Mapping peptidergic cells in Drosophila: Where DIMM fits in

Abstract

The bHLH transcription factor DIMMED has been associated with the differentiation of peptidergic cells in Drosophila. However, whether all Drosophila peptidergic cells express DIMM, and the extent to which all DIMM cells are peptidergic, have not been determined. To address these issues, we have mapped DIMM expression in the central nervous system (CNS) and periphery in the late larval stage Drosophila. At 100 hr after egg-laying, DIMM immunosignals are largely congruent with a dimm-promoter reporter (c929-GAL4) and they present a stereotyped pattern of 306 CNS cells and 52 peripheral cells. We assigned positional values for all DIMM CNS cells with respect to reference gene expression patterns, or to patterns of secondary neuroblast lineages. We could assign provisional peptide identities to 68% of DIMM-expressing CNS cells (207/306) and to 73% of DIMM-expressing peripheral cells (38/52) using a panel of 24 markers for Drosophila neuropeptide genes. Furthermore, we found that DIMM co-expression was a prevalent feature within single neuropeptide marker expression patterns. Of the 24 CNS neuropeptide gene patterns we studied, six patterns are >90% DIMM-positive, while 16 of 22 patterns are >40% DIMM-positive. Thus most or all DIMM cells in Drosophila appear to be peptidergic, and many but not all peptidergic cells express DIMM. The co-incidence of DIMM-expression among peptidergic cells is best explained by a hypothesis that DIMM promotes a specific neurosecretory phenotype we term LEAP. LEAP denotes Large cells that display Episodic release of Amidated Peptides.

Full text

Mapping Peptidergic Cells in
Drosophila
: Where DIMM
Fits In
Dongkook Park
1
, Jan A. Veenstra
2
, Jae H. Park
3
, Paul H. Taghert
1
*
1 Department of Anatomy and Neurobiology, Washington University School of Medicine, Saint Louis, Missouri, United States of America, 2 CNIC UMR 5228 CNRS,
Universite
´
Bordeaux I, Talence, France, 3 Department of Biochemistry and Cellular and Molecular Biology, University of Ten nessee–Knoxville, Knoxville, Tennessee, United
States of America
Abstract
The bHLH transcription factor DIMMED has been associated with the differentiation of peptidergic cells in Drosophila.
However, whether all Drosophila peptidergic cells express DIMM, and the extent to which all DIMM cells are peptidergic,
have not been determined. To address these issues, we have mapped DIMM expression in the central nervous system (CNS)
and periphery in the late larval stage Drosophila. At 100 hr after egg-laying, DIMM immunosignals are largely congruent
with a dimm-promoter reporter (c929-GAL4) and they present a stereotyped pattern of 306 CNS cells and 52 peripheral cells.
We assigned positional values for all DIMM CNS cells with respect to reference gene expression patterns, or to patterns of
secondary neuroblast lineages. We could assign provisional peptide identities to 68% of DIMM-expressing CNS cells (207/
306) and to 73% of DIMM-expressing peripheral cells (38/52) using a panel of 24 markers for Drosophila neuropeptide
genes. Furthermore, we found that DIMM co-expression was a prevalent feature within single neuropeptide marker
expression patterns. Of the 24 CNS neuropeptide gene patterns we studied, six patterns are .90% DIMM-positive, while 16
of 22 patterns are .40% DIMM-positive. Thus most or all DIMM cells in Drosophila appear to be peptidergic, and many but
not all peptidergic cells express DIMM. The co-incidence of DIMM-expression among peptidergic cells is best explained by a
hypothesis that DIMM promotes a specific neurosecretory phenotype we term
LEAP. LEAP denotes Large cells that display
Episodic release of Amidated Peptides.
Citation: Park D, Veenstra JA, Park JH, Taghert PH (2008) Mapping Peptidergic Cells in Drosophila: Where DIMM Fits In. PLoS ONE 3(3): e1896. doi:10.1371/
journal.pone.0001896
Editor: Brian D. McCabe, Columbia University, United States of America
Received February 5, 2008; Accepted February 22, 2008; Published March 26, 2008
Copyright: ß 2008 Park et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The work was supported by a grant from the NSF (IBN-0133538) to JAP, and the NIH (NS21749) to PHT, and by an NIH Neuroscience Blueprint Core
Grant (#NS057105) to Washington University.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: taghertp@pcg.wustl.edu
Introduction
Neuropeptides were first studied as chemical messengers
secreted by hormone-producing neurons[1]. For example, mag-
nocellular neurosecretory neurons synthesize and release vaso-
pressin and oxytocin [2]. Neuropeptides are also secreted by
conventional neurons as co-transmitters with small, fast-acting
chemicals [3]. For example, mammalian skeletal motorneurons
release various neuropeptides along with acetylcholine[4]. Like-
wise, single modulatory interneurons in crustacea release neuro-
peptides along with GABA to affect distinct responses in neuronal
function[5].
Drosophila genetics provides useful research tools to investigate
the physiology of peptidergic and neuroendocrine systems [6–13].
Annotations of the Drosophila genome indicate it contains roughly
30 neuropeptide-encoding genes and roughly 45 genes encoding G
protein-coupled neuropeptide receptors [14–17]. In parallel
efforts, biochemical surveys of Drosophila have begun to systemat-
ically analyze and catalogue the Drosophila peptidome [18–22].
Most recently, Wegener and colleagues have begun to define the
neuroarchitecture of peptidergic projections within the CNS to
define the morphological rules by which peptidergic neurons
receive and send information [23]. The present work is a
contribution in the same vein: we attempt to provide an overall
map for an important developmental regulator of Drosophila
peptidergic cells, the basic helix loop helix (bHLH) transcription
factor DIMMED.
The precise profiles of transmitters and neuropeptides that are
produced by different cell types as a function of their positions
along the neuraxis are highly reproducible. Many cell-intrinsic
regulatory mechanisms that help establish specific transmitter
phenotypes have been discovered (e.g., [24,25]). However, the
relevant developmental mechanisms that underlie peptidergic cell
properties, especially those of neurosecretory peptidergic neurons,
remain poorly understood. Transcription factors such as Mash1,
Otp, Brn2, Sim1 and Sim2 are known to regulate the early
differentiation of hypothalamic neuroendocrine centers by their
expression in neuronal progenitors and in pre-migratory neu-
rons[26–32]. However little is known about the intrinsic regulatory
factors that directly organize maturation of peptidergic cellular
properties.
DIMMED protein (DIMM) has a limited expression pattern
within the CNS and periphery and, for the most part, first appears
within cells that have recently become post-mitotic [33,34]. There
are a few examples known of neurons that become post-mitotic in
the embryo, but which then delay differentiation until metamor-
phosis: in those cases, DIMM expression is likewise delayed[35].
DIMM is a member of the NeuroD family of bHLH transcription
factors and its mammalian sequence orthologue is Mist1[36].
Mist1 is required for normal differentiation of serous exocrine
PLoS ONE | www.plosone.org 1 March 2008 | Volume 3 | Issue 3 | e1896

cells[37,38]. For example, in Chief Cells of the stomach, Mist1 is
dispensible for cell survival, but is needed to complete cellular
trans-differentiation to display a robust zymogenic phenotype that
includes a highly active, regulated secretory pathway [39]. In the
fly, DIMM is a transcription factor whose direct targets include
PHM[40]–this gene encodes the enzyme regulating the rate-
limiting step for C-terminal neuropeptide amidation [9,41].
Amidation is a specific and critical post-translational modification
displayed by the vast majority of Drosophila neuropeptides[9,14].
Mammalian Mist1 trans-activates Drosophila PHM in cell culture
and like DIMM, it can drive ectopic expression of PHM in non-
peptidergic neurons of the fly in a transgenic model[40]. Initial
descriptions in Drosophila have linked DIMM expression with
peptidergic neurons and with peripheral endocrine cells[33–
35,40,42,43], though it is clearly not tied to any single
neuropeptide or peptide hormone. Miguel-Aliaga et al. [44]
surveyed DIMM-positive neurons in the Stage 17 embryo ventral
nerve cord and could ascribe several different molecular markers
to a large subset of them. However, there has not been a
comprehensive effort to map DIMM expression, or to evaluate the
degree to which its correlation with peptidergic cells is partial or
complete.
Here we map and identify nearly all 306 DIMM-positive cells in
the larval central nervous system. Furthermore, we use a large
panel of peptide antibodies and gene reporters to survey DIMM
expression in the context of Drosophila peptidergic systems. Our
observations reveal a substantial correlation of DIMM expression
with peptidergic phenotypes. Most or all DIMM cells are
peptidergic, but importantly, not all peptidergic cells are
DIMM-positive. We observe that DIMM is generally expressed
by those peptidergic cells that display the highest level of steady-
state secretory activity and which extend longer and more complex
neuronal processes–we define these as
Neurosecretory Neurons
and give them the acronym
LEAP, which stands for Large cells
that display
Episodic release of Amidated Peptides. We argue that
at a molecular level, DIMM concerns secretory peptides that are
amidated, and at a cellular level, DIMM concerns peptidergic
neurons which are Neurosecretory. We conclude that DIMM
plays a dedicated role to promote the differentiation of most of the
principle Neurosecretory (including neuroendocrine) cells in the
fly. A corollary to this conclusion is that in Drosophila, there exist
alternative regulatory pathways for the control of peptidergic
phenotypes in non-DIMM cells. Furthermore, we propose that
different peptidergic cells can be usefully described by their
divergent regulatory cascades, of which DIMM controls one.
Results
DIMM protein expression closely follows the pattern of
c929-GAL4
The P element c929-gal4 is inserted within the gene cryptocephal
and lies ,13kb upstream of dimm (Hewes et al., 2003). We
previously showed that the expression of crc mRNA is largely
ubiquitous in the larval central nervous system (CNS), while that of
dimm paralleled the c929-GAL4 pattern. To investigate this
correspondence at the protein level and with better resolution,
we used antibodies directed against the C-terminal domain of the
DIMM protein as described by Allan et al. [34]. Here we show in
the 3
rd
larval instar, most c929-positive cells represent DIMM-
positive cells (Figure 1).
In the wild type embryo, DIMM immunosignals appeared
transiently in broad domains of the ectoderm, beginning at St 11
and disappeared by St 14. DIMM protein then appeared in a
stable and reproducible pattern in several hundred cells of the
CNS and periphery (Figure 1A). In the periphery, anti-DIMM
labeled the dorsal pharyngeal muscle (not shown), the lateral
bipolar dendrite neurons[45], cells associated with the corpora
cardiaca of the Ring Gland, the trachea-associated Inka endocrine
cells, and cells associated with the developing heart (not shown).
This pattern of expression persisted throughout the larval stages,
with only minor changes. At a sub-cellular level, signals were
concentrated in the nucleus and also in small cytoplasmic
inclusions (visible in later figures); the inclusions were more prevalent
in younger specimens such as embryos, 1
st
and 2
nd
instar larvae,
and were generally absent in feeding stage, 3
rd
instar larvae (data
not shown; see also Supplemental Information). All nuclear signals
appeared specific because they were absent in dimm mutants
(Figure 1B), while cytoplasmic inclusions were non-specific-
present regardless of the dimm genotype. Among the stained nuclei,
we observed different levels of staining intensity: in this effort to
map DIMM expression, we focused on strong signals and did not
score low-level DIMM expression (Figure S1).
In the larval CNS, greater than 90% of DIMM-positive cells
expressed c929-GAL4, and virtually all GAL4-positive neurons
expressed DIMM (Figure 1C and Figure S1). The c929-GAL4
pattern includes some surface glia in the adult brain (data not
shown); in the larval CNS, no surface glia were DIMM immuno-
positive. Next, we asked whether peripheral neuroendocrine cells
that express c929-GAL4 also express DIMM. We found DIMM
co-localization in all the major endocrine and neuroendocrine
locations including, in the segmental lateral bipolar dendrite
neuron (LBD) of the peripheral nervous system (Figure 1A), in
seven cells of the stomatogastric nervous system (SNS)
(Figure 1D), in all 16 neuroendocrine cells within the corpora
cardiaca (CC) of the Ring Gland (Figure 1E), and in the 14
endocrine Inka cells associated with the tracheal system
(Figure 1A). However, several cells and tissues that normally
express c929-GAL4 did not display detectable DIMM immuno-
signals: the salivary gland, fat body, and tracheal cells.
In summary, we showed that the anti-DIMM antibody is
genetically-specific and that its expression pattern that is largely
congruent with that of c929-GAL4. In the following sections we
examine the pattern of DIMM expression in greater detail.
A map of DIMM-positive neurons in the larval CNS
We studied DIMM expression in late stage embryonic CNS (St
17) and in the CNS of feeding 3
rd
instar larvae that were
approximately 100 hr after egg laying (AEL). The earlier stage
produced clear DIMM expression signals but poorly developed
patterns of neuropeptide expression. The latter stage produced
robust neuropeptide expression as well as strong and maintained
DIMM expression. The DIMM expression pattern was basically
constant between the two developmental stages, and a simplified
overview is illustrated in Figure 2A. It includes 306 cells that are
distributed throughout the rostral-caudal axis of the CNS: a total
of 45 DIMM cells are found at different, though reproducible
locations within each brain hemisphere, and 8–22 DIMM cells are
observed per segmental neuromere, for a total of 216 in the VNC.
DIMM cells in the larval VNC. In order to provide a
segmentally-accurate map of DIMM cells, we employed the well-
described even-skipped (EVE) and engrailed (EN) markers of
segmental identity [46]. Triple-labels of EVE/EN and DIMM
were performed on late stage (St. 17) embryos (Figure 2B) and
double-labels (EVE/DIMM) on 100 hr AEL larval nervous
systems (Figure 2C). The developmental stability of the DIMM
expression map allowed us to assign provisional segmental
identities to larval DIMM cells based on similarity to their
inferred positions in the embryonic CNS (Figure 2D). Of these,
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 2 March 2008 | Volume 3 | Issue 3 | e1896

one lateral DIMM neuron per abdominal hemisegment was EVE-
positive in the larval, but not the embryonic CNS; three DIMM
cells were EN-positive per thoracic and abdominal hemisegments
in both embryonic and larval CNS. The EL group of EVE
neurons lies immediately posterior to the segmental boundary and
thus roughly marks the anterior domain of a neuromere [46].
Likewise, the PL group of EN neurons provides a rough position
for the posterior aspect of the neuromere [47]. Our interpretation
places DIMM cells essentially between the EVE and EN indicators
of segmental boundaries (Figure 2D). On this basis, we assigned
provisional segmental identity to each DIMM-positive neuron in
the larval ventral nerve cord (as described more fully in later
figures).
DIMM neurons in the larval brain. Pereanu and
Hartenstein (2006) established a 3D atlas of the pattern of
identified neuronal lineages of the larval brain based on the anti-
neurotactin (MAb BP106) staining pattern. This atlas serves as a
framework on which gene expression patterns may be positioned
and then compared in a consistent and systematic fashion. Thus,
to provide a positional reference system for DIMM-positive brain
cells, we determined the proximity of individual DIMM cells to
identified secondary neuroblast lineages[48]. Figures 3B, C and
D illustrate DIMM/neurotactin double staining images at
different dorsal-ventral levels. ,100 neuroblast lineages can be
distinguished in the 3
rd
instar larval brain, and we were able to
assign relative positions to 43 of the 45 DIMM-positive brain cells
(Table 1). One or two in the ventral brain were seen only variably
and hence could not be accurately scored. Each of the 45 cells was
assigned an arbitrary numerical identity and, where possible, the
closest neuronal lineage(s) were defined from a set of three
specimens.
Mapping the peptide identities of DIMM-expressing cells
Previous studies have shown that DIMM regulates cellular
phenotypes in diverse peptidergic neurons of Drosophila [33,34,40].
For example, the identified Tv neurons of thoracic segments
that express dFMRFa and the identifiable leukokinin-expressing
neurons of the abdominal segments all display strong regulation
by DIMM [33,34]. Likewise steady-state levels of the neuro-
peptide processing enzyme PHM (peptidylglycine alpha-hydrox-
ylating monooxygenase) are sensitive to loss of DIMM[33,40].
Moreover, gain-of-function analysis shows that DIMM can
confer strong PHM expression, and thus a peptidergic phe-
notype, onto all neurons of the CNS [34]. These studies strongly
suggest that DIMM is highly correlated with, and linked to,
mechanisms of peptidergic differentiation. Therefore, we asked-
how many of the 306 DIMM-expressing cells in the CNS can
be related to markers of known neuropeptides? Also we won-
dered if (or to what extent) the set of DIMM cells represents a
population that is homogenous and dedicated to peptidergic cell
function.
Figure 4 shows examples of double-staining for DIMM and
various neuropeptide markers. As described in a later section, we
observed partial to complete overlap of DIMM with various
neuropeptide markers. In total, we examined more than 24
neuropeptide markers (see Tables 2 and 3) for potential co-
localization with DIMM in the 100 hr AEL larval CNS. The
Tables list markers for 26 genes, but we do not include AKH or
ETH markers in this section, as they are only expressed by
peripheral endocrine/neuroendocrine cells. In fact all ETH- and
AKH-expressing cells are also DIMM-positive (Figure 1, Figure
S2 and data not shown; see also Gauthier et al., 2006). Five known
or suspected Drosophila neuropeptides were not analyzed in these
studies for lack of suitable markers-the Drosophila immune
inducible genes 2 and 4 [18], and neuropeptide-like precursors
2, 3 and 4 [19]. Therefore the genes we could investigate cover the
vast majority, but not all of the known neuropeptide genes in the
fly. In the following sections, we describe the peptide identities of
DIMM-positive cells according to their regional positions within
the CNS.
Identities of DIMM neurons in the 100 hr AEL ventral
nerve cord
Suboesophageal segments S1–S3. There are 40 DIMM-
positive cells in these neuromeres and all are found in the ventral
aspect: We found three neuropeptide markers expressed among
different members of these three neuronal sets, and could therefore
identify 65% (26/ 40) of the suboesophageal segment DIMM cells
with at least one peptide marker (Figure 5). All DIMM-positive
neurons in S1 and S2 are Hugin-YFP-positive. Of the 18 DIMM-
positive neurons in S3, two are dromyosuppressin- (DMS-)
positive, two are CAPA-positive and two are dFMRFa-positive.
We suspect that the latter two pairs represent the same pair of
neurons.
Figure 1. DIMM immunostaining and its correspondence to
c929
-GAL4 expression. A) Anti-DIMM staining in St 17 wild type embryo and
(B) in a dimm mutant (Rev8/Rev4). Asterisks mark the peripheral LBD neuron; Arrowheads mark positions of the Inka cell. C) c929(dimm) signals are
highly congruent with DIMM antibody staining. Arrows mark the few DIMM cells that are not c929-positive. DIMM-positive neurons are also c929-
positive in (D) the stomatogastric nervous system (SNS), and (E) in the sixteen cells of corpora cardiaca (CC) within the Ring Gland.
doi:10.1371/journal.pone.0001896.g001
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 3 March 2008 | Volume 3 | Issue 3 | e1896

Thoracic segments T1–T3. There are 46 DIMM-positive
cells in segments T1–T3 and these are found medially and
laterally, in both ventral and dorsal aspects. Thoracic DIMM
neurons variously express five different peptide markers (for
neuropeptide-like precursor 1 (NPLP1), dFMRFa, crustacean
cardioactive peptide (CCAP), allatostatin B (Ast-B) and corazonin
(COR) (Figure 5). We could identify 82% (38/ 46) of the thoracic
segment DIMM cells with at least one peptide marker.
Abdominal segments A1–A9. Abdominal segments
contained between eight (A7) to twenty four (A1) DIMM-
Figure 2. A map of DIMM-expressing neurons in the 100 hr AEL larval CNS. Top: schematic of the CNS along with cross-sections of each
segmental neuromere to illustrate dorsal-ventral positions of DIMM-expressing neurons. Details on positions of individual DIMM-positive neuronsin
the brain hemispheres are given in later figures. Bottom: use of EVE and EN expression patterns to assign DIMM neurons to individual segments. Left:
triple-labeled St. 17 embryonic CNS stained for EVE (blue) EN (green) and DIMM (red); middle: double-labeled 100 hr AEL larval CNS stained for EVE
(green) and DIMM (red); right: schematic of an idealized abdominal segment showing the interpretation used to assign segmental values to DIMM
neurons in the VNC.
doi:10.1371/journal.pone.0001896.g002
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 4 March 2008 | Volume 3 | Issue 3 | e1896

positive cells, for a total of 130 DIMM-positive cells in segments
A1–A9. Several segmental homologues are present in multiple
abdominal segments, including DIMM neurons expressing COR,
allatostatin A (Ast-A), ion transport polypeptide (ITP), Diuretic
Hormone 31 (DH 31), NPLP1, and leukokinin (LK) (Figure 6). In
some instances, single DIMM neurons were labeled by multiple
neuropeptide markers–antibodies to DH 31 and to ITP and to
Ast-A often labeled the same neurons (Figure 6). In all, we could
identify 65% (85/ 130) of the abdominal segment DIMM cells
with at least one peptide marker.
Identities of DIMM neurons in the brain
We found that 78% (35 of the 45) DIMM cells per brain lobe
could be identified by at least one of the 24 different neuropeptide
markers (Table 2; Figure 7); in all, seventeen different
neuropeptide markers identified diverse, DIMM-positive brain
cells. In some instances, single DIMM neurons were labeled by
multiple neuropeptide markers. For example, MP1 cells (#4 and
5) expressed drosulfakinin- (DSK-)GFP and allatostatin C (Ast-C)
immunosignals; the seven Drosophila insulin-like peptide- (dILP-)
expressing cells (#3-9) were also DSK-GFP-positive; the single
DTK cell (#37) was allatostatin B (Ast-B-GFP-)-positive. The Pars
Intercerebralis (PI) and Pars Lateralis (PL) are the principle
neurosecretory centers of the insect brain (Hartenstein, 2006).
Sixteen PI neurons are DIMM-positive (#19-34) and also c929-
positive (Figure 8A). Among the 16 DIMM-positive cells, seven
were dILP2-GAL4-positive cells, between two and seven were
DSK-GAL4-positive, three were positive for DH 44, two for SIFa
and two for DMS antibodies (Figure 8B–F). We asked whether
these markers are co-expressed among the PI neurons. All DSK-
GAL4-positive neurons are also dILP2-positive, while the other
neuropeptide markers highlighted unique PI subsets (Figure 8G–
M). Thus, we found that many Drosophila PI neurons express
DIMM and at least one of five different neuropeptide markers,
dILP2, DSK-GAL4, DH 44, SIFa or DMS (Table 4).
In summary, our double staining experiments revealed that 306
of the ,10,000 neurons of the larval CNS express DIMM protein,
while the suite of 23 neuropeptide markers identified ,1030
diverse neurons. Disregarding known instances of dual neuropep-
tide expression by single cells, we consider the peptide markers to
reveal 530 distinct cells. The rate of false positive discovery of a
Figure 3. Mapping positions of DIMM-positive neurons in the larval brain hemispheres. (A–C) Representative single confocal scans of a
100 hr AEL larval brain hemisphere that was double-labeled for MAb BP106 (anti-neurotactin) and anti-DIMM (green). (A) In the dorsal aspect, Cell #1
(MP0) lies adjacent to the CP1 secondary neuroblast lineage. (B) at a mid-dorsal position, Cell #8 is adjacent to DPMm1/2, Cells 12 and 13 are
adjacent to DPLl3/4 and cells 6–7 are adjacent to CM1; (C) more ventral, Cell #14 is found close to DPLc1-4, Cell #15 close to DPL3/4 and Cell #17
close to BLD3/4. See Table 1 for the complete listing of results from this analysis.
doi:10.1371/journal.pone.0001896.g003
Table 1. Positions of DIMM-positive cells in the brain.
Cell# Cell Name NP Marker Secondary Lineage(s)
1 MP3 Unknown CP1, CM1
2–3 MP 4–5 CCAP DPMpl1, CM3
4–5 MP1 DSK-GAL4/AstC CM2, CM3
6–7 MP2 sNPF/DMS CP1, CM1
8 NPF-M NPF-GAL4 DPM1/2, DPMl3
9–11 PL 1–3 DMS/ ITP DPLl3/4, BLD5
12–14 PL 4–6 Crz DPLl1/2, DPL3/4, DPMl4
15 PL 7 DMS/ ITP DPLl3/4, BLD5
16 PL 8 Unknown DPLl3/4, BLD5
17 PL 9 Leucokinin BLD3/4, BLD1/2
18 PL10 (NPF-L) NPF-GAL4 BLD3/4, BLD1/2
19–25 PI 1–7 dILP/DSK-GAL4 PI
26–27 PI 8–9 SIFa PI
28–30 PI 10–12 DH 44 PI
31–32 PI 13–14 DMS PI
33–34 PI 15–16 Unknown PI
35 VP 1 Ast-A BAlp1/2/3
36 VA 1 Unknown Not assigned
37 VA 2 EH DAMd2/3, DALcm1
38 VA 3 DTK/Ast-B DAMd1
39 VA 4 Unknown DAMd2/3, DALcm1
40–41 VP 2–3 Unknown damv
42 VP 4 Unknown Bamv2, DALcm2
43 VP 5 Unknown Bamd1
44–45 VP 6 Unknown Not assigned
Cells not assigned to Secondary lineages were either not reproducible in
position or variably-stained.
Notes: In the cell group 40–43, one of the cells is DH 31-positive, but we did not
determine which. Abbreviations: NP: neuropeptide; MP: medial protocerebral;
PI: Pars Intercerebralis; PL: Pars Lateralis; VA: ventral anterior; VP: ventral
posterior;
doi:10.1371/journal.pone.0001896.t001
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 5 March 2008 | Volume 3 | Issue 3 | e1896

single peptide marker within DIMM-expressing cells should be
roughly [(306/10,000) * (1030/10,000)]*10,000 = ,31 cells.
More than 200 of the 306 DIMM cells were associated with a
specific peptide marker, thus we consider the population of DIMM
cells to be highly enriched for a peptidergic phenotype.
Overlap of DIMM within individual neuropeptide
expression patterns
Figure 9 presents schematic diagrams to illustrate the overlap
of DIMM immunosignals with 24 different neuropeptide markers
in the larval CNS. Figure 10 quantifies the same data. We
observed three patterns of co-localization of DIMM antibody
signals with those for individual neuropeptide markers. (i)
Complete Overlap was displayed by 6/24 markers: .90 % of
peptide-expressing cells were also DIMM-positive. (ii)
Partial
Overlap was displayed by 16/24 markers: between 4 and 90% of
peptide-expressing cells were also DIMM-positive. (iii)
Virtually
No Overlap was displayed by 2/24 markers: ,4% of peptide-
expressing cells were also DIMM-positive. Examples of the co-
localization between DIMM and neuropeptide markers for each of
the three categories are shown in Figure 4. Here we describe each
category in turn.
Category A: Complete Overlap with DIMM. Hugin-YFP
(marks 22 neurons located in subesophageal segments S1 and S2
[49]): 20 of these are strongly DIMM-positive (Figure 4A).
Likewise SIFa- (Figure 8C), eclosion hormone- (EH-), dILP2-
(Figure 8B), Diuretic hormone 44- (DH 44-) (Figure 8D), and
COR-expression markers (Figure 4B) all displayed greater than
90% overlap with DIMM.
Category B: Partial Overlap with DIMM. The extent of
partial overlap was very broad among different peptide markers,
but reproducible for individual markers. For example, eight of
twelve allatostatin A (Ast-A-)-positive cells were DIMM-positive
(Figure 4C), and most CAPA-expressing neurons were all
strongly DIMM-positive. In the case of CCAP, we saw that 12
of the 29 peptidergic cells were DIMM-positive (Figure 4D).
There were 32 dTK-positive cells but only two were DIMM-
positive (Figure 4E). Other peptidergic systems displaying partial
overlap included DSK (Figure 8E), DMS (Figure 8F), Ast B, Ast
C, LK, neuropeptide F (NPF-GAL4), pigment dispersing factor
(PDF), dFMRFa, ITP, short neuropeptide F (sNPF), NPLP1, and
DH 31.
To assess how reproducible are partially overlapping patterns
we counted the incidence of peptide marker and DIMM overlap in
a large cohort of specimens for each of two peptides in this
category– dTK and LK. For DTK, we counted an average of 29.7
+/2 0.57 peptidergic neurons (n = 21 specimens and each had
exactly 2 neurons that were DIMM-positive. For the case of LK,
we counted an average of 23.17 +/2 0.43 peptidergic neurons
(n = 17 specimens), of which 17.65 +/2 0.28 were DIMM-
positive. In both dTK and LK systems, the DIMM-positive
neurons appeared to be a reproducible subset, as judged by cell
body position.
An additional feature that described the ‘Partial Overlap’
category was the strong correlation between DIMM-co-expression
and intensity of peptide marker expression. For example, among
CCAP-expressing neurons, strongly-stained neurons were invari-
ably DIMM-positive and ‘‘less-strongly’’ stained ones were
DIMM-negative (Figure 4C). This correlation was also clearly
evident in the co-expression patterns for PDF, COR, DMS,
dFMRFa, LK, dTK, NPLP1, CAPA-, ITP-, Ast A and Ast B. The
example of PDF:DIMM coincidence is especially interesting as the
DIMM-negative LNv (see also Taghert et al., 2001) are implicated
in control of circadian locomotor rhythms via neuropeptide PDF
Figure 4. Examples of double-antibody stains performed in the
CNS of 100 hr AEL larvae to compare DIMM immunosignals
with those for markers of 24 different peptidergic systems.
Table S1 provides the summary of numerical results from this analysis;
Table 2 lists the markers used. Figure 5, 6, 7, 8, 9 and 10 provide
more details of DIMM/peptide marker overlap for each CNS region and
for each peptide marker. Overlap of DIMM and different peptides varies
from complete to virtually none. (A) An example of a peptide system
that exhibits complete overlap with DIMM: Hugin-YFP-neurons in S1
and S2 are all strongly DIMM-positive. (B) Of several COR-immunopo-
sitive neurons in the CNS, several are DIMM positive. (C–E). Examples of
peptide systems that exhibit partial overlap with DIMM. (C) The most
strongly stained Ast-A-positive neurons are also DIMM-positive. (D)
Likewise, the most strongly stained CCAP-expressing neurons are
DIMM-positive (arrow), while the weakly stained cell is DIMM-negative
(arrowhead). (E) The dTK system shows only a single DIMM-positive cell
(arrow) among many DIMM-negative dTK-expressing cells (arrowheads):
it is the largest and most strongly-stained. (F) An example of little or no
overlap with DIMM: anti-proctolin antibodies label several hundred
neurons in the CNS, of which only one cell type–the Ap-let neuron [35]
is weakly stained by proctolin antibodies but is strongly DIMM-positive.
NPs: neuropeptides.
doi:10.1371/journal.pone.0001896.g004
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 6 March 2008 | Volume 3 | Issue 3 | e1896

release (recently reviewed by [50]). The sNPF, DH 31 and Ast C
patterns present three prominent exceptions to that general rule.
Specifically, the most strongly-staining cells in these groups were
reproducibly not DIMM-positive. sNPF and DH 31 peptides are
potentially amidated; the AstC peptide is not. Thus sNPF and
DH31 systems were exceptions to this general rule. These systems
can produce amidated peptides according to their genomic
sequences and amidated forms have been recovered by purifica-
tion or peptidomic analyses[51].
Category C: Virtually No Overlap with DIMM. Two
peptide markers displayed little if any overlap with DIMM.
The two prothoracicotropic hormone (PTTH-) producing
neurons of the brain did not express DIMM and the widely-
expressed pentapeptide proctolin (.400 proctolin-positive
neurons per larval CNS) overlapped with DIMM only in the
24 Ap-let neurons (Figure 4F). Ap-let neurons are peptidergic
[35] and recently were shown to express the NPLP1 neuro-
peptide ([52] and Figure 9). They were weakly proctolin-
immunoreactive.
Relationship between neurons expressing DIMMED and
Ddc
Co-expression of peptide and bioactive amine transmitters is a
common observation in many different model systems [53]. We
wondered whether DIMM cells also co-express small conventional
transmitters. Using c929-GAL4 (the dimmed reporter) and a specific
anti-Ddc [54], we previously reported a strict segregation of c929
and Ddc immunosignals in the larval CNS[33]. We re-examined
this question with a Ddc-GAL4 line and DIMM antbody staining.
Surprisingly, we found that the prominent CRZ-positive neurons
in the ventral aspect of segments A2-A7 were Ddc:GAL4-positive,
as were the PDF-expressing mid-line neurons of segments A8 and
A9, and the dorso-lateral CCAP-expressing neurons of segments
A1-A4 (data not shown). All these cells were DIMM antibody-
positive (Figure 6). We consider possible explanations for this
different result in the Discussion.
Table 2. Antibodies used for these experiments.
Neuropeptide antibodies Donor Dilution References
Rb anti-AKH (D. melanogaster) S. Kim, Stanford 1:300 Kim and Rulifson [62]
Rb anti-leucokinin (L. maderae J.Veenstra, Bordeaux 1:500 Chen et al. [82]
Rb anti-FMRFamide (A. californica P. Taghert, St. Louis 1:2500 Taghert and Schneider [83]
Rb anti-pro-dFMRFa (D. melanogaster R. Scheller, Palo Alto 1:2000 Chin et al. [84]
Rb anti-eclosion hormone (M. sexta J. Truman, Seattle 1:500 Truman and Copenhaver, [85]
Rb anti-allatostatin C (M. sexta S. Tobe, Toronto 1:500 Zitnan et al.[86]
M anti-allatostatin A (D. punctata B. Stay, Iowa City 1:2 Stay et al. [87]
Rb anti-CCAP (D. melanogaster J. Ewer, Valparaiso 1:500 Truman and Ewer [88]
Rb anti-proctolin (D. melanogaster D. Nassel, Stockholm 1:1000 Taylor et al. [89]
Rb anti-LMS (L. maderae L. Schoofs, Leuven 1:500 Schoofs et al.[90]
Rb anti-dILP2 (D. melanogaster E. Rulifson, Philadelphia 1:500 Rulifson et al.[91]
Rb anti-corazonin (D. melanogaster L. Roller, Bratislava 1:1000 Roller et al.[92]
Rb anti-s-NPF (D. melanogaster K. Yu, Daejon 1:250 Lee et al.[93]
Rb anti-NPF (D. melanogaster P. Shen, Athens 1:1000 Wu et al.[94]
Rb anti-b PDH (U. pugilator R. Rao, Pensacola 1:10,000 Nassel et al. [95]
Rb anti-DH44 (D. melanogaster J.Veenstra, Bordeaux 1:500 Cabrero et al.[96]
Rb anti-SIFa (D. melanogaster J.Veenstra, Bordeaux 1:500 Terhzaz et al.[97]
Rb anti-IPNa (D. melanogaster L. Schoofs, Leuven 1:1000 Verleyen et al.[98]
Rb anti-pro-CAPA (D. melanogaster J.Veenstra, Bordeaux 1:1000 Kean et al.[99]
Rb anti-DH 31 (D. melanogaster J.Veenstra, Bordeaux 1:1000 this study
Rb anti-Ast B (D. melanogaster J.Veenstra, Bordeaux 1:1000 this study
Rb anti-ITP (S. gregaria H. Dircsken, Stockholm 1:2000 Macins et al.[100]
doi:10.1371/journal.pone.0001896.t002
Table 3. Transgenic flies used for these studies
GAL4 lines Donor References
CCAP-gal4 J. Park, Knoxville Park et al.[101]
CRZ-gal4 J. Park, Knoxville Choi et al.[102]
DSK-gal4 J. Park, Knoxville this study
SIFa-gal4 J.Veenstra, Bordeaux Terhzaz et al.[97]
DMS-gal4 J.Veenstra, Bordeaux this study
NPF-gal4 P. Shen, Athens Wu et al.[94]
dILP2-gal4 E. Rulifson, Philadelphia Rulifson et al.[91]
36Y-gal4 K. Kaiser, Glasgow O’Brien and Taghert [64]
Hugin-YFP, Hugin-Gal4 M. Pankratz, Karlsruhe Melcher and Pankratz [67]
Mai301-gal4 Gunter Korge, Berlin Siegmund and Korge [60]
Kurs6-gal4 Gunter Korge, Berlin Siegmund and Korge [60]
Feb191-gal4 Gunter Korge, Berlin Siegmund and Korge [60]
doi:10.1371/journal.pone.0001896.t003
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 7 March 2008 | Volume 3 | Issue 3 | e1896

Discussion
To evaluate and interpret the phenotypic traits associated with
normal expression of dimmed, we have employed three independent
anatomical measurements–(i) mRNA in situ’s, (ii) regulatory
promoter sequences [33,34], and (iii) specific antibody staining
([40], and this study). Expression starts in mid-embryonic stages in
200-300 cells of the CNS and in several endocrine cells. In most of
these cells, dimm expression carries forward stably through all
subsequent developmental stages. The dimm in situ pattern was
highly reminiscent of the c929-GAL4 pattern [33]. Here we have
shown that the c929:GAL4 pattern is precisely matched by the
expression of DIMM immunosignals (Figure 1). These signals are
essentially lost in dimm mutant backgrounds ([33]; this study,
Figure 1) validating the interpretation that DIMM is normally
restricted to a widely-distributed, but numerically-restricted subset
of central and peripheral cells. Therefore, the map of DIMM-
expressing cells we present is based on a foundation of
independent methods, which together produce highly congruent
results. That internal consistency increases the value of our
subsequent efforts to identify and characterize DIMM-expressing
cells in the aggregate, and as individual cells.
Physical mapping of DIMM cell bodies
We used the larval brain mapping atlas of Perneau and
Hartenstein [48] to fix approximate locations to the DIMM-
expressing cells in the hemispheres. We found that the ,45
DIMM cells in each hemisphere occupy reproducible positions in
proximity to one or more identified secondary lineage. Secondary
lineages are defined as the clones derived from post-embryonic
divisions of the ,100 neuroblasts per brain hemisphere [48,55].
The lineage histories of insect peptidergic neurons are largely
unknown, but the physical association of DIMM neurons with
specific secondary lineages suggests the potential for assigning
clonal relationships to them. The lineage history of DIMM cells as
a group is of fundamental significance because these cells comprise
a large fraction of the most significant peptidergic neurosecretory
neurons of the Drosophila brain. The cell lineage of certain of the
CRZ-, dFMRFa- and NPLP1-expressing DIMM neurons have
been described [52,56,57]. The distributed and largely invariant
positions of DIMM cells in the CNS suggest their derivation from
numerous, different NBs, but this supposition awaits future
experimental analysis. 16 of the 45 DIMM cells in the brain are
likely not derived from specific neuroblasts as they are found
within the PI region of the protocerebrum. The PI is one of the
major insect brain neuroendocrine centers [58] and its develop-
mental origins from ectodermal placodes have recently been
described by de Valasco et al. [59]. Siegmund and Korge [60] used
random GAL4-generated reporter activity to identify as many as
Figure 5. Neuropeptide identities of DIMM cells in the SEG and
Thoracic regions of the larval CNS. Neuromeres S2 and T3 are
shown as representative of the two regions. The adjoining pie charts
indicate the percentages of DIMM-positive neurons in all SEG and
thoracic segments respectively that were associated with a specific
peptide marker.
doi:10.1371/journal.pone.0001896.g005
Figure 6. Neuropeptide identities of DIMM cells in the
abdominal region of the larval CNS. Neuromeres A1 and A8 are
shown as representative of the region. The adjoining pie chart indicates
the percentage of DIMM-positive neurons in all abdominal segments
that was associated with a specific peptide marker.
doi:10.1371/journal.pone.0001896.g006
Figure 7. Neuropeptide identities of DIMM cells in the brain.
Top diagram illustrates the positions of cells along the medial-to-lateral
axis; bottom diagram indicates the positions of cells along the dorsal-
to-ventral axis. Cells are numbered arbitrarily, as listed in Table 1. The
adjoining pie chart indicates the percentage of DIMM-positive neurons
that was associated with a specific peptide marker.
doi:10.1371/journal.pone.0001896.g007
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 8 March 2008 | Volume 3 | Issue 3 | e1896

18 PI neurons that innervate the Ring Gland in each Drosophila
brain hemisphere. We found that all of the PI neurons revealed by
the Jan191-, Mai301- and Kurs6-GAL4 lines were DIMM-positive
(unpublished observations).
Most or all DIMM cells are peptidergic
DIMM was originally described in the context of peptidergic
neuronal expression [33], but the possible restriction to that cellular
class was never quantified. The present results confirm that many
DIMM cells are in fact peptidergic and suggest that most may be.
Using markers for ,24 peptide-encoding genes, we could assign
peptide identities to 64% of the 306 DIMM-expressing cells in the
100 hr AEL larval stage Drosophila. Furthermore, the broad
representation of DIMM among most of peptide markers here
surveyed (only two or three of 24 markers lacked substantial DIMM
expression) suggests the percentage of identifiable DIMM cells will
increase as markers for other Drosophila peptide systems become
available. We used specific anti-peptide antibodies and neuropep-
Figure 8. The expression patterns of five neuropeptide markers within DIMM-expressing neurons of the PI. (A) DIMM and c929-GAL4
are co-localized within 16 PI neurons. (B) All dILP2-expressing neurons are DIMM-positive. (C) The two SIFa-positive neurons are both DIMM-positive.
(D) The three DH 44-expressing neurons are all DIMM-positive. (E) All seven DSK-GAL4-positive neurons are DIMM-positive. (F) The DMS-positive
neurons are DIMM-positive. (G) The seven DSK-GAL4-positive neurons (as visualized with UAS-lacZ) are dILP2-positive. (H) dILP2-positive neurons and
SIFa-positive neurons are distinct. (I) dILP2-positive neurons and DMS-positive neurons are distinct. (J) dILP2-positive neurons and DH 44-positive
neurons are distinct. (K) The SIFa-positive and DMS-positive neurons are distinct. (L) The SIFa-positive and DH 44-positive neurons are distinct. The
results are illustrated in the schematic at the bottom of the figure and in Table 2.
doi:10.1371/journal.pone.0001896.g008
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 9 March 2008 | Volume 3 | Issue 3 | e1896

tide GAL4 lines where available (Tables 2 & 3) and refer to these
as ‘‘peptide markers’’ because these have not all been verified to be
100% authentic expression patterns. For example, there could be
cross-reactivity between markers (especially significant for markers
of the various RFamide-and PRXamide-containing peptides) but
that would not preclude their inclusion in this effort to map the
potential peptidergic character of DIMM-positive cells. With
respect to the incidence of co-transmitter expression among
peptidergic DIMM-positive neurons, we found that a few DIMM
antibody-positive in the VNC were Ddc-GAL-positive neurons. The
Ddc-GAL4 pattern appears exhuberant compared to that demon-
strated by the anti-Ddc antibody ([33,54] and B. White, pers.
communication). One possible conclusion is that, unlike other
peptidergic neurons. DIMM cells are dedicated to a very high-level
peptidergic function (see below) and so cannot also sustain
expression of conventional co-transmitters.
Where DIMM fits in among peptidergic cells
Peptidergic cells are not easily classified–they may be large or
small, express different neuropeptides, may have varying levels of
peptide output, and they may modify their secretory peptides post-
translationally in several alternative ways. To discuss the possible
roles of DIMM in peptidergic cell biology of Drosophila,we
illustrate a range of cellular phenotypes in Figure 11. This range
distinguishes neurons according to three main attributes–(i)
physical size, (ii) physiological status (meaning, the level of
secretory activity or suspected cellular class) and (iii) biochemical
activity (specifically, post-translational modifications of the secret-
ed peptides). DIMM distinguishes a precise subset of peptidergic
cells, but not according to peptide identity. Rather, we propose
that DIMM is normally associated with those peptidergic cells that
(i) are large cells and not small, (ii) are neurosecretory cells and not
interneurons or motorneurons (i.e., highly active in peptide
production and episodic release), and that (iii) amidate their
secretory peptides post-translationally. To symbolize the amal-
gamation of these three properties into a singular, genetically-
defined cell fate we propose calling DIMM-expressing cells
LEAP
cells–
Large cells that Episodically release Amidated Peptides.
Next, we discuss each of these three ideas separately.
DIMM peptidergic cells are relatively large
We found DIMM as a normal component of many of the classic
and well-studied Drosophila neuroendocrine systems–these include
AKH-expressing cells of the corpora cardiaca [61–63], ETH-
expressing cells of the Inka system [64,65], a large fraction of the
classic Pars Intercerebralis[66], the hugin-expressing neurons of
the subesophageal segments [67] and the Tv neurons of the
thoracic segments [68]. These DIMM-positive neural and
endocrine cells must attain large cell body size in part to sustain
production of hormone levels sufficient to release effective doses
into the general circulation. Beyond the association with classic
neurosecretory systems, we noted that DIMMED expression is
also highly predictive of greater size among cells co-expressing a
single peptide marker. For example, in the larval CNS there are
two sets of neurons expressing the neuropeptide PDF (Figure 11):
(i) the eight LNv’s of the brain are interneurons and DIMM-
negative (they later become critical circadian pacemakers in the
adult CNS–[69]), and (ii) a group of 4–6 neurons of abdominal
segments A8 and A9 that project long axons onto the hindgut.
This second PDF-expressing group is Neurosecretory (neuroen-
docrine) and DIMM-positive; these cells have large cell bodies and
considerable amount of axonal arbor (Figure 11, left side). Thus
DIMM neurons display large cell bodies, are more likely to extend
a peripheral axon, or display an axon that spans the entire length
of the CNS. This interpretation is partly circular: estimations of
cell body size and visibility of neuronal arbor are highly dependant
on the intensity of anti-peptide antibody staining, which we have
shown to be critically dependent on DIMM levels [33,34,40].
Nevertheless, in considering the physiological contributions that
DIMM may make to the differentiation and organization of
peptidergic cells, we speculate that the issue of size is highly
pertinent to the biology of DIMM neurons.
To further emphasize the correlation of normal DIMM
expression and cell body size, we note that in the adult CNS,
the small LNv remain DIMM-negative, while the newly-
differentiated large LNv are DIMM-positive ([70] and data not
shown). This positive correlation between DIMM expression and
increased cell size also holds for other markers in the ‘‘Partial
Overlap’’ category, including: dTK, dFMRFa, DSK, DMS,
NPLP1, NPF, Ast-A, and LK cells. Therefore, we propose DIMM
neurons are large, they often projecting axons to the periphery or
to long distances within the CNS. They are distinguished by these
features from most other peptidergic interneurons (like the PDF-
expressing interneuronal LNv) which are more diminutive.
DIMM peptidergic cells are neurosecretory and display a
high physiological state
The classic features of neurosecretory function are the
production and release of large amounts of hormone(s): the Bag
Cells of Aplysia dedicate 50–70% of protein synthesis to production
of the peptide Egg Laying Hormone [71]. Likewise, individual
vasopressin-secreting magnocellular neurons are estimated to
contain 2,000 molecules of vasopressin mRNA per cell, and
oxytocin-secreting neurons contain 5,000 to 12,000 molecules of
oxytocin mRNAs per neurosecretory cell [72]. As mentioned
above, DIMM is a normal molecular constituent of most of the
classic peptide neurosecretory systems of Drosophila. Therefore, we
propose that DIMM cells display, on average, a more highly-active
secretory profile that conventional interneurons or motorneurons–
and that DIMM is therefore essential to define a prevalent class of
Neurosecretory Neuron in the fly (Figure 11, top left). This class
comprises neuroendocrine cells that project into the periphery to
form neurohaemal endings and release products into the
circulation. Likewise we propose the DIMM Neurosecretory class
also includes the large DIMM-positive peptidergic neurons that
extend axons long distances and maintain large axonal arbors, but
which remain within the CNS. Examples of that category include
the DIMM-positive dTK neuron (#38, Table 1), the NPF-
positive cell (#8–Table 1) and the sNPF/DMS- positive cells
(#4-5, Table 1).
We further speculate that DIMM cells are defined by the
common physiological property of displaying Episodic Release.
The term refers to brief periods of intense secretory activity that
Table 4. Co-expression of peptide markers among the 16
DIMM-positive neurons of the Pars Intercerebralis.
DIMM dILP2
DSK
-Gal4 SIFa DH 44
dILP2 Yes - - - -
DSK-
Gal4 Yes Yes - - -
SIFa Yes No No - -
DH 44 Yes No No No -
DMS Yes No No No No
doi:10.1371/journal.pone.0001896.t004
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 10 March 2008 | Volume 3 | Issue 3 | e1896

Figure 9. Schematics describing the distribution of cells scored positive for each of the 24 peptide markers found in the 100 hr AEL
larval CNS. If the peptides are potentially amidated, this is noted below each marker name in parentheses (
amidated). Blue cells are marked by the
peptide marker, but lack DIMM staining;
Red cells co-express DIMM. The proctolin schematic does not show the complete complement of ,400
proctolin-immunoreactive neurons. Schematics are distributed with ones showing greater percentages of DIMM co-expression are towards to the top
of the figure and ones showing lesser percentages are towards the bottom.
doi:10.1371/journal.pone.0001896.g009
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 11 March 2008 | Volume 3 | Issue 3 | e1896

delivers large amounts of stored peptide quickly. DIMM cells
already known to display this property include the Inka cells [73],
EH cells [7], and Bursicon/CCAP cells [11]. By analogy with
studies in other insects [74], we presume that the DIMM-positive
Drosophila AKH cells also release episodically. By analogy with the
rapid post-prandial activation of mammalian insulin-producing
cells (reviewed by [75]), we presume dILP-2-producing neurons of
the Drosophila PI also display episodic release. Additional examples
in Drosophila derive from recent physiological studies of ETH
actions. The peptide hormone ETH triggers sequential (episodic)
waves of activation in diverse peptidergic target neurons in the
larval CNS [76]. The first cells to respond are the DIMM-positive
Tv neurons (expressing dFMRFa), followed by the EH cells, then
DIMM-positive CCAP cells (cell 27/703), and finally the DIMM-
positive Bursicon/CCAP-containing of the abdominal segments.
Hence for many of the DIMM neurons about which we have at
least some information concerning their activity, they undergo
release events episodically, as indicated by the sudden, temporally-
restricted manner in which they are activated.
High-levels of steady-state peptide antibody staining may be
explained by affecting any of three cellular properties: (i) increased
peptide synthesis/ accumulation, (ii) decreased peptide release or
(iii) decreased peptide turnover. Most of the available evidence
concerning DIMM functions cannot distinguish between these
potential explanations, and each may have validity. However, it
now well established that DIMM is a strong activator of the
neuropeptide biosynthetic enzyme PHM [34,40] and this means
that DIMM is a pro-secretory regulatory factor. This is evidence to
support the first explanation and hence we interpret DIMM-
dependent changes as not simply the prevention of neuropeptide
release or turnover. We favor the interpretation that the individual
DIMM cells are the most strongly-stained for secretory peptide
products because they display the highest levels of secretory
activity.
Our speculations are based on correlating the cellular properties
of neurons that
normally produce DIMM, as shown in this report.
In addition, they are supported by several, previous
experimental
studies: genetic analyses employing dimm loss- and gain-of-function
states [33,34,40,43]. In particular, the dimmed loss of function
phenotype reflects a decline in steady-state levels of peptides and
peptide biosynthetic enzymes [33]. DIMM does not influence cell
survival, and the mutant neurons retain the ability to produce at
least a certain low-level of peptidergic production. Thus dimm is
not required to initiate the differentiation of a peptidergic
phenotype but instead appears necessary for the full, quantitative
display of the peptidergic neurosecretory phenotype. In similar
fashion, the mammalian sequence orthologue of dimm, called
Mist1, is not needed for survival or initial specification of the Chief
cells as secretory cells of the stomach. Instead it is needed for their
complete differentiation as zymogenic cells, which normally
display a robust secretory phenotype [39].
DIMM peptidergic cells specifically express amidated
peptides
The third distinguishing feature we highlight is the strong
correlation of DIMM with C-terminal peptide amidation.
Neuropeptide amidation is a post-translational modification of
many neuropeptides–about 50% of peptides in mammals [77] and
greater than 90% of peptides in Drosophila are amidated [14].
Amidation can affect the turnover rate of secreted peptides and/
or affect the binding or activation of receptors by secreted peptides
(reviewed by [77]). DIMM directly regulates the PHM gene which
encodes the rate-limiting enzyme for peptide amidation [40], and
its expression is highly congruent with that of PHM[33,34].
If this regulatory connection is meaningful, then normal DIMM
expression should be highly correlated with that of amidated
peptides. In addition, it should not show any particular correlation
with expression of non-amidated peptides. We note that very few
anti-peptide antibodies are known to distinguish between ami-
dated and Gly-extended forms of their peptide antigens. Thus,
‘‘actual’’ amidation states of peptides which may be amidated is
uncertain for any given neuron. However, peptide amidation
displays specific sequence requirements and neuropeptides that do
not show these (e.g., Ast-C, proctolin and certain large protein
hormones) do not display that modification. Given these
considerations, how well were these predictions met? At first
glance, the results were seemingly mixed, however closer
inspection reveals that fundamentally the predictions hold true.
On the one hand, DIMM is widely expressed by numerous cells
expressing diverse, amidated (amidatable) peptides and this result
conforms to the prediction. Counter to the hypothesis however, we
found that DIMM is also reproducibly expressed by several classic
neurosecretory, peptidergic neurons that express large, non-
amidated peptide hormones–the fourteen dILP-neurons, the two
Eclosion Hormone neurons [78] and in the several bursicon
neurons [79]. In addition, DIMM is found in certain neurons that
express Ast-C and proctolin. These counter-examples suggest the
initial hypothesis of equating DIMM with exclusive expression of
amidated peptides cannot be supported in its simplest terms.
However, we note that DIMM is found in Ast-C neurons that
are only weakly-stained by Ast-C antibodies, not in ones stained
more strongly–hence in this case, there is no correlation of DIMM
with ‘‘strong’’ expression of a non-amidated peptide, in contrast to
the situation for numerous amidated peptides (Figures 4, 9 and
10). Furthermore, pancreatic b-cells of mammals express insulin,
but also co-express the amidated peptide amylin [80]. Therefore,
DIMM expression in insect dILP2-, EH-, Bursicon-, in some Ast
C- and some proctolin-expressing neurons may be explained by
invoking a second class of Neurosecretory neurons in Drosophila
(Figure 11, middle left.): these produce peptides that be amidated
along with non-amidated peptides or protein hormones. In fact
this appears true for at least some examples here mentioned:
bursicon-containing neurons co-express a peptide that can be
Figure 10. The quantitative representation of DIMM co-
expression among sets of cells expressing any of 22 different
peptide markers in the 100 hr AEL larval CNS. 16 of 22 peptide
markers display DIMM co-expression in more than 40% of the peptide-
expressing cells (horizontal bar). The degree of overlap is categorized as
‘‘
Complete’’, ‘‘Partial’’, or ‘‘None’’, as described in the text.
doi:10.1371/journal.pone.0001896.g010
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 12 March 2008 | Volume 3 | Issue 3 | e1896

amidated-CCAP [79]. The DIMM-positive proctolin neurons are
called Ap-lets [35] and they express the precursor NPLP1 which
also encodes peptides that can be amidated [52]. Likewise, we here
show that dILP neurons co-express a genetic marker for DSK,
which encodes peptides that can be amidated. On this basis, and
in support of our initial hypothesis concerning DIMM’s role, we
predict the EH-secreting neurons normally co-express an ami-
dated peptide. To invoke such an amidated peptide is not
unreasonable, as currently we lack markers for several known
Drosophila amidated peptides, such as for example, the Drosophila
immune-inducible peptides 2 and 4 [18].
We found one classic peptidergic Neurosecretory system in
Drosophila that does not express DIMM–the PTTH-expressing
neurons of the brain. These resemble DIMM Neurosecretory
Neurons in that they have large cells bodies, extensive axonal
projections, and display high levels of steady-state peptide
accumulation and episodic release. These cells may be DIMM-
negative because they only express DIMM transiently, during a
developmental stage that we did not survey. However, we favor
the explanation that these neurons possess an alternative but
regulatory system: comparable, but distinct from that controlled by
DIMM. We note that PTTH is a large glycoprotein hormone that
is not amidated and that (at present) we have no evidence for any
expression of peptides that can be amidated in these cells.
Therefore we predict Drosophila contains a third class of
Neurosecretory Neuron (Figure 11, lower left)–a DIMM-
negative one that only produces non-amidated secretory products.
Finally, for the class of Neurosecretory Neurons that co-express
amidated and non-amidated peptides (Figure 11, middle left), we
wonder whether DIMM controls the secretory pathway for one or
both sets of secretory products. It is interesting to consider for these
cases, that amidated and non-amidated secretory peptide
pathways within single neurons may be controlled by distinct
regulatory cascades. To evaluate this possibility, it will be useful to
determine whether manipulation of DIMM levels leads to changes
in steady-state levels of the non-amidated secretory peptides and
peptide hormones, namely, EH, bursicon, proctolin, Ast C and the
dILPs.
Materials and Methods
Fly stocks
We used Canton S for a wild type stock; GAL4 transgenic lines
as described in Table 3 were crossed to either of two UAS-
reporter stocks (2X EGPF or -lacZ). Flies were reared and
maintained on a standard cornmeal-agar medium at room
Figure 11. Classification of peptidergic neurons in
Drosophila
according to several physical and biochemical attributes based on the
observations reported in this manuscript. We propose that DIMM neurons are peptidergic Neurosecretory Neurons whose distinctive
properties are enumerated by the acronym LEAP. They are distinguished by their
Large size (long axon morphology and extensive arborizations),
periods of
Episodic release high levels of secretory activity and by specific modifications of secretory products (Amidation of Peptides). The top row
compares two peptidergic neuronal classes in the Drosophila CNS, using the example of neuropeptide PDF expression. The DIMM-positive
Neurosecretory Neuron produces high levels of amidated PDF. The DIMM-negative Interneuron produces more modest levels of amidated PDF, or
more likely of Gly-extended (non-amidated) PDF. DIMM neurons express peptides that can be amidated. They may also express peptides or protein
hormones that are not amidated, as illustrated for the example of Neurosecretory Neurons that express both CCAP (potentially amidated) and
Bursicon (a non-amidated, glycoprotein hormone). Neurosecretory Neurons that lack DIMM express only non-amidated secretory products (bottom
left). Motorneurons that co-release glutamate (Glu) with the non-amidated peptide Proctolin (bottom right) also lack DIMM. See text for further
details.
doi:10.1371/journal.pone.0001896.g011
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 13 March 2008 | Volume 3 | Issue 3 | e1896

temperature (22-23
o
C). DSK-GAL4 stocks were generated as
follows: a 706-bp DSK upstream sequence was PCR-amplified
from wild-type genomic DNA template, the 39 end of which is two
base pairs upstream of the translation start site. PCR primers were
GCTCTAGA-TGGGTATCGTGTTAATATCAG (forward
primer with Xba I site) and GCGGTACC-ACAGCGTGGC-
GAAGTGCGTA (reverse primer with Kpn I site). PCR product
was digested with Xba I and Kpn I, the insert was cloned into
P{pPTGAL} vector, and resulting construct employed for germ-
line transformation. DMS-gal4 enhancer flies were produced by
amplifying the putative DMS promoter using the following
primers: GCGAGATCTCGGTGCTTCCACAAAGAAGT and
GCGGAATTCCGCAAAGTGGCGAAAATAAT. The PCR
product was cloned into the P{pAKH-GAL4} vector [61] digested
with Eco R1 and Bam H1. Transgenic flies were produced by
TheBestGene Inc. (www.thebestgene.com).
Antibodies, Immunostaining and Imaging
Immunostaining methods were as previously described by
Hewes et al. [33]. The CNS of the 90–100 hr (feeding IIIrd
instar) AEL larvae were dissected in the standard saline that lacked
calcium and fixed with 4% paraformaldehyde / 7% picric acid (v/
v) in 1X PBS. Embryos were harvested from egg collection plates,
dechorionated with 50% chlorine and fixed with 37% formalde-
hyde for 3 min in 50% heptane, then washed with 100%
methanol. The primary antibodies used as peptide markers in
this study are listed in Table 2. Anti-b-galatosidase antibody
(Promega, WI, 1:1000), MAb anti-neurotactin (BP106; Develop-
mental Hybridoma Bank, Iowa City, 1:100), MAb 4D9 anti-inv
(gift from J. Skeath; 1:10), rabbit anti-EVE (gift from J. Skeath;
1:500), were also used. Antisera were raised to Drosophila DH 31, a
kind gift from Julian Dow and to Drosophila Ast-B AWQSLQSS-
Wamide (Research Genetics, Huntsville, AL). In both cases the
peptides were coupled to porcine thyroglobulin using difluorodi-
nitrobenzene as described by Tager [81], in a ratio of 2 mg
peptide to 5 mg carrier protein. Unreacted peptide was removed
by dialysis and the conjugate injected in five to six sites on the back
of a female New Zealand white rabbit. Booster injections were
given at six week intervals. Blood was collected before the first
injection and ten days after each booster injection; serum was
collected and stored frozen. Cy3-conjugated, Alexa-568, Alexa-
633 or Alex-488-conjugated, secondary antibodies were used at
1:500 dilutions. Images were acquired on an Olympus FV500
laser scanning confocal microscope and manipulated by Adobe
Photoshop software to adjust contrast. For the positional analysis
of larval brain DIMM cells, the images acquired from the confocal
microscope were imported into and analyzed with Amira software,
as described at Pereanu and Hartenstein[48].
Supporting Information
Figure S1 Double antibody staining for c929-GAL4 activity
(green) and DIMM immunoreactivity (magenta) in a single
confocal image of the 100 hr AEL larval CNS. The single channel
for DIMM antibody staining is shown on the right. Strongly-
stained cells for each marker were highly correlated (arrows);
hands illustrate weakly-stained cells. Only the strongly-stained cells
were scored in this report.
Found at: doi:10.1371/journal.pone.0001896.s001 (3.62 MB TIF)
Figure S2 Neuropeptide identities of DIMM neuroendo-
crine cells in the periphery. The sixteen cells of the corpora
cardiaca (CC) that express the peptide hormone AKH are all
DIMM-positive. The 14 Inka cells associated with the largest
tracheal trunks and that express the peptide hormone ETH are
all DIMM-positive. Seven neurons in the oesophageal ganglion of
the SNS that express unidentified -RFa-positive neurons are
DIMM-positive. No specific peptide marker has yet been
associated with the 14 DIMM-positive LBD neurons that are
situated along the segmentally-repeated Transverse Nerve. In
other insects, a similar neuron is peptidergic (Wall and Taghert,
1990). The pie chart indicates the percentage of all DIMM-
positive peripheral cells that have been associated with a specific
peptide. All DIMM-expressing peripheral cells are PHM-positive
(not shown).
Found at: doi:10.1371/journal.pone.0001896.s002 (0.33 MB TIF)
Table S1 Quantification of overlap between DIMM immuno-
stained cells and 24 different peptide ‘‘markers’’ (antibodies or
GAL4 lines) in the 100 hr AEL larval CNS.
Found at: doi:10.1371/journal.pone.0001896.s003 (0.03 MB
DOC)
Acknowledgments
We wish to thank all of our colleagues (listed in Tables 2 and 3) who
generously provided the reagents and fly lines that were instrumental in
producing the data in this paper. We are very grateful to Volker
Hartenstein for advice and consultation on the assignment of positional
values of brain neurons. We thank Jim Skeath and Chris Doe for advice
regarding definition of segment boundaries, and Jay Hirsh and Ben White
for discussions concerning Ddc expression patterns. We thank Michelle
Itano for participation in earlier experiments and Weihua Li for help
raising flies. Members of our lab provided helpful comments and criticisms.
Author Contributions
Conceived and designed the experiments: PT DP. Performed the
experiments: DP. Analyzed the data: PT JV DP. Contributed reagents/
materials/analysis tools: JV DP JP. Wrote the paper: PT DP.
References
1. Bargmann W, Scharrer E (1951) The site of origin of the hormone of the
posterior pituitary. American Scientists. 255 p.
2. Burbach JP, Luckman SM, Murphy D, Gainer H (2001) Gene regulation in the
magnocellular hypothalamo-neurohypophysial system. Physiol Rev 81:
1197–1267.
3. Nassel DR, Homberg U (2006) Neuropeptides in interneurons of the insect
brain. Cell Tissue Res 326: 1–24.
4. Villar MJ, Huchet M, Hokfelt T, Changeux JP, Fahrenkrug J, et al. (1988)
Existence and coexistence of calcitonin gene-related peptide, vasoactive intestinal
polypeptide- and somatostatin-like immunoreactivities in spinal cord motoneu-
rons of developing embryos and post-hatch chicks. Neurosci Lett 86: 114–118.
5. Blitz DM, Nusbaum MP (1999) Distinct functions for cotransmitters mediating
motor pattern selection. J Neurosci 19: 6774–6783.
6. Baker JD, Truman JW (2002) Mutations in the Drosophila glycoprotein hormone
receptor, rickets, eliminate neuropeptide-induced tanning and selectively block a
stereotyped behavioral program. J Exp Biol 205: 2555–2565.
7. Clark AC, del Campo ML, Ewer J (2004) Neuroendocrine control of larval
ecdysis behavior in Drosophila: complex regulation by partially redundant
neuropeptides. J Neurosci 24: 4283–4292.
8. Dierick HA, Greenspan RJ (2007) Serotonin and neuropeptide F have opposite
modulatory effects on fly aggression. Nat Genet 39: 678–682.
9. Jiang N, Kolhekar AS, Jacobs PS, Mains RE, Eipper BA, et al. (2000) PHM is
required for normal developmental transitions and for biosynthesis of secretory
peptides in Drosophila. Dev Biol 226: 118–136.
10. Kim YJ, Zitnan D, Galizia CG, Cho KH, Adams ME (2006) A command
chemical triggers an innate behavior by sequential activation of multiple
peptidergic ensembles. Curr Biol 16: 1395–1407.
11. Luan H, Lemon WC, Peabody NC, Pohl JB, Zelensky PK, et al. (2006)
Functional dissection of a neuronal network required for cuticle tanning and
wing expansion in Drosophila. J Neurosci 26: 573–584.
12. Nitabach MN, Wu Y, Sheeba V, Lemon WC, Strumbos J, et al. (2006)
Electrical hyperexcitation of lateral ventral pacemaker neurons desynchronizes
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 14 March 2008 | Volume 3 | Issue 3 | e1896

downstream circadian oscillators in the fly circadian circuit and induces
multiple behavioral periods. J Neurosci 26: 479–489.
13. Renn SC, Park JH, Rosbash M, Hall JC, Taghert PH (1999) A pdf
neuropeptide gene mutation and ablation of PDF neurons each cause severe
abnormalities of behavioral circadian rhythms in Drosophila. Cell 99: 791–
802.
14. Hewes RS, Taghert PH (2001) Neuropeptides and neuropeptide receptors in
the Drosophila melanogaster genome. Genome Res 11: 1126–1142.
15. Nassel DR (2002) Neuropeptides in the nervous system of Drosophila and other
insects: multiple roles as neuromodulators and neurohormones. Prog Neurobiol
68: 1–84.
16. Taghert PH, Veenstra JA (2003) Drosophila neuropeptide signaling. Adv Genet
49: 1–65.
17. Vanden Broeck J (2001) Neuropeptides and their precursors in the fruitfly,
Drosophila melanogaster. Peptides 22: 241–254.
18. Baggerman G, Boonen K, Verleyen P, De Loof A, Schoofs L (2005)
Peptidomic analysis of the larval Drosophila melanogaster central nervous system
by two-dimensional capillary liquid chromatography quadrupole time-of-flight
mass spectrometry. J Mass Spectrom 40: 250–260.
19. Baggerman G, Cerstiaens A, De Loof A, Schoofs L (2002) Peptidomics of the
larval Drosophil a melanogaster central nervous system. J Biol Chem 277:
40368–40374.
20. Liu F, Baggerman G, D’Hertog W, Verleyen P, Schoofs L, et al. (2006) In silico
identification of new secretory peptide genes in Drosophila melanogaster. Mol
Cell Proteomics 5: 510–522.
21. Neupert S, Johard HA, Nassel DR, Predel R (2007) Single-cell peptidomics of
drosophila melanogaster neurons identified by Gal4-driven fluorescence. Anal
Chem 79: 3690–3694.
22. Wegener C, Reinl T, Jansch L, Predel R (2006) Direct mass spectrometric
peptide profiling and fragmentation of larval peptide hormone release sites in
Drosophila melanogaster reveals tagma-specific peptide expression and differential
processing. J Neurochem 96: 1362–1374.
23. Santos JG, Vomel M, Struck R, Homberg U, Nassel DR, et al. (2007)
Neuroarchitecture of peptidergic systems in the larval ventral ganglion of
Drosophila melanogaster. PLoS ONE 2: e695.
24. Ding YQ, Marklund U, Yuan W, Yin J, Wegman L, et al. (2003) Lmx1b is
essential for the development of serotonergic neurons. Nat Neurosci 6:
933–938.
25. Cheng L, Arata A, Mizuguchi R, Qian Y, Karunaratne A, et al. (2004) Tlx3
and Tlx1 are post-mitotic selector genes determining glutamatergic over
GABAergic cell fates. Nat Neurosci 7: 510–517.
26. Acampora D, Postiglione MP, Avantaggiato V, Di Bonito M, Vaccarino FM, et
al. (1999) Progressive impairment of developing neuroendocrine cell lineages in
the hypothalamus of mice lacking the Orthopedia gene. Genes Dev 13:
2787–2800.
27. Wang W, Lufkin T (2000) The murine Otp homeobox gene plays an essential
role in the speci fication of neuronal cell lineages in the developing
hypothalamus. Dev Biol 227: 432–449.
28. Schonemann MD, Ryan AK, McEvilly RJ, O’Connell SM, Arias CA, et al.
(1995) Development and survival of the endocrine hypothalamus and posterior
pituitary gland requires the neuronal POU domain factor Brn-2. Genes Dev 9:
3122–3135.
29. Nakai S, Kawano H, Yudate T, Nishi M, Kuno J, et al. (1995) The POU
domain transcription factor Brn-2 is required for the determination of specific
neuronal lineages in the hypothalamus of the mouse. Genes Dev 9: 3109–3121.
30. Michaud JL, Rosenquist T, May NR, Fan CM (1998) Development of
neuroendocrine lineages requires the bHLH-PAS transcription factor SIM1.
Genes Dev 12: 3264–3275.
31. Goshu E, Jin H, Lovejoy J, Marion JF, Michaud JL, et al. (2004) Sim2
contributes to neuroendocrine hormone gene expression in the anterior
hypothalamus. Mol Endocrinol 18: 1251–1262.
32. Hosoya T, Oda Y, Takahashi S, Morita M, Kawauchi S, et al. (2001) Defect ive
development of secretory neurones in the hypothalamus of Arnt2-knockout
mice. Genes Cells 6: 361–374.
33. Hewes RS, Park D, Gauthier SA, Schaefer AM, Taghert PH (2003) The
bHLH protein Dimmed controls neuroendocrine cell differentiation in
Drosophila. Development 130: 1771–1781.
34. Allan DW, Park D, St Pierre SE, Taghert PH, Thor S (2005) Regulators acting
in combinatorial codes also act independently in single differentiating neurons.
Neuron 45: 689–700.
35. Park D, Han M, Kim YC, Han KA, Taghert PH (2004) Ap-let neurons–a
peptidergic circuit potentially controlling ecdysial behavior in Drosophila.Dev
Biol 269: 95–108.
36. Lemercier C, To RQ , Carrasco RA, Konieczny SF (1998) The basic helix-
loop-helix transcription factor Mist1 functions as a transcriptional repressor of
myoD. Embo J 17: 1412–1422.
37. Pin CL, Bonvissuto AC, Konieczny SF (2000) Mist1 expression is a common
link among serous exocrine cells exhibiting regulated exocytosis. Anat Rec 259:
157–167.
38. Pin CL, Rukstalis JM, Johnson C, Konieczny SF (2001) The bHLH
transcription factor Mist1 is required to maintain exocrine pancreas cell
organization and acinar cell identity. J Cell Biol 155: 519–530.
39. Ramsey VG, Doherty JM, Chen CC, Stappenbeck TS, Konieczny SF, et al.
(2007) The maturation of mucus-secreting gastric epithelial progenitors into
digestive-enzyme secreting zymogenic cells requires Mist1. Development 134:
211–222.
40. Park D, Shafer OT, Shepherd SP, Suh H, Trigg JS, et al. (2008) The Drosophila
basic helix-loop-helix protein DIMMED directly activates PHM, a gene
encoding a neuropeptide-amidating enzyme. Mol Cell Biol 28: 410–421.
41. Kolhekar AS, Roberts MS, Jiang N, Johnson RC, Mains RE, et al. (1997)
Neuropeptide amidation in Drosophila: separate genes encode the two enzymes
catalyzing amidation. J Neurosci 17: 1363–1376.
42. Hewes RS, Gu T, Brewster JA, Qu C, Zhao T (2006) Regulation of secretory
protein expres sion in mature cells by DIMM, a basic helix-loop-helix
neuroendocrine differentiation factor. J Neurosci 26: 7860–7869.
43. Gauthier SA, Hewes RS (2006) Transcriptional regulation of neuropeptide and
peptide hormone expression by the Drosophila dimmed and cryptocephal genes.
J Exp Biol 209: 1803–1815.
44. Miguel-Aliaga I, Allan DW, Thor S (2004) Independent roles of the dachshund
and eyes absent genes in BMP signaling, axon pathfinding and neuronal
specification. Development 131: 5837–5848.
45. Gorczyca MG, Phillis RW, Budnik V (1994) The role of tinman, a mesodermal
cell fate gene, in axon pathfinding during the development of the transverse
nerve in Drosophila. Development 120: 2143–2152.
46. Broadus J, Skeath JB, Spana EP, Bossing T, Technau G, et al. (1995) New
neuroblast markers and the origin of the aCC/pCC neurons in the Drosophila
central nervous system. Mech Dev 53: 393–402.
47. Cui X, Doe CQ (1992) ming is expressed in neuroblast sublineages and regulates
gene expression in the Drosophila central nervous system. Development 116:
943–952.
48. Pereanu W, Hartenstein V (2006) Neural lineages of the Drosophila brain: a
three-dimensional digital atlas of the pattern of lineage location and projection
at the late larval stage. J Neurosci 26: 5534–5553.
49. Bader R, Colomb J, Pankratz B, Schrock A, Stocker RF, et al. (2007) Genetic
dissection of neural circuit anatomy underlying feeding behavior in Drosophila:
distinct classes of hugin-expressing neurons. J Comp Neurol 502: 848–856.
50. Nitabach MN, Taghert PH (2008) Organization of the Drosophila circadian
control circuit. Curr Biol 18: R84–93.
51. Furuya K, Milchak RJ, Schegg KM, Zhang J, Tobe SS, et al. (2000) Cockroach
diuretic hormones: characterization of a calcitonin-like peptide in insects. Proc
Natl Acad Sci U S A 97: 6469–6474.
52. Baumgardt M, Miguel-Aliaga I, Karlsson D, Ekman H, Thor S (2007)
Specification of neuronal identities by feedforward combinatorial coding. PLoS
Biol 5: e37.
53. Sudhof TC (2008) Neurotransmitter release. pp 1–21.
54. Scholnick SB, Bray SJ, Morgan BA, McC ormick CA, Hirsh J (1986) CNS and
hypoderm regulatory elements of the Drosophila melanogaster dopa decarboxylase
gene. Science 234: 998–1002.
55. Urbach R, Technau GM (2003) Molecular markers for identified neuroblasts in
the developing brain of Drosophila. Development 130: 3621–3637.
56. Lundell MJ, Hirsh J (1998) eagle is required for the specification of serotonin
neurons and other neuroblast 7-3 progeny in the Drosophila CNS. Development
125: 463–472.
57. Karcavich R, Doe CQ (2005) Drosophila neuroblast 7-3 cell lineage: a model
system for studying programmed cell death, Notch/Numb signaling, and
sequential specification of ganglion mother cell identity. J Comp Neurol 481:
240–251.
58. Hartenstein V (2006) The neuroendocrine system of invertebrates: a
developmental and evolutionary perspective. J Endocrinol 190: 555–570.
59. de Velasco B, Erclik T, Shy D, Sclafani J, Lipshitz H, et al. (2007) Specification
and development of the pars intercerebralis and pars lateralis, neuroendocrine
command centers in the Drosophila brain. Dev Biol 302: 309–323.
60. Siegmund T, Korge G (2001) Innervation of the ring gland of Drosophila
melanogaster. J Comp Neurol 431: 481–491.
61. Isabel G, Martin JR, Chidami S, Veenstra JA, Rosay P (2004) Ablation of
AKH-producing neuroendocrine cells decreases trehalose levels and induces
behavioral changes in Drosophila. Am J Physiol Regul Integr Comp Physiol.
62. Kim SK, Rulifson EJ (2004) Conserved mechanisms of glucose sensing and
regulation by Drosophila corpora cardiaca cells. Nature 431: 316–320.
63. Lee G, Park JH (2004) Hemolymph sugar homeostasis and starvation-induced
hyperactivity affected by genetic manipulations of the adipokinetic hormone-
encoding gene in Drosophila melanogaster. Genetics 167: 311–323.
64. O’Brien MA, Taghert PH (1998) A peritracheal neuropeptide system in insects:
release of myomodulin-like peptides at ecdysis. J Exp Biol 201 ( Pt 2): 193–209.
65. Zitnan D, Kingan TG, Hermesman JL, Adams ME (1996) Identification o f
ecdysis-triggering hormone from an epitracheal endocrine system. Science 271:
88–91.
66. Siga S (2003) Anatomy and functions of brain neurosecretory cells in diptera.
Microsc Res Tech 62: 114–131.
67. Melcher C, Pankratz MJ (2005) Candidate gustatory interneurons modulating
feeding behavior in the Drosophila brain. PLoS Biol 3: e305.
68. Lundquist T, Nassel DR (1 990) Substance P-, FMRFamide-, and gastrin/
cholecystokinin-like immunoreactive neurons in the thoraco-abdominal ganglia
of the flies Drosophila and Calliphora. J Comp Neurol 294: 161–178.
69. Kaneko M, Helfrich-Forster C, Hall JC (1997) Spatial and temporal expression
of the period and timeless genes in the developing nervous system of Drosophila:
newly identified pacemaker candidates and novel features of clock gene product
cycling. J Neurosci 17: 6745–6760.
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 15 March 2008 | Volume 3 | Issue 3 | e1896

70. Taghert PH, Hewes RS, Park JH, O’Brien MA, Han M, et al. (2001) Multiple
amidated neuropeptides are required for normal circadian locomotor rhythms
in Drosophila. J Neurosci 21: 6673–6686.
71. Arch S, Berry RW (1989) Molecular and cellular regulation of neuropeptide
expression: the bag cell model system. Brain Res Brain Res Rev 14: 181–201.
72. Burbach JP, Van Tol HH, Bakkus MH, Schma le H, Ivell R (1 986)
Quantitation of vasopressin mRNA and oxytocin mRNA in hypothalamic
nuclei by solution hybridization assays. J Neurochem 47: 1814–1821.
73. Park Y, Zitnan D, Gill SS, Adams ME (1999) Molecular cloning and biological
activity of ecdysis-triggering hormones in Drosophila melanogaster. FEBS Lett 463:
133–138.
74. Candy DJ (2002) Adipokinetic hormones concentrations in the haemolymph of
Schistocerca gregaria, measured by radioimmunoassay. Insect Biochem Mol Biol
32: 1361–1367.
75. Rorsman P, Renstrom E (2003) Insulin granule dynamics in pancreatic beta
cells. Diabetologia 46: 1029–1045.
76. Kim YJ, Zi tnan D, Cho KH, Schooley DA, Mizoguchi A, et al. (2006) Central
peptidergic ensembles associated with organization of an innate behavior. Proc
Natl Acad Sci U S A 103: 14211–14216.
77. Eipper BA, Stoffers DA, Mains RE (1992) The biosynthesis of neuropeptides:
peptide alpha-amidation. Annu Rev Neurosci 15: 57–85.
78. Hewes RS, Truman JW (1994) Steroid regulation of excitability in identified
insect neurosecretory cells. J Neurosci 14: 1812–1819.
79. Dewey EM, McNabb SL, Ewer J, Kuo GR, Takanishi CL, et al. (2004)
Identification of the gene encoding bursicon, an insect neuropeptide
responsible for cuticle sclerotization and wing spreading. Curr Biol 14:
1208–1213.
80. Boonen K, Baggerman G, D’Hertog W, Husson SJ, Overbergh L, et al. (2007)
Neuropeptides of the islets of Langerhans: a peptidomics study. Gen Comp
Endocrinol 152: 231–241.
81. Tager HS (1976) Coupling of peptides to albumin with difluorodinitrobenzene.
Anal Biochem 71: 367–375.
82. Chen Y, Veenstra JA, Hagedorn H, Davis NT (1994) Leucokinin and diuretic
hormone immunoreactivity of neurons in the tobacco hornwo rm, Manduca
sexta, and co-localization of this immunoreactivity in lateral neurosecretory cells
of abdominal ganglia. Cell Tissue Res 278: 493–507.
83. Taghert PH, Schneider LE (1990) Interspecific comparison of a Drosophila gene
encoding FMRFamide-related neuropeptides. J Neurosci 10: 1929–1942.
84. Chin AC, Reynolds ER, Scheller RH (1990) Organization and expression of
the Drosophila FMRFamide-related prohormone gene. DNA Cell Biol 9:
263–271.
85. Copenhaver PF, Truman JW (1986) Identification of the cerebral neurosecre-
tory cells that contain eclosion hormone in the moth Manduca sexta. J Neurosci
6: 1738–1747.
86. Zitnan D, Sehnal F, Bryant PJ (1993) Neurons producing specific neuropep-
tides in the central nervou s system of normal and pupariation-delayed
Drosophila. Dev Biol 156: 117–135.
87. Stay B, Chan KK, Woodhead AP (1992) Allatostatin-immunoreactive neurons
projecting to the corpora allata of adult Diploptera punctata. Cell Tissue Res 270:
15–23.
88. Ewer J, Truman JW (1996) Increases in cyclic 39,59-guanosine monophosphat e
(cGMP) occur at ecdysis in an evolutionarily conserved crustacean cardioactive
peptide-immunoreact ive insect neuronal network. J Comp Neurol 370:
330–341.
89. Taylor CA, Winther AM, Siviter RJ, Shirras AD, Isaac RE, et al. (2004)
Identification of a proctolin preprohormone gene (Proct)ofDrosophila melano-
gaster: expression and predicted prohormone processing. J Neurobiol 58:
379–391.
90. Schoofs L, Holman GM, Paemen L, Veelaert D, Amelinckx M, et al. (1993)
Isolation, identification, and synthesis of PDVDHFLRFamide (SchistoFLRFa-
mide) in Locusta migratoria and its association with the male accessory glands, the
salivary glands, the heart, and the oviduct. Peptides 14: 409–421.
91. Rulifson EJ, Kim SK, Nusse R (2002) Ablation of insulin-producing neurons in
flies: growth and diabetic phenotypes. Science 296: 1118–1120.
92. Roller L, Tanaka Y, Tanaka S (2003) Corazonin and corazon in-like substances
in the central nervous system of the Pterygote and Apterygote insects. Cell
Tissue Res 312: 393–406.
93. Lee KS, You KH, Choo JK, Han YM, Yu K (2004) Drosophila short
neuropeptide F regulates food intake and body size. J Biol Chem. 279:
50781–50789.
94. Wu Q, Wen T, Lee G, Park JH, Cai HN, et al. (2003) Developmental control
of foraging and social behavior by the Drosophila neuropeptide Y-like system.
Neuron 39: 147–161.
95. Nassel DR, Shiga S, Wikstrand EM, Rao KR (1991) Pigment-dispersing
hormone-immunoreactive neurons and their relation to serotonergic neurons
in the blowfly and cockroach visual system. Cell Tissue Res 266: 511–523.
96. Cabrero P, Radford JC, Broderick KE, Costes L, Veenstra JA, et al. (2002) The
Dh gene of Drosophila melanogaster encodes a diuretic peptide that acts through
cyclic AMP. J Exp Biol 205: 3799–3807.
97. Terhzaz S, Rosay P, Goodwin SF, Veenstra JA (2007) The neuropeptide
SIFamide modulates sexual behavior in Drosophila. Biochem Biophys Res
Commun 352: 305–310.
98. Verleyen P, Baggerman G, Wiehart U, Schoeters E, Van Lommel A, et al.
(2004) Expression of a novel neuropeptide, NVGTLARDFQLPIPNamide,
in the larval and adult brain of Drosophila melanogaster. J Neurochem 88:
311–319.
99. Kean L, Cazenave W, Costes L, Broderick KE, Graham S, et al. (2002) Two
nitridergic pep tides are encoded by the gene capability in Drosophila melanogaster.
Am J Physiol Regul Integr Comp Physiol 282: R1297–1307.
100. Macins A, Meredith J, Zhao Y, Brock HW, Phillips JE (1999) Occurrence of
ion transport peptide (ITP) and ion transport-like peptide (ITP-L) in
orthopteroids. Arch Insect Biochem Physiol 40: 107–118.
101. Park JH, Schroeder AJ, Helfrich-Forster C, Jackson FR, Ewer J (2003)
Targeted ablation of CCAP neuropeptide-containing neurons of Drosophila
causes specific defects in execution and circadian timing of ecdysis behavior.
Development 130: 2645–2656.
102. Choi YJ, Lee G, Hall JC, Park JH (2005) Comparative analysis of Corazonin-
encoding genes (Crz’s) in Drosophila species and functional insights into Crz-
expressing neurons. J Comp Neurol 482: 372–385.
Mapping Drosophila DIMM Cells
PLoS ONE | www.plosone.org 16 March 2008 | Volume 3 | Issue 3 | e1896