides in silencing of miRNAs in vivo
by antagonizing miR-122 in the murine liver. We report
here that a systemically administered, 16 nt, unconjugated
LNA-antimiR oligonucleotide, complementary to the 5
0
end of miR-122 leads to specific and dose-dependent
miRNA-122 antagonism in mice. Our data suggest that
miR-122 regulates the expression of a large number of
target mRNAs in adult mouse liver. Most of the identified
miR-122 targets showed only slight to moderate de-
repression implying that miR-122 might work by fine-
tuning several liver gene-regulatory networks.
MATERIALS AND METHODS
Design and synthesis of LNA oligonucleotides
The LNA oligonucleotides were synthesized as un-
conjugated and fully phosphorothiolated oligonucleotides.
The perfectly matching LNA-antimiR oligonucleotide:
5
0
-ccAttGtcAca
m
Ctc
m
Ca-3
0
(uppercase: LNA; lowercase:
DNA;
m
C denotes methyl cytosine) was complementary
to nucleotides 1–16 in the mature miR-122 sequence.
The mismatch control LNA oligonucleotide was
synthesized with the following sequence: 5
0
-ccAtt
GtcTcaAtc
m
Ca-3
0
.
In vivo experiments
NMRI female mice (Taconic M&B Laboratory Animals,
Ejby, Denmark) with 27 g average body weight at first
dosing were used in all experiments and received regular
chow diet (Altromin no 1324, Brogaarden, Gentofte,
Denmark). All substances were formulated in physiologi-
cal saline (0.9% NaCl) to final concentration allowing the
mice to receive a tail vein injection volume of 10 ml/kg.
The animals were dosed for three consecutive days with
LNA-antimiR, LNA mismatch control or saline (0.9%
NaCl), receiving daily doses from 2.5 to 25 mg/kg. In the
dose–response study, the mice were sacrificed 24 h after
last dose, whereas the mice in the duration of action study
were sacrificed 1, 2 or 3 weeks after last dose, respectively.
Real-time quantitative RT-PCR
The dissected mice livers were immediately stored in RNA
later (Ambion). Total RNA was extracted with Trizol
reagent according to the manufacturer’s instructions
(Invitrogen), except that the precipitated RNA pellet
was washed in 80% ethanol and not vortexed.
The miR-122 and let-7a levels were quantified with
mirVana real-time RT-PCR detection kit (Ambion)
following the manufacturer’s instructions, except that
200-ng total RNA was used in the reverse transcription
(RT) reaction. The RT reaction was diluted 10 times in
water and 10 ml of aliquots were subsequently used for
RT-PCR amplification according to the manufacturer’s
instructions (Ambion). A 2-fold total RNA dilution series
from untreated mouse liver RNA served as standard to
ensure a linear range (Ct versus relative copy number) of
the amplification.
mRNA quantification of selected genes was done using
standard TaqMan assays (Applied Biosystems). The
reverse transcription reaction was carried out with
random decamers, 0.5 mg total RNA and the M-MLV
RT enzyme from Ambion according to protocol. First-
strand cDNA was subsequently diluted 10 times in
nuclease-free water before addition to the RT-PCR
reaction mixture. The Applied Biosystems 7500 real-time
PCR instrument was used for amplification. A 2-fold total
RNA dilution series from a saline-treated animal served as
standard to ensure a linear range (Ct versus relative copy
number) of the amplification.
Determination of duplex melting temperature and stability
in mouse plasma
Twenty-three microlitres of 15 mM pre-annealed LNA-
antimiR:miR-122 duplex or 30 mM LNA-antimiR solution
were mixed with 100 ml mouse plasma (Lithium heparin
plasma from adult BomTac:NMRI female mice, Taconic,
Ry, Denmark) and incubated at 378C. Twenty microlitre
aliquots were taken at the different time points and frozen.
Samples were diluted in equal volume of (20 ml) 0.1 M Tris,
pH 7.6 and phenol extracted with 40 ml phenol/chloro-
form/isoamyl alcohol (25:24:1, saturated w. 10 mM Tris,
pH 8, 1 mM EDTA). The samples were separated on a
20% non-denaturing TBE gel (Novex, Invitrogen). The
nucleic acids were visualized by staining the gel in SYBR
Gold (Molecular Probes) and analysed with a Bio-Rad
Molecular Imager FX using QuantityOne software.
The oligonucleotide:miR-122 duplexes were diluted to
3 mM in 500 ml RNase-free H
2
0 and mixed with 500 ml2
T
m
-buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM Na-
phosphate, pH 7.0). The solution was heated to 958C for
3 min and then allowed to anneal in room temperature for
30 min. The duplex melting temperatures (T
m
) were
measured on a Lambda 40 UV/VIS Spectrophotometer
equipped with a Peltier temperature programmer PTP6
using PE Templab software (Perkin Elmer). The tempera-
ture was ramped up from 208Cto958C and then down to
1154
Nucleic Acids Research, 2008, Vol. 36, No. 4
258C, recording absorption at 260 nm. First derivative and
the local maximums of both the melting and annealing
were used to assess the duplex T
m
.
Northern blot analysis
Mouse liver total RNAs (10 mg per sample), were
electrophoresed in formamide loading buffer (47.5%
formamide, 9 mM EDTA, 0.0125% Bromophenol Blue,
0.0125% Xylene Cyanol, 0.0125% SDS) in 15% denatur-
ing Novex TBE-Urea polyacrylamide gels (Invitrogen)
without pre-heating the RNA. The total RNAs were
transferred to GeneScreen Plus Hybridization Transfer
Membrane (PerkinElmer) at 200 mA for 35 min and
probed with
32
P-labelled LNA-modified oligonucleotide
probes for miR-122 and let-7a (Exiqon, Denmark).
LNA probes were labelled and hybridized to the mem-
brane as described (23) with the following modifications:
pre-hybridization and hybridization solutions contained
50% formamide, 0.5% SDS, 5 SSC, 5 Denhardt’s
solution and 20 mg/ml sheared denatured herring sperm
DNA. Hybridizations were performed at 458C. The blots
were visualized by scanning in a Storm 860 scanner
(Molecular Dynamics). The Decade Marker System
(Ambion) was used as size marker.
Construction of 3’untranslated region (UTR) reporter
plasmids and luciferase assays
HeLa cells were cultivated in Eagles MEM with 10% FBS,
2 mM Glutamax I, non-essential amino acids and 25 mg/ml
Gentamicin (Invitrogen). The 3
0
UTRs of four predicted
miR-122 targets were cloned downstream of the Renilla
luciferase gene (XhoI/NotI sites) in the psiCheck-2
plasmid (Promega). PCR primers used for amplification
of the 3
0
UTRs of the four predicted miR-122 targets were
(5
0
to 3
0
): AldoA: forward ccctcgagccagagctgaactaaggctgc
(incl. a XhoI site), reverse gggcggccgcggcagtgggctggaggg
(incl. a NotI site), Bckdk: forward ccctcgagtccgcatcaacgga
cat, reverse aatgcggccgcaaactttaataagcagcagg, Cd320: for-
ward aatctcgagggacacatggttaccacctg, reverse aatgcggccgcc
aatattttcttgttttctg, Ndrg3: forward aatctcgagagatctcctcccct
ggacca, reverse aatgcggccgctaaaaagtcacactctggcagagtg.
HeLa cells were co-transfected with a miR-122 mimic
(miRIDIAN mimic, Dharmacon) and target reporter
plasmid using Lipofectamine 2000 (Invitrogen). The
transfections and luciferase activity measurements were
carried out according to the manufacturer’s instructions
(Invitrogen Lipofectamine 2000/Promega Dual-luciferase
kit). Relative protein levels were expressed as Renilla/
Firefly luciferase ratios.
Western blot analysis
Liver proteins extracted from treated mice were separated
on NuPAGE Bis Tris 4–12% (Invitrogen) using 100 mg
protein per sample. The proteins were transferred to a
nitrocellulose membrane using iBlot (Invitrogen) accord-
ing to manufacturer’s instructions. ECL advanced western
kit (GE Healthcare Life Sciences) was used for blocking,
antibody dilution and detection according to the manu-
facturer. A primary goat-anti-AldoA antibody (SC-12061,
Santa Cruz Biotechnology) and an HRP-conjugated
secondary rabbit anti-goat (PD449, DAKO) were used
according to manufacturer’s instructions.
Plasma cholesterol and transaminase measurements
Immediately before sacrifice, retro-orbital sinus blood was
collected in EDTA-coated tubes followed by isolation of
the plasma fraction. Total plasma cholesterol was
analysed using ABX Pentra Cholesterol CP (Horiba
Group, Horiba ABX Diagnostics) according to the
manufacturer’s instructions. Alanine aminotransferase
(ALT) and aspartate aminotransferase (AST) levels in
the mouse serum were measured using an enzymatic ALT/
AST CP assay (Horiba ABX Diagnostics, France)
according to the manufacturer’s instructions. The mea-
surements were carried out in duplicates and were
correlated to a 2-fold diluted standard curve generated
from an ABX Pentra MultiCal solution (Horiba ABX
Diagnostics, France).
ISH and histological analysis
In situ detection of miR-122 was performed on 8 mm
frozen liver sections of LNA-antimiR treated and saline
control mice. Slides were thawed, fixed in 4% parafor-
maldehyde for 10 min at room temperature and treated in
acetic anhydride/triethanolamine followed by rinsing
in PBS after each treatment. Slides were pre-hybridized
in hybridization solution (50% formamide, 5 SSC,
500 mg/ml yeast tRNA, 1 Denhardt’s solution) at 488C
for 30 min. Three picomoles of LNA-modified oligonu-
cleotide probe (Exiqon) complementary to miR-122 was
labelled (DIG–oligonucleotide 3
0
Tailing Kit, Roche
Applied Sciences, USA) and hybridized to the liver
sections for 1 h at 488C. After post-hybridization washes
in 0.1 SSC at 558C, the ISH signals were detected using
the tyramide signal amplification system (Perkin Elmer
USA) according to the manufacturer’s instructions.
Detection of the LNA-antimiR in the liver sections
involved ISH employing a 5
0
FAM-labelled complemen-
tary LNA probe: 5
0
-tGgaGtgTga
m
CaaTgg-3
0
. After a
15-min pre-hybridization step, the LNA probe was
hybridized to the liver sections for 5 min at the same
temperature followed by a 3 10-min post-hybridization
wash in 0.1 SSC at 558C. The slides were mounted in
Prolong Gold containing DAPI (Invitrogen) and analysed
on a Leica epifluorescence microscope equipped with a
CCD camera (Leica Microsystems) and Leica CW4000
CytoFISH software.
Histology of the mouse liver samples was carried out by
fixation of the cryosections in 4% formaldehyde for
10 min, followed by three washes in distilled water and
staining in Mayer’s haematoxylin for 1 min. The sections
were rinsed in tap water for 10 min and then quickly
washed in distilled water followed by staining in 0.2%
eosin for 30 s. The slides were washed in distilled water,
dehydrated, mounted with coverslips and analysed in a
light microscope.
Gene expression profiling
Total liver RNAs were extracted from mice treated with
25 mg/kg/day of LNA-antimiR or saline for three
Nucleic Acids Research, 2008, Vol. 36, No. 4 1155
consecutive days and sacrificed 24 h, 1, 2 or 3 weeks after
last dose as well as from mice treated with LNA mismatch
control sacrificed 24 h after last dose. RNA quality and
concentration was measured using an Agilent 2100
Bioanalyzer and Nanodrop ND-1000, respectively. Total
RNA was processed following the GeneChip Expression
3
0
-Amplification Reagents One-cycle cDNA synthesis kit
instructions (Affymetrix Inc, Santa Clara, CA, USA) to
produce double-stranded cDNA. This was used as a
template to generate biotin-labelled cRNA following
manufacturer’s specifications. Fifteen micrograms of
biotin-labelled cRNA was fragmented and 10 mg were
hybridized onto Affymetrix Mouse Genome 430 2.0 arrays
overnight in the GeneChip Hybridisation oven 6400 using
standard procedures. The arrays were washed and stained
in a GeneChip Fluidics Station 450. Scanning was carried
out using the GeneChip Scanner 3000 and image analysis
was performed using GeneChip Operating Software.
Normalization and statistical analysis were done using
the LIMMA software package for the R programming
environment (28,29). Probes reported as absent by GCOS
software in all hybridizations were removed from the
dataset. Additionally, an intensity filter was applied to
the dataset to remove probes displaying background-
corrected intensities below 16. Data were normalized using
quantile normalization (30). Differential expression was
assessed using a linear model method. P-values were
adjusted for multiple testing using the Benjamini and
Hochberg method. Tests were considered to be significant
if the adjusted P-values were P < 0.05. Clustering and
visualization of Affymetrix array data were done using the
MultiExperiment Viewer software (31). The differentially
regulated genes found in the expression studies were
analysed for enriched GO-terms using the DAVID online
tool (32).
miRNA target site analysis
Affymetrix probe set identifiers were mapped to Ensembl
transcripts using annotation files provided by Affymetrix
and the Ensembl Biomart system. Transcript sequences
were extracted from Ensembl using the ensembl–Perl–API
(33). Target prediction algorithms were applied on full-
length transcripts taking note whether the first base of a
site occurred in 5
0
UTR, coding sequence or 3
0
UTR. The
following prediction methods were used: Our own
implementation of TargetScanS (15) finding seed matches
(perfect Watson–Crick matches between the 6mer from
base 2 to 7 of the miRNA from the 5
0
end) with none or
one of three kinds of extensions: (i) an A across from
nucleotide 1 in the miRNA (seedM+t1A), (ii) an
additional match between the site and nucleotide 8 in
the miRNA (seedM+m8M) and (iii), the combination of
(i) and (ii) (seedM+m8M+t1A). miRanda (34) was
downloaded from www.microrna.org and run with default
parameter setting. RNAhybrid (35) was downloaded from
http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/and run
with P-value cutoff of 0.05 using parameters calculated
from human 3
0
UTRs.
RESULTS AND DISCUSSION
Silencing of miRNA-122 in vitro and in vivo by short,
unconjugated LNA-antimiR
Previously, 2
0
-O-methyl antisense oligonucleotides have
been used as potent and irreversible inhibitors of siRNA
and miRNA function in vitro and in Drosophila and
Caenorhabditis elegans, thereby inducing a loss-of-
function phenotype (36,37). This method was recently
applied to mice, where cholesterol-conjugated 2
0
-O-methyl
antisense oligonucleotides (antagomirs) were used to
silence miRNAs, including miR-122 (11,38). In a similar
study, unconjugated 2
0
MOE antisense oligonucleotides
were used to inhibit miR-122 in both normal and diet-
induced obese mice (10). While complementary LNA
oligonucleotides have been shown to mediate specific
miRNA inhibition in vitro (25–27), their utility in
antagonizing miRNAs in vivo has not been addressed to
date. A potential advantage of LNA is its high affinity to
miRNA as described by Kloosterman et al. (20) in which
highly sensitive and specific detection of miR-206 and
miR-124a in zebrafish embryos by whole-mount ISH
could be achieved using shortened LNA versions (16- to
14-mers) complementary to the 5
0
-end of the miRNA.
In this study, we designed a 16-nt mixed LNA/DNA
oligonucleotide (LNA-antimiR) complementary to the 5
0
region of miR-122 similar to the LNA probes reported by
Kloosterman et al. (20), by substituting every third
nucleotide position with an LNA monomer. Since
phosphorothioate modifications have been shown to
provide good pharmacokinetic and tissue uptake proper-
ties in antisense oligonucleotides along with protection
against nucleases (39,40), we synthesized the LNA-
antimiR as an unconjugated oligonucleotide with a
complete phosphorothioate backbone.
We first evaluated miR-122 inhibition by LNA-antimiR
in Huh-7 cells, which express miR-122. Treatment of Huh-
7 cells with 1, 10 and 100 nM LNA-antimiR revealed
dose-dependent reduction of miR-122 as measured by
miR-122-specific RT-PCR compared to unaltered miR-
122 levels observed with a double mismatch LNA control
oligonucleotide (Supplementary Figure 1). Previous stu-
dies have shown that endogenous miRNAs are effective in
cleaving reporter mRNAs harbouring miRNA recognition
sequences with perfect complementarity to the miRNA
(41,42). Hence, we cloned a perfectly complementary miR-
122 target site into the 3
0
UTR of the Renilla luciferase
reporter in the psiCHECK 2 vector, which contains both
the Renilla and firefly luciferase genes in the same plasmid.
As expected, introduction of the miR-122 sensor into
Huh-7 cells resulted in repression of the Renilla luciferase
compared to the control reporter without a miR-122
target site. By contrast, transfection of the miR-122 sensor
plasmid along with the LNA-antimiR led to dose-
dependent de-repression of the Renilla luciferase activity
in Huh-7 cells, which was not detected with the LNA
mismatch control (Supplementary Figure 2). Considered
together, these results confirm effective and specific
miR-122 inhibition in vitro by the LNA-antimiR
oligonucleotide.
1156
Nucleic Acids Research, 2008, Vol. 36, No. 4
Next, we asked whether the LNA-antimiR could be
used to antagonize miR-122 in mice. The LNA-antimiR
compound was systemically administered to mice by single
intravenous injections on three consecutive days using
doses ranging from 2.5 to 25 mg/kg/day. Subsequent real-
time RT-PCR analysis of miR-122 levels in total RNA
samples extracted from LNA-antimiR-treated mice
livers 24 h after last dose revealed a dose-dependent
reduction of mature miR-122 (Figure 1A). In contrast,
the similarly administered mismatch control LNA dosed
at 25 mg/kg/day did not show significant miR-122 reduc-
tion, indicating that miR-122 inhibition in vivo by the
LNA-antimiR is specific, which is also consistent with
our findings in vitro. By comparison, control RT-PCR
assays for let-7a, which is also expressed in the liver
showed largely unchanged levels across all animal groups
(Figure 1B).
miRNA-122 antagonism by LNA-antimiR leads to stable
heteroduplex formation
To better understand the mechanism of miR-122 inhibi-
tion by LNA-antimiR, mouse liver RNA samples were
subjected to northern blot analysis. The northern results
showed significantly reduced levels of mature miR-122 in
LNA-antimiR-treated liver RNA, which concurs with our
real-time RT-PCR results, whereas the levels of the let-7a
control were not altered (Figure 1C). Silencing of miR-122
in mice as reported previously by Krutzfeldt et al. (11,38)
using a cholesterol-conjugated 2
0
-O-Me antagomir and
by Esau et al. (10) using 2
0
-MOE ASO inferred degrada-
tion of the targeted miRNA. By contrast, we observed
dose-dependent accumulation of a shifted miR-122:LNA-
antimiR heteroduplex band, implying that the LNA-
antimiR binds stably to the miRNA, thereby antagonizing
its function. The fact that a preformed miR-122:LNA-
antimiR duplex was stable in mouse plasma over 96 h
(Figure 1D) together with the high thermal stability of the
LNA-antimiR:miR-122 duplex supports our notion that
inhibition of miR-122 by the LNA-antimiR is due to high
affinity duplex formation between the two molecules,
which is also consistent with recent observations in cell
culture (43).
We assessed these findings further by in situ detection of
both miR-122 and the LNA-antimiR molecule in frozen
liver sections from LNA-antimiR-treated (25 mg/kg) and
saline control mice. ISH in frozen liver sections from
control animals showed high miR-122 accumulation over
the entire liver section, whereas those from the LNA-
antimiR-treated mice showed significantly reduced
staining for miR-122 (Figure 1E). On the other hand,
the LNA-antimiR was readily detected in the liver sections
of treated mice, but not in untreated controls. At higher
magnification, the mature miR-122 could be localized in
distinct cytoplasmic compartments in the control liver
sections. By comparison, the LNA-antimiR was evenly
distributed in the entire cytoplasm (Figure 1E, right
panels), with occasional staining observed also in some,
but not all nuclei (Supplementary Figure 3). Combined,
these results demonstrate uptake of the systemically
administered LNA-antimiR compound by murine liver.
Furthermore, our data support the conclusion that
antagonism of miR-122 by LNA-antimiR in mouse liver
cells is due to formation of stable heteroduplexes between
the LNA-antimiR and mature miR-122 in the cytoplasm
accompanied by markedly reduced mature miR-122
levels as detected by real-time RT-PCR, northern blots
and ISH.
Figure 1. Silencing of miR-122 in mouse liver by LNA-antimiR.
(A, B) Real-time RT-PCR assessment of miR-122 and let-7a levels in
LNA-antimiR-treated mice livers. The mice were treated with indicated
doses of LNA-antimiR along with a mismatch control (mm) and saline
for three consecutive days and sacrificed 24 h after last dose. miR-122
and let-7a levels were normalized to the saline-treated group. Shown
are mean and SEM, n = 10. (C) Northern blots were probed with a
miR-122 specific probe (upper panel) and re-probed with a let-7a
specific probe (lower panel). Two miR-122 bands were detected, a lower
band corresponding to mature miR-122 and an upper band to a duplex
between the LNA-antimiR and miR-122. (D) The stability of the LNA-
antimiR and LNA-antimiR:miR-122 duplex was assessed in mouse
plasma at 378C over 96 h. Shown is a SYBR-Gold stained PAGE. The
melting temperature (T
m
) of the LNA-antimiR:miR-122 duplex was
measured along with mismatch control and an unmodified DNA
oligonucleotide complementary to miR-122. (E) In situ detection of
miR-122 and the LNA-antimiR oligonucleotide in the mouse liver
sections. Positive in situ hybridization signals for miR-122 and LNA-
antimiR, respectively, are visualized in green, while blue depicts DAPI
nuclear stain. 100 magnifications reveal subcellular distribution of
miR-122 and LNA-antimiR.
Nucleic Acids Research, 2008, Vol. 36, No. 4 1157
Analysis of miR-122 target mRNAs in the mouse liver
Since most animal target sites are located in the 3
0
UTRs
and show only limited complementarity to the miRNA
(1), precise and reliable experimental identification of
targets for miRNAs remains a major bottleneck. Recent
studies have reported significant enrichment of predicted
target sites in messages that are up-regulated upon
miRNA silencing in vivo (10,11,38). Hence, we set out to
identify genes with altered transcript levels in response
to miR-122 antagonism by LNA-antimiR in murine liver.
To this end, we carried out genome-wide expression
profiling of total RNA samples from saline, LNA-antimiR
and LNA-mismatch-treated mice livers 24 h after the last
dose using Affymetrix Mouse Genome arrays. Analysis of
the array data revealed 455 up-regulated Affymetrix probe
sets corresponding to 395 distinct ENSEMBL genes in the
LNA-antimiR-treated mice livers compared to saline and
LNA mismatch controls (Figure 2A and Supplementary
Table 1). Next, we examined the 3
0
UTRs for the presence
of the 6-nt sequence CACTCC, which is the reverse
complement of the nucleotide 2–7 seed in the mature miR-
122 sequence. The number of mRNAs having at least one
miR-122 recognition sequence was 199 (50%), while the
seed match frequency in all annotated mouse 3
0
UTRs was
only 21%, implying that a significant pool of the up-
regulated mRNAs correspond to de-repressed, direct miR-
122 targets in the liver. It is noteworthy that 74% of the
mRNAs identified as up-regulated in both this study and
in that of Krutzfeldt et al. (11) 24 h after LNA-antimiR or
2
0
O-Me antagomir-122 treatment, respectively, have at
least one 6-nt seed match in their 3
0
UTRs (Supplementary
Table 2). In our study, we find a 2.4-fold enrichment for
6-nt seed matches in the up-regulated 3
0
UTRs (odds ratio:
2.3, P-value: 1.4E-11, Supplementary Table 3).
Detailed in vitro studies using over-expression of
miRNAs indicate that the presence of extended seed
matches increases the likelihood that a given message is
regulated by a miRNA (15,44). We therefore examined the
identified seed matches for the presence of an A anchor
corresponding to the 5
0
most nucleotide of miR-122, as
well as for an extended match to base 8 of miR-122 as
described by Lewis et al. (15). Both types of 7-nt seed
matches were significantly enriched in the de-repressed 3
0
UTRs, whereas combined requirement of the A anchor
position and M8 match did not show further enrichment
in our mouse liver data set (Figure 2C). As a control, we
also investigated the frequency of sites for the unrelated
let-7a miRNA among the up-regulated mRNAs.
Compared to miR-122 seed sites whose enrichment were
statistically highly significant, we observed no enrichment
of let-7a seed matches in our dataset, which is in good
agreement with specific antagonism of miR-122 by LNA-
antimiR leading to de-repression of direct miR-122 targets
in the murine liver (Supplementary Table 3). Furthermore,
we find that simple string matching to miR-122 seed
sites yields higher enrichment within the up-regulated
mRNAs compared to more complex algorithms, such as
RNAhybrid and miRanda (run locally with default
settings, data not shown).
Among the identified miR-122 targets, we chose four
mRNAs for further expression analyses by real-time
RT-PCR: AldoA (Aldolase A. one SeedM+m8M+t1A
site), Bckdk (Branched-chain a-ketoacid dehydrogenase
kinase, one SeedM+m8M+t1A, one SeedM+m8M and
SeedM site), Cd320 (Cd320 antigen, putative VLDL
receptor, two SeedM+m8M sites) and Ndrg3 (N-myc
downstream regulated gene 3, one SeedM+m8M and two
SeedM+t1A sites) (Figure 3A). At 24 h after the last dose,
all four mRNAs were de-repressed in a dose-dependent
manner in response to increasing LNA-antimiR dose, as
would be expected if miR-122 was functionally inhibited
by LNA-antimiR (Figure 3B). In contrast, the expression
levels of two non-target mRNAs, aldolase B and
GAPDH, were unaltered in the treated mice compared
to saline and LNA-mismatch control (Figure 3B). The
results obtained here by in vivo antagonism of miR-122
imply that the Ndrg3, AldoA, Bckdk and Cd320
mRNAs are direct targets of miR-122 in the mouse
liver. To confirm that the identified target sites in these
messages could mediate translational repression by miR-
122, we cloned their full-length 3
0
UTRs downstream of
the Renilla luciferase gene and transfected the resulting
3
0
UTR reporters into HeLa cells alongside a miR-122
mimic. As shown in Figure 3C, all four 3
0
UTR reporters
showed a significant decrease in luciferase activity,
Figure 2. Enrichment of miR-122 target sites in genes up-regulated
after LNA-antimiR treatment. (A) The number of significantly
(P < 0.05) up- or down-regulated genes (red and green, respectively)
in LNA-antimiR-treated mice livers compared to saline and LNA-
mismatch-treated mice. (B) The occurrence of miR-122 6-nt seed
sequence matches in differentially expressed genes and in all mouse
ENSEMBL annotated genes. (C) Enrichment of different seed types
(as shown in lower panel) in up- and down-regulated genes relative to
all genes.
1158 Nucleic Acids Research, 2008, Vol. 36, No. 4
whereas the miR-122 mimic had no effect on the luciferase
control plasmid without a miR-122 target site. Moreover,
AldoA protein levels were 3-fold increased in LNA-
antimiR-treated mice compared to saline control mice
(Figure 3D), concurring with the observed 2-fold de-
repression of AldoA message levels in LNA-treated mice
(Figure 3B). Taken together, our data suggest that miR-
122 negatively regulates the expression of a large number
of target mRNAs in adult mouse liver, which is in good
agreement with reports from Drosophila and vertebrates
(14,45). On the other hand, the finding that most of these
targets showed only slight to moderate de-repression in
miR-122-silenced mice livers (Supplementary Tables 1,
2 and 4) is consistent with the proposal that many
miRNAs might work by fine-tuning gene-regulatory
networks (46,47). Our results are also consistent with the
idea that perfect seed pairing is a useful means of
predicting animal miRNA targets and provide important
in vivo evidence that the presence of extended 7-nt seed
matches can be used to improve the specificity of miRNA
target site prediction.
Antagonism of miR-122 by LNA-antimiR is reversible and
shows no hepatotoxicity in mice
To gain further insight into the long-term effects of
LNA-antimiR-mediated antagonism of miR-122 in vivo,
we treated mice with single intravenous doses of LNA-
antimiR for three consecutive days at 25 mg/kg/day, and
then extended monitoring of the study animals to 3 weeks
after last dose. The LNA-antimiR treatment resulted in
maximal reduction of miR-122 levels at 24 h, followed by
an increase of mature miR-122 to 50% relative to saline
control levels at 1 week leading to completely normalized
levels at 3 weeks after last dose (Figure 4A). This
coincided with transient de-repression within 24 h of 199
predicted miR-122 targets, which gradually returned to
saline control levels by 3 weeks post-treatment, which
along with temporal normalization of most changes in
liver gene expression (Figure 3 and Supplementary
Tables 1, 2 and 4) implies that antagonism of miR-122
by LNA-antimiR in mice is reversible. Contrary to a
recent report (48), we did not observe any hepatotoxicity
in the LNA-antimiR or LNA-mismatch control-treated
mice as shown by unaltered levels of the serum transami-
nases ALT and AST 24 h after treatment with total LNA
doses of 75 mg/kg (3 25 mg/kg/day) compared to saline
controls (Figure 4F). This is consistent with the absence of
morphological changes in liver sections from the LNA-
treated animals (Figure 4F, Supplementary Figure 4). It is
also noteworthy that we did not observe any perturbations
in the treated livers for genes associated with the miRNA
pathway (Supplementary Table 6).
Previous studies in mice have reported effective
miR-122 knockdown using total intravenous doses of
120–240 mg/kg for cholesterol-conjugated 2
0
-O-Me antag-
omirs and weekly intraperitoneal doses of 25–150 mg/kg
for 2
0
MOE oligonucleotides leading to a low plasma
cholesterol loss-of-function phenotype (10,11,38). One
week after dosing with LNA-antimiR, plasma cholesterol
levels were reduced by 40% in treated mice, thereby
Figure 3. Expression of four miR-122 targets. (A) Alignment showing
the seed matches in Cd320, Ndrg3, AldoA and Bckdk. The 6-nt seed is
shown in capital letters, with the m8M or t1A extensions highlighted in
red. (B) Real-time RT-PCR analysis of AldoA, Nrdg3, Bckdk and
Cd320 was carried out to investigate their expression as response to
increasing LNA-antimiR doses. Shown are mean and SD (where n =3)
of mRNA levels relative to the saline control group. Shown is also the
mismatch control (mm). (C) miR-122-mediated repression of 3
0
UTR
reporters for AldoA, Ndrg3, Bckdk and Cd320 in HeLa cells. The
3
0
UTRs of the four predicted miR-122 targets were cloned downstream
of the Renilla luciferase gene and the resulting reporters were
transfected into HeLa cells along with a miR-122 mimic. Shown are
mean values and SD, n =4. (D) Western blot analysis of AldoA in liver
protein extracts of LNA-antimiR-treated and saline control mice.
Shown is one representative western blot and corresponding quantifica-
tion. Values are related to the mean of the saline values (mean and SD,
n = 4, asterisk: 75 mg protein instead of 100 m g, compensated for in
quantification).
Nucleic Acids Research, 2008, Vol. 36, No. 4 1159
confirming the low cholesterol phenotype, with levels still
being 20% below controls at 3 weeks (Figure 4B). By
comparison, the miR-122 targets AldoA, Bckdk, Ndrg3
and Cd320, were all substantially de-repressed 24 h after
LNA-antimiR treatment and then reverted towards
control levels over the next 2 weeks (Figure 4E). Thus,
the observed changes in gene expression appear to precede
reduction in cholesterol, which in turn, appears longer
lasting than changes in miR-122 target gene expression.
It is therefore tempting to speculate that the coordinated
changes in miR-122-associated gene networks are respon-
sible for the control of cholesterol and lipid metabolism
in the liver and that such pathways take several weeks
to revert to normal levels. Interestingly, we find that the
up-regulated genes in treated mice 24 h post-treatment are
enriched in the Gene Ontology categories lipid metabolism
(25 genes, P =3.3E5) and lipid biosynthesis (12 genes,
P = 9.1E5).
In conclusion, our temporal liver gene expression profile
extended to 3 weeks after the last LNA-antimiR dose
combined with the low-cholesterol phenotype demonstrate
functional antagonism of miR-122 in mice by LNA-
antimiR. Our findings suggest that miRNA antagonists
comprised of LNA may be valuable tools for identifying
miRNA targets in vivo and for studying the biological
role of miRNAs and miRNA-associated gene-regulatory
networks in a physiological context. In addition, the
high metabolic stability of LNA-antimiRs, due in part to
increased nuclease resistance, their small size and lack
of acute toxicity imply that LNA-antimiRs may be well
suited as a novel class of potential therapeutics for disease-
associated miRNAs.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
Figure 4. Duration of functional miR-122 inhibition in LNA-antimiR-
treated mice. (A) Real-time RT-PCR analysis of miR-122 levels in
LNA-antimiR-treated mice livers over time. The mice were treated with
25 mg/kg/day LNA-antimiR or saline for three consecutive days
followed by sacrificing the animals after 24 h, 1, 2 or 3 weeks. miR-
122 levels were normalized to the mean of the saline control group at
each individual time point. Shown are mean and SD, n = 7 (24 h
n = 10). (B) Total plasma cholesterol in LNA-antimiR-treated mice
over time. The data were normalized to the saline group at each time
point. Shown are mean and SD (n =7, 24h n = 10). (C) Hierarchical
clustering was performed on the expression profiles of genes identified
as differentially expressed between LNA-antimiR and saline-treated
mice 24 h, 1 week or 3 weeks post-treatment. The LNA-antimiR/saline
log2-transformed expression ratios are indicated by colour where red
indicates higher expression level in LNA-antimiR-treated mice com-
pared to saline-treated mice, whereas green indicates lower expression
level and black indicates equal expression level. (D) Expression profiles
of genes identified as differentially expressed between LNA-antimiR-
and saline-treated mice 24 h post-treatment was monitored over time.
(E) Temporal expression of four miR-122 target genes (AldoA, Nrdg3,
Bckdk and Cd320) and GAPDH in LNA-antimiR-treated mice
livers. Values were normalized to saline control at each time point.
Shown are mean and SD (n = 3). (F) Toxicity assessed by measuring
liver enzymes and investigating liver morphology 24 h after last dose,
shown are ALT and AST levels (mean and SD, n = 5) and histology on
liver sections.
1160 Nucleic Acids Research, 2008, Vol. 36, No. 4
ACKNOWLEDGEMENTS
The authors wish to thank Anja Konge, Bettina Nordbo,
Christina Udesen, Heidi W. Høvring, Janni Juul
Jørgensen, Katrine Rishøj Nielsen, Lisbeth Bang, Otto
Olsen and Rikke Sølberg and Ulla Steinmeier for excellent
technical assistance. This study was supported by grants
from the Danish National Advanced Technology
Foundation, Danish Medical Research Council and the
Lundbeck Foundation to S.K. Wilhelm Johannsen Centre
for Functional Genome Research is established by the
Danish National Research Foundation, Copenhagen,
Denmark (www.dg.dk). Funding to pay the Open Access
publication charges for this article was provided by
Santaris Pharma, Hørsholm, Denmark.
Conflict of interest statement . J.E., M.L., M.H., J.B.H.,
H.F.H., E.M.S., K.M., P.K. and S.K. are employed at
Santaris Pharma. Santaris Pharma is a biopharmaceutical
company engaged in the development of RNA based
medicine.
REFERENCES
1. Bartel,D.P. (2004) MicroRNAs: genomics, biogenesis, mechanism,
and function. Cell, 116, 281–297.
2. Kloosterman,W.P. and Plasterk,R.H. (2006) The diverse functions
of microRNAs in animal development and disease. Dev. Cell, 11,
441–450.
3. Costinean,S., Zanesi,N., Pekarsky,Y., Tili,E., Volinia,S.,
Heerema,N. and Croce,C.M. (2006) Pre-B cell proliferation and
lymphoblastic leukemia/high-grade lymphoma in E(mu)-miR155
transgenic mice. Proc. Natl Acad. Sci. USA, 103, 7024–7029.
4. He,L., Thomson,J.M., Hemann,M.T., Hernando-Monge,E., Mu,D.,
Goodson,S., Powers,S., Cordon-Cardo,C., Lowe,S.W. et al. (2005)
A microRNA polycistron as a potential human oncogene. Nature,
435, 828–833.
5. Johnson,S.M., Grosshans,H., Shingara,J., Byrom,M., Jarvis,R.,
Cheng,A., Labourier,E., Reinert,K.L., Brown,D. et al. (2005) RAS
is regulated by the let-7 microRNA family. Cell, 120, 635–647.
6. Lu,J., Getz,G., Miska,E.A., Alvarez-Saavedra,E., Lamb,J., Peck,D.,
Sweet-Cordero,A., Ebert,B.L., Mak,R.H. et al. (2005) MicroRNA
expression profiles classify human cancers. Nature, 435, 834–838.
7. Abelson,J.F., Kwan,K.Y., O’Roak,B.J., Baek,D.Y., Stillman,A.A.,
Morgan,T.M., Mathews,C.A., Pauls,D.L., Rasin,M.R. et al. (2005)
Sequence variants in SLITRK1 are associated with Tourette’s
syndrome. Science, 310, 317–320.
8. Triboulet,R., Mari,B., Lin,Y.L., Chable-Bessia,C., Bennasser,Y.,
Lebrigand,K., Cardinaud,B., Maurin,T., Barbry,P. et al. (2007)
Suppression of microRNA-silencing pathway by HIV-1 during virus
replication. Science, 315, 1579–1582.
9. Yang,B., Lin,H., Xiao,J., Lu,Y., Luo,X., Li,B., Zhang,Y., Xu,C.,
Bai,Y. et al. (2007) The muscle-specific microRNA miR-1 regulates
cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2.
Nat. Med., 13, 486–491.
10. Esau,C., Davis,S., Murray,S.F., Yu,X.X., Pandey,S.K., Pear,M.,
Watts,L., Booten,S.L., Graham,M. et al. (2006) miR-122 regulation
of lipid metabolism revealed by in vivo antisense targeting. Cell
Metab., 3, 87–98.
11. Krutzfeldt,J., Rajewsky,N., Braich,R., Rajeev,K.G., Tuschl,T.,
Manoharan,M. and Stoffel,M. (2005) Silencing of microRNAs
in vivo with ‘antagomirs’. Nature, 438, 685–689.
12. Jopling,C.L., Yi,M., Lancaster,A.M., Lemon,S.M. and Sarnow,P.
(2005) Modulation of hepatitis C virus RNA abundance by a
liver-specific MicroRNA. Science, 309, 1577–1581.
13. John,B., Sander,C. and Marks,D.S. (2006) Prediction of human
microRNA targets. Methods Mol. Biol., 342, 101–113.
14. Krek,A., Grun,D., Poy,M.N., Wolf,R., Rosenberg,L., Epstein,E.J.,
MacMenamin,P., da Piedade,I., Gunsalus,K.C. et al. (2005)
Combinatorial microRNA target predictions. Nat. Genet., 37,
495–500.
15. Lewis,B.P., Burge,C.B. and Bartel,D.P. (2005) Conserved seed
pairing, often flanked by adenosines, indicates that thousands of
human genes are microRNA targets. Cell, 120, 15–20.
16. Sethupathy,P., Corda,B. and Hatzigeorgiou,A.G. (2006) TarBase:
a comprehensive database of experimentally supported animal
microRNA targets. RNA, 12, 192–197.
17. Lim,L.P., Lau,N.C., Garrett-Engele,P., Grimson,A., Schelter,J.M.,
Castle,J., Bartel,D.P., Linsley,P.S. and Johnson,J.M. (2005)
Microarray analysis shows that some microRNAs downregulate
large numbers of target mRNAs. Nature, 433, 769–773.
18. Fluiter,K., Ten Asbroek,A.L., de Wissel,M.B., Jakobs,M.E.,
Wissenbach,M., Olsson,H., Olsen,O., Oerum,H. and Baas,F. (2003)
In vivo tumor growth inhibition and biodistribution studies of
locked nucleic acid (LNA) antisense oligonucleotides. Nucleic Acids
Res., 31, 953–962.
19. Koshkin,A.A., Singh,S.K., Nielsen,P., Rajwanshi,V.K., Kumar,R.,
Meldgaard,M., Olsen,C.E. and Wengel,J. (1998) LNA (Locked
Nucleic Acids): Synthesis of the adenine, cytosine, guanine,
5-methylcytosine, thymine and uracil bicyclonucleoside monomers,
oligomerisation, and unprecedented nucleic acid recognition.
Tetrahedron, 54, 3607–3630.
20. Kloosterman,W.P., Wienholds,E., de Bruijn,E., Kauppinen,S. and
Plasterk,R.H. (2006) In situ detection of miRNAs in animal
embryos using LNA-modified oligonucleotide probes. Nat.
Methods, 3, 27–29.
21. Nelson,P.T., Baldwin,D.A., Kloosterman,W.P., Kauppinen,S.,
Plasterk,R.H. and Mourelatos,Z. (2006) RAKE and LNA-ISH
reveal microRNA expression and localization in archival human
brain. RNA, 12, 187–191.
22. Obernosterer,G., Martinez,J. and Alenius,M. (2007) Locked nucleic
acid-based in situ detection of microRNAs in mouse tissue sections.
Nat. Protoc., 2, 1508–1514.
23. Valoczi,A., Hornyik,C., Varga,N., Burgyan,J., Kauppinen,S. and
Havelda,Z. (2004) Sensitive and specific detection of microRNAs by
northern blot analysis using LNA-modified oligonucleotide probes.
Nucleic Acids Res., 32, e175.
24. Wienholds,E., Kloosterman,W.P., Miska,E., Alvarez-Saavedra,E.,
Berezikov,E., de Bruijn,E., Horvitz,H.R., Kauppinen,S. and
Plasterk,R.H. (2005) MicroRNA expression in zebrafish embryonic
development. Science, 309, 310–311.
25. Chan,J.A., Krichevsky,A.M. and Kosik,K.S. (2005) MicroRNA-21
is an antiapoptotic factor in human glioblastoma cells. Cancer Res.,
65, 6029–6033.
26. Lecellier,C.H., Dunoyer,P., Arar,K., Lehmann-Che,J., Eyquem,S.,
Himber,C., Saib,A. and Voinnet,O. (2005) A cellular microRNA
mediates antiviral defense in human cells. Science, 308, 557–560.
27. Orom,U.A., Kauppinen,S. and Lund,A.H. (2006) LNA-modified
oligonucleotides mediate specific inhibition of microRNA function.
Gene, 372, 137–141.
28. Gentleman,R., Carey,V., Huber,W., Irizarry,R. and Dudoit,S. (eds)
(2005) Bioinformatics and Computational Biology Solutions Using R
and Bioconductor. Springer, New York.
29. Gentleman,R.C., Carey,V.J., Bates,D.M., Bolstad,B., Dettling,M.,
Dudoit,S., Ellis,B., Gautier,L., Ge,Y. et al. (2004) Bioconductor:
open software development for computational biology and
bioinformatics. Genome Biol., 5, R80.
30. Bolstad,B.M., Irizarry,R.A., Astrand,M. and Speed,T.P. (2003)
A comparison of normalization methods for high density
oligonucleotide array data based on variance and bias.
Bioinformatics, 19, 185–193.
31. Saeed,A.I., Sharov,V., White,J., Li,J., Liang,W., Bhagabati,N.,
Braisted,J., Klapa,M., Currier,T. et al. (2003) TM4: a free,
open-source system for microarray data management and analysis.
Biotechniques, 34, 374–378.
32. Dennis,G.Jr, Sherman,B.T., Hosack,D.A., Yang,J., Gao,W.,
Lane,H.C. and Lempicki,R.A. (2003) DAVID: Database for Anno-
tation, Visualization, and Integrated Discovery. Genome Biol., 4,3.
33. Curwen,V., Eyras,E., Andrews,T.D., Clarke,L., Mongin,E.,
Searle,S.M. and Clamp,M. (2004) The Ensembl automatic gene
annotation system. Genome Res., 14, 942–950.
34. Enright,A.J., John,B., Gaul,U., Tuschl,T., Sander,C. and Marks,D.S.
(2003) MicroRNA targets in Drosophila. Genome Biol., 5, R1.
Nucleic Acids Research, 2008, Vol. 36, No. 4 1161
35. Rehmsmeier,M., Steffen,P., Hochsmann,M. and Giegerich,R. (2004)
Fast and effective prediction of microRNA/target duplexes. RNA,
10, 1507–1517.
36. Hutvagner,G., Simard,M.J., Mello,C.C. and Zamore,P.D. (2004)
Sequence-specific inhibition of small RNA function. PLoS Biol., 2,
E98.
37. Leaman,D., Chen,P.Y., Fak,J., Yalcin,A., Pearce,M., Unnerstall,U.,
Marks,D.S., Sander,C., Tuschl,T. et al. (2005) Antisense-mediated
depletion reveals essential and specific functions of microRNAs in
Drosophila development. Cell, 121, 1097–1108.
38. Krutzfeldt,J., Kuwajima,S., Braich,R., Rajeev,K.G., Pena,J.,
Tuschl,T., Manoharan,M. and Stoffel,M. (2007) Specificity, duplex
degradation and subcellular localization of antagomirs. Nucleic
Acids Res., 35, 2885–2892.
39. Crooke,S.T (ed) (2001) Antisense Drug Technology. Marcel Dekker,
New York.
40. Crooke,S.T. (2000) Progress in antisense technology: the end of the
beginning. Methods Enzymol., 313, 3–45.
41. Davis,S., Lollo,B., Freier,S. and Esau,C. (2006) Improved targeting
of miRNA with antisense oligonucleotides. Nucleic Acids Res., 34,
2294–2304.
42. Meister,G., Landthaler,M., Dorsett,Y. and Tuschl,T. (2004)
Sequence-specific inhibition of microRNA- and siRNA-induced
RNA silencing. RNA, 10, 544–550.
43. Naguibneva,I., Ameyar-Zazoua,M., Nonne,N., Polesskaya,A.,
Ait-Si-Ali,S., Groisman,R., Souidi,M., Pritchard,L.L. and
Harel-Bellan,A. (2006) An LNA-based loss-of-function assay for
micro-RNAs. Biomed. Pharmacother., 60, 633–638.
44. Grimson,A., Farh,K.K., Johnston,W.K., Garrett-Engele,P.,
Lim,L.P. and Bartel,D.P. (2007) MicroRNA targeting
specificity in mammals: determinants beyond seed pairing. Mol.
Cell, 27, 91–105.
45. Brennecke,J., Stark,A., Russell,R.B. and Cohen,S.M. (2005)
Principles of microRNA-target recognition. PLoS Biol.,
3, e85.
46. Farh,K.K., Grimson,A., Jan,C., Lewis,B.P., Johnston,W.K.,
Lim,L.P., Burge,C.B. and Bartel,D.P. (2005) The widespread impact
of mammalian MicroRNAs on mRNA repression and evolution.
Science, 310, 1817–1821.
47. Stark,A., Brennecke,J., Bushati,N., Russell,R.B. and Cohen,S.M.
(2005) Animal MicroRNAs confer robustness to gene expression
and have a significant impact on 3
0
UTR evolution. Cell, 123,
1133–1146.
48. Swayze,E.E., Siwkowski,A.M., Wancewicz,E.V., Migawa,M.T.,
Wyrzykiewicz,T.K., Hung,G., Monia,B.P. and Bennett,C.F. (2007)
Antisense oligonucleotides containing locked nucleic acid improve
potency but cause significant hepatotoxicity in animals. Nucleic
Acids Res., 35, 687–700.
1162 Nucleic Acids Research, 2008, Vol. 36, No. 4
