Late B Cell Depletion with a Human Anti-Human CD20 IgG1 Monoclonal Antibody Halts the Development of Experimental Autoimmune Encephalomyelitis in Marmosets

Abstract

Depletion of CD20(+) B cells has been related to reduced clinical activity in relapsing-remitting multiple sclerosis. The underlying mechanism is not understood, because serum IgG levels were unaltered by the treatment. We report the effect of late B cell depletion on cellular and humoral immune mechanisms in a preclinical multiple sclerosis model (i.e., experimental autoimmune encephalomyelitis [EAE] in the common marmoset). We used a novel human anti-human CD20 IgG1κ mAb (HuMab 7D8) that cross-reacts with marmoset CD20. EAE was induced in 14 marmosets by immunization with recombinant human myelin oligodendrocyte glycoprotein (MOG) in CFA. After 21 d, B cells were depleted in seven monkeys by HuMab 7D8, and seven control monkeys received PBS. The Ab induced profound and long-lasting B cell depletion from PBMCs and lymphoid organs throughout the observation period of 106 d. Whereas all of the control monkeys developed clinically evident EAE, overt neurologic deficits were reduced substantially in three HuMab 7D8-treated monkeys, and four HuMab 7D8-treated monkeys remained completely asymptomatic. The effect of HuMab 7D8 was confirmed on magnetic resonance images, detecting only small lesions in HuMab 7D8-treated monkeys. The infusion of HuMab 7D8 arrested the progressive increase of anti-MOG IgG Abs. Although CD3(+) T cell numbers in lymphoid organs were increased, their proliferation and cytokine production were impaired significantly. Most notable were the substantially reduced mRNA levels of IL-7 and proinflammatory cytokines (IL-6, IL-17A, IFN-γ, and TNF-α). In conclusion, B cell depletion prevents the development of clinical and pathological signs of EAE, which is associated with impaired activation of MOG-reactive T cells in lymphoid organs.

Full text

The Journal of Immunology
Late B Cell Depletion with a Human Anti-Human CD20
IgG1kMonoclonal Antibody Halts the Development of
Experimental Autoimmune Encephalomyelitis in Marmosets
Yolanda S. Kap,*
,†,‡
Nikki van Driel,* Erwin Blezer,
x
Paul W. H. I. Parren,
{
Wim K. Bleeker,
{
Jon D. Laman,
†,‡
Jenny L. Craigen,
‖
and Bert A. ’t Hart*
,†,‡
Depletion of CD20
+
B cells has been related to reduced clinical activity in relapsing–remitting multiple sclerosis. The underlying
mechanism is not understood, because serum IgG levels were unaltered by the treatment. We report the effect of late B cell
depletion on cellular and humoral immune mechanisms in a preclinical multiple sclerosis model (i.e., experimental autoimmune
encephalomyelitis [EAE] in the common marmoset). We used a novel human anti-human CD20 IgG1kmAb (HuMab 7D8) that
cross-reacts with marmoset CD20. EAE was induced in 14 marmosets by immunization with recombinant human myelin oligo-
dendrocyte glycoprotein (MOG) in CFA. After 21 d, B cells were depleted in seven monkeys by HuMab 7D8, and seven control
monkeys received PBS. The Ab induced profound and long-lasting B cell depletion from PBMCs and lymphoid organs throughout
the observation period of 106 d. Whereas all of the control monkeys developed clinically evident EAE, overt neurologic deficits
were reduced substantially in three HuMab 7D8-treated monkeys, and four HuMab 7D8-treated monkeys remained completely
asymptomatic. The effect of HuMab 7D8 was confirmed on magnetic resonance images, detecting only small lesions in HuMab
7D8-treated monkeys. The infusion of HuMab 7D8 arrested the progressive increase of anti-MOG IgG Abs. Although CD3
+
T cell
numbers in lymphoid organs were increased, their proliferation and cytokine production were impaired significantly. Most
notable were the substantially reduced mRNA levels of IL-7 and proinflammatory cytokines (IL-6, IL-17A, IFN-g, and TNF-
a). In conclusion, B cell depletion prevents the development of clinical and pathological signs of EAE, which is associated with
impaired activation of MOG-reactive T cells in lymphoid organs. The Journal of Immunology, 2010, 185: 3990–4003.
Recent clinical trials in multiple sclerosis (MS) with the
chimeric CD20 mAb rituximab (Rituxan, IDEC-C2B8)
have triggered renewed interest in the pathogenic rele-
vance of B cells. Treatment of relapsing–remitting MS (RRMS)
with rituximab led to sustained peripheral B cell depletion, re-
duced relapse rate, and reduced numbers of brain white matter
lesions (1–3). B cell depletion by rituximab also reduced the le-
sion volume enlargement in primary progressive MS but had only
a modest effect on disease progression (4). Rituximab not only
depletes B cells from peripheral blood but also from cerebrospinal
fluid and cerebral perivascular spaces (5–7).
Traditionally, B cells were thought to contribute to MS mainly
via the production of autoantibodies, which upon binding to myelin
sheaths initiate Ab-dependent cell-mediated cytotoxicity and
complement-dependent cytotoxicity (8). Abs directed against my-
elin proteins, such as myelin oligodendrocyte glycoprotein (MOG),
have been isolated from MS patients (9, 10) and healthy controls
(11). Autoantibodies were found to amplify demyelination in mouse
(12), rat (13), and nonhuman primate (14) experimental autoim-
mune encephalomyelitis (EAE) models. Furthermore, evidence for
Ab and complement-mediated demyelination has been described
in type II MS lesions (15). Recently, B cells were detected in ectopic
lymphoid structures in the meninges of MS brains, although their
putative pathogenic role in these structures is still unknown (16, 17).
The fact that plasma cells do not express CD20 and therefore were
not depleted by anti-CD20 mAb likely explains the lack of a re-
duction in total IgG serum (2, 3). It therefore has been suggested that
the clinical effect of depleting B cells in RRMS may be due to
interference with other B cell functions, such as Ag presentation
and cytokine production, leading to impaired activation of T cells
and macrophages (2, 3). Reduced numbers of T cells have been
reported in the cerebrospinal fluid after B cell depletion, but not in
blood (4, 6). Because access to body fluids or organs other than
blood for immune profiling is limited in MS patients and healthy
controls, we chose to investigate the effect of B cell depletion on
T cell activation in lymphoid organs in a relevant animal model of
MS, EAE in the common marmoset (18, 19).
The recombinant human MOG (rhMOG)-induced EAE model
in the common marmoset is a relevant model for the purpose of this
study, because both autoantibodies and anti-MOG T cells are in-
duced. Autoantibodies contribute significantly to the pathogenic
process in this marmoset EAE model (14, 20). However, full
*Department of Immunobiology, Biomedical Primate Research Centre, Rijswijk;
†
Department of Immunology, Erasmus Medical Centre;
‡
MS Centre ErasMS,
Rotterdam;
x
Image Sciences Institute, University Medical Center Utrecht;
{
Genmab,
Utrecht, The Netherlands; and
‖
Discovery,BioPharm R&D, GlaxoSmithKline, Steven-
age, United Kingdom
Received for publication April 27, 2010. Accepted for publication July 19, 2010.
This work was supported by funding from The Netherlands Organization for Scien-
tific Research and by an unbiased grant from GlaxoSmithKline.
Address correspondence and reprint requests to Dr. Bert A. ‘t Hart, Department Immuno-
biology, Biomedical Primate Research Centre, Lange Kleiweg 161, 2288 GJ Rijswijk,
The Netherlands. E-mail address: hart@bprc.nl
The online version of this article contains supplemental material.
Abbreviations used in this paper: ABL, abelson; ALN, axillary lymph node; A.U.,
arbitrary units; EAE, experimental autoimmune encephalomyelitis; LLN, lumbar
lymph node; MNC, mononuclear cell; MOG, myelin oligodendrocyte glycoprotein;
MR, magnetic resonance; MRI, magnetic resonance imaging; MS, multiple sclerosis;
MTR, magnetization transfer ratio; PK/PD, pharmacokinetics/pharmacodynamics;
psd, postsensitization day; qPCR, quantitative PCR; rhMOG, recombinant human
myelin oligodendrocyte glycoprotein; RP, red pulp; RRMS, relapsing–remitting mul-
tiple sclerosis; TE, echo time; T
2
W, T
2
-weighted; WP, white pulp.
Copyright Ó2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1001393

development of evident neurologic disease does not depend strictly
on the presence of autoantibodies, because T cells specific for the
MOG
34–56
epitope can induce demyelination (21, 22). These highly
pathogenic T cells, which are activated in the rhMOG EAE model,
express CD56, are cytotoxic, and produce IL-17A (21, 22). Cyto-
toxic CD56
+
MOG-specific T cells also are present in MS (23, 24).
In marmosets, these T cells can be activated by a very mild im-
munization protocol that only includes MOG
34–56
emulsified in
IFA, suggesting that anti-MOG T cells are highly pathogenic and
important in the pathogenic process (22).
In recent years, a panel of fully human CD20 Abs was generated
in Ig transgenic mice (25). This panel included ofatumumab and
HuMab 7D8, which both bind to a unique membrane-proximal
CD20 epitope, comprising the small and large extracellular loops.
Ofatumumab and HuMab 7D8 display superior CD20 binding and
complement-dependent cytotoxicity compared with those of rit-
uximab (25–28).
In the current study, we have induced profound B cell depletion
by weekly infusion of the human anti-human CD20 mAb HuMab
7D8 starting 3 wk after the EAE induction by a single immuni-
zation with rhMOG formulated in CFA. The treatment was started
simultaneously in all of the animals well after immunization (i.e., at
week 3) to avoid interference with the induction of the immuno-
pathogenic process but before the onset of overt clinical EAE.
Neurological signs in the used model appear between 4 and 16 wk
after immunization with rhMOG/CFA (21). The earliest responders
display clinical signs already within 4 wk, suggesting that the
autoimmune mechanisms needed for the induction of lesions and
neurologic deficit can be induced within 4 wk after immunization.
We report that this semitherapeutic treatment schedule with
HuMab 7D8, when autoantibody production is already ongoing,
impaired the development of neurologic deficit. The immunolo-
gical correlates of this remarkable therapeutic effect were arrest of
already initiated autoantibody production and impaired activation of
autoreactive T cells in lymphoid organs, read out by reduced pro-
liferation and proinflammatory cytokine production in lymphoid
organs. These data obtained in a valid preclinical model of MS
contribute to a better understanding of the elusive mechanism un-
derlying the clinical effect of B cell depletion in RRMS.
Materials and Methods
Animals
The common marmoset monkeys used in this study were purchased from
two outbred colonies kept at the Biomedical Primate Research Centre
(Rijswijk, The Netherlands) or the German Primate Centre Deutsches
Primatenzentrum (Go
¨ttingen, Germany), respectively. Only animals that
were declared healthy after the veterinarian’s physical, hematological, and
biochemical checkup were included. Monkeys were pair-housed in spa-
cious cages and under intensive veterinary care throughout the study. The
daily diet consisted of commercial food pellets for New World monkeys
(Special Diet Services, Witham, Essex, U.K.), supplemented with rice,
raisins, peanuts, marshmallows, biscuits, fresh fruit, and grasshoppers.
Drinking water was provided ad libitum. According to the Dutch law on
animal experimentation, all of the study protocols and experimental pro-
cedures have been reviewed and approved by the Institute’s Ethics Com-
mittee.
Twelve marmosetswere used to find an effective dose (pharmacokinetics/
pharmacodynamics [PK/PD]), and fourteen marmosets were used for effi-
cacy assessment in the EAE model (Table I). The average body weight
distribution of the monkeys selected for the EAE experiment was the same
for the control (367 630 g) and treatment groups (332 641 g).
rhMOG-induced EAE
EAE was induced with a recombinant protein encompassing the extra-
cellular domain of human MOG residues 1–125 (rhMOG), which was
produced in Escherichia coli and purified as described previously (29). The
inoculum contained 100 mg rhMOG in 300 ml PBS and was emulsified in
300 ml CFA containing Mycobacterium butyricum (Difco Laboratories,
Detroit, MI) by gentle stirring for at least 1 h at 4˚C. The emulsion was
injected at four locations into the dorsal skin under alfaxalone anesthesia
(10 mg/kg; Alfaxan; Vetoquinol, Den Bosch, The Netherlands).
Clinical signs were scored daily by two independent observers using
a previously described semiquantitative scale (30). Briefly, 0 = no clinical
signs; 0.5 = apathy, altered walking pattern without ataxia; 1 = lethargy,
tail paralysis, tremor; 2 = ataxia, optic disease; 2.25 = monoparesis; 2.5 =
paraparesis, sensory loss; and 3 = para- or hemiplegia. Overt neurologic
deficit starts at score 2. For ethical reasons, monkeys were sacrificed once
complete paralysis of limbs (score $3.0) was observed or at the pre-
determined end point of the study (i.e., postsensitization day [psd] 106).
Body weight measurements of conscious monkeys, which are used as a sur-
rogate disease marker, were performed three times per week.
CD20 treatment
HuMab 7D8 is a human IgG1kmAb (25) (Genmab, Utrecht, The Neth-
erlands) directed against human CD20 and cross-reactive with marmoset
CD20 (data not shown).
The PK/PD study comprised 12 marmosets. Four monkeys received
a single i.v dose of 10 mg/kg HuMab 7D8 from a 2.86 mg/ml stock solution.
Four marmosets received a single i.v dose of 20 mg/kg HuMab 7D8 from a
12.18 mg/ml stock solution. Four control animals received 1 ml/kg sterile
PBS.
The EAE study comprised 14 marmosets. Seven monkeys received
a single i.v. dose of 20 mg/kg HuMab 7D8 21 d after immunization. To
maintain plasma levels .5–10 mg/ml HuMab 7D8, 5 mg/kg was admin-
istered i.v. every week for the duration of the study. Seven control animals
received 1 ml/kg sterile PBS.
Blood sampling, cell numbers, and plasma levels
For the initial PK/PD study, 50 ml blood was collected in 450 ml citrated PBS
at 5, 15, 30, 60, 120, and 240 min. After 1, 3, 7, and 34 d, 500 ml blood was
collected in heparinized vacutainers (Greiner, So
¨lingen, Germany) under
alfaxalone anesthesia (10 mg/kg). After centrifugation, plasmas were col-
lected and stored frozen at 220˚C until analysis of test substance levels was
performed.
Every two weeks during the EAE study, 1.5 ml venous blood was collected
into EDTA vacutainers (Greiner) under alfaxalone anesthesia (10 mg/kg). In
alternating weeks, 50 ml blood was collected in 450 ml PBS/EDTA without
sedation. The number of RBCs and WBCs was measured on a Sysmex
XT-2000iV (Sysmex, Norderstedt, Germany).
Plasma levels of HuMab 7D8 were determined by ELISA, in which an
idiotype-specific mouse mAb (Genmab MS3001-009) was used for capture
and a mouse anti-human IgG (Fc-specific) HRP-conjugated mAb (MH16-1;
Central Laboratory Blood Bank, Amsterdam, The Netherlands) was used
for detection. The quantification limit was 1 mg/ml in plasma.
Necropsy
Monkeys selected for necropsy were first deeply sedated by i.m. injection of
alfaxalone (10 mg/kg). A maximum volume of blood was collected into
EDTA or heparanized vacutainers, and subsequently the marmoset was
euthanized by infusion of pentobarbital sodium (Euthesate; Apharmo,
Duiven, The Netherlands).
Spleen and lymph nodes from several anatomical locations were collected
aseptically and cut into four pieces, which were processed for cell culture,
fixed in buffered formalin, snap-frozen in liquid nitrogen, or processed for
RNA extraction with RNAlater (Sigma-Aldrich, St. Louis, MO). Half of the
brain and spinal cord was stored in formalin, and the other half was snap-
frozen in liquid nitrogen. Femur was collected in PBS for isolation of bone
marrow cells.
Magnetic resonance imaging
One cerebral hemisphere collected at necropsy was fixed in 4% buffered
formalin and 2 wk later transferred into buffered saline containing sodium
azide to allow stabilization of magnetic resonance (MR) relaxation time
characteristics (31). High-contrast postmortem MR images were recorded
on a 9.4 T horizontal bore nuclear magnetic resonance spectrometer (Varian,
Palo Alto, CA), equipped with a quadrature coil (RAPID Biomedical,
Rimpar, Germany). Brains were submerged in nonmagnetic oil (Fomblin;
perfluorinated polyether; Solvay Solexis, Weesp, The Netherlands) to pre-
vent unwanted susceptibility artifacts.
On a sagittal scout image, 41 contiguous coronal slices of 0.75 mm were
defined covering the complete brain, with the following characteristics: field
of view = 25 325 mm; matrix = 256 3256; zero-filled = 512 3512;
The Journal of Immunology 3991

Tab le I . Overview of monkeys included in the PK/PD study and the EAE study
PK/PD Study EAE Study
No. Monkey Sex Age
a
Treatment
Concentration
(mg/kg)
Day of
Sacrifice Monkey Sex Age
a
Treatment Concentration (mg/kg)
1 M05051 F 34 Placebo 7 M02052 M 84 Placebo
2 M06050 F 22 Placebo 62 M06061 M 31 Placebo
3 Mi013024 M 40 Placebo 7 M06081
b
M 28 Placebo
4 Mi013212 M 34 Placebo 62 M07021 M 24 Placebo
5 M06028 F 26 HuMab 7D8 10 (one dose) 7 M07029 M 24 Placebo
6 M06067 F 22 HuMab 7D8 10 (one dose) 62 M07048 M 21 Placebo
7 Mi012698 M 49 HuMab 7D8 10 (one dose) 7 M07080 M 20 Placebo
8 Mi013067 M 26 HuMab 7D8 10 (one dose) 62 M04096 M 56 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
9 M06047 F 23 HuMab 7D8 20 (one dose) 7 M05073 M 43 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
10 Mi012964 M 53 HuMab 7D8 20 (one dose) 62 M06055 M 31 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
11 Mi013294 M 34 HuMab 7D8 20 (one dose) 7 M07012 M 26 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
12 Mi013362 F 30 HuMab 7D8 20 (one dose) 62 M07075 M 21 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
M07085 M 20 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
M07095 M 19 HuMab 7D8 Single dose of 20 mg/kg followed
by a weekly dose of 5 mg/kg
a
Age in months at the start of the experiment.
b
M06081 died on psd 33 without EAE.
F, female; M, male.
3992 LATE B CELL DEPLETION PREVENTS MARMOSET EAE

voxel volume = 7.15 310
23
mm
3
, two transitions. The following mag-
netic resonance imaging (MRI) data sets were collected:
T
2
maps were calculated by a monoexponential fitting of six spin
echo images with increasing echo time (TE): repetition time =
2650 ms; TE = 10 + 5 310 ms. The second image of this series
(i.e., TE = 20 ms) was used for region of interest determination.
Magnetization transfer ratio (MTR) maps were calculated from two
T
1
-weighted spin echo images with and without a magnetization
transfer saturation pulse. MTR values represent the percentage de-
crease in MR signal intensity as a result of this pulse: repetition time
= 1675 ms; TE = 23 ms; MT pulse = 8.19 ms Gaussian-shaped pulse,
nominal flip angle 1000, offset 29.4 kHz.
Calculations of T
2
and MTR were done with a homemade software
package developed in MATLAB (version 7.2; Mathworks, Natick, MA).
Regions of interest were defined using the freely available Medical Image
Processing, Analysis and Visualization package (MIPAV, version 4.3.0; Na-
tional Institutes of Health, Bethesda, MD). White matter lesions were defined
as areas with abnormally high signal intensities in the white matter. The total
volume of white matter lesions was determined for the complete hemisphere.
Anti-MOG Ab detection
Ab binding to rhMOG and MOG
54–76
was determined using ELISA as
described (21). Bound IgM Ab was detected using alkaline phosphatase-
conjugated goat anti-monkey IgM (Rockland, Gilbertsville, PA), and bound
IgG Ab was detected using polyclonal alkaline phosphatase-conjugated
rabbit anti-human IgG (Abcam, Cambridge, U.K.). The results of the Ab
assays are expressed relative to a standard curve of pooled necropsy plasma
from three rhMOG/CFA-immunized control marmosets of this study. The
Ab concentration in pooled plasma was defined arbitrarily as 350 when OD
was equal to 1, and ELISA data of 10- and 100-fold diluted test samples
were fitted to a four-parameter hyperbolic function, using homemade soft-
ware ADAMSEL (Dr. E. Remarque, Biomedical Primate Research Centre,
The Netherlands).
Procedures and assays for the quantification of a cellular
immune response
Mononuclear cell isolation. Mononuclear cell (MNC) suspensions from the
PBMCs, spleen, and bone marrow were isolated by density gradient centri-
fugation over lymphocyte separation medium (Axis-Shield, Oslo, Norway).
Cell suspensions from axillary (ALN), inguinal, lumbar (LLN), and cervical
lymph nodes were isolatedby gently pressing the organ through a nylon mesh
and washing with RPMI 1640 medium.
Phenotyping with flow cytometry. To enable visualization of residual CD20-
expressing cells in the circulation or lymphoid organs of monkeys treated
with HuMab 7D8, MNCs weresubjected to an Ab stripping protocol aimedat
the removal of HuMab 7D8. Cells (2 310
6
) were incubated with 5 ml acidic
buffer (50 mM glycine-HCl, 5 mM KCl, and 130 mM NaCl [pH 3]) for 4
min at room temperature and subsequently washed and used for flow
cytometry. The flow cytometry protocol used to phenotype MNCs
involved staining of dead cells using violet viability stain (Invitrogen,
Molecular Probes, Carlsbad, CA) for 25 min at room temperature.
Subsequently, cells were incubated with CD3
AF700
(SP34-2; BD
Biosciences, San Jose, CA), CD20
PE
(H299; Beckman Coulter, Fullerton,
CA), CD40
FITC
(B-B20; Abcam, Cambridge, MA), CD4
APC
(MT310; Zebra
Bioscience, Enschede, The Netherlands), and CD8
biotin
(LT-8; Serotec,
Du
¨sseldorf, Germany) for 30 min at 4˚C. CD8
+
cells were visualized by
incubation with streptavidin-PerCP (BD Biosciences) for 30 min at 4˚C.
Finally, cells were fixed in 1% Cytofix (BD Biosciences). Flow cytometric
analysis was performed on a FACS LSRII using FACSDiva software (BD
Biosciences).
Proliferation. Proliferation of MNCs was assayed as described previously
(32). Briefly, cells were cultured in triplicate at a cell density of 2 310
5
per
well in 96-well U-bottom plates with rhMOG, MOG peptides, OVA, and Con
A. All of the Ags were tested at a concentration of 5 mg/ml. After 48 h of
culture, 50 ml supernatant was harvested for cytokine ELISA, and 0.5 mCi per
well of tritiated thymidine was added to the cells. Incorporation of radiolabel
was determined after 18 h using a Matrix 9600 beta counter (Packard 9600;
Packard Instrument, Meriden, CT).
Phenotyping of proliferating cells. This was performed by CFSE vital dye
dilution assay as described elsewhere (21).
Cytokine detection with ELISA. Due to the limitation of sample volume and
availability of cross-reactive ELISA reagents, we chose to assay for three
cytokines. The production of IL-17A, IFN-g, and IL-12p40/p70 was
measured in culture supernatants with commercial ELISA according to
the manufacturer’s instructions (U-CyTech, Utrecht, The Netherlands).
Cytokine detection with quantitative PCR. RNA was isolated using an
RNeasy Mini Kit (Qiagen, Hilden, Germany), and cDNA was synthesized
using a RevertAidFirst Strand cDNA SynthesisKit (Fermentas, St. Leon-Rot,
Germany) according to the manufacturer’s instructions. Random hexamer
primers were used for cDNA synthesis. Expression levels of mRNA were
determined by quantitative PCR (qPCR) using iTaq Supermix with ROX and
CFX96 Real-Time PCR Detection System (both from Bio-Rad, Hercules,
CA). Primer and probesused are listed in Table II. Probeswere obtained from
the Universal Probe Library set for human (Roche, Indianapolis, IN).
Transcript levels were normalized against the reference gene abelson
(ABL) (33).
Immunohistochemistry
Spleen and lymph nodes obtained at necropsy were snap-frozen in liquid
nitrogen and stored at 280˚C. Frozen spleen and lymph node sections of 6
mm were cut and thaw-mounted on gelatin/chrome alum-coated glass
slides. Slides were kept overnight at room temperature in a humidified
atmosphere. After the slides were air-dried for 1 h, they were fixed in fresh
acetone containing 0.02% (v/v) H
2
O
2
. Acetone-fixed slides were air-dried
for 10 min and subsequently washed in PBS. Tissue sections were incubated
with primary Ab overnight at 4˚C in a humidified atmosphere. Primary Abs
were mouse anti-human CD20 (clone L26; DakoCytomation, Glostrup,
Denmark), mouse anti-human CD40 (clone B-B20; Chemicon Inter-
national, Billerica, MA), and rabbit anti-human CD3 (DakoCytomation).
Incubations with secondary and tertiary reagents were performed for 1 h at
room temperature. Between incubation steps, the slides were washed twice
with PBS. Detection of primary unlabeled Ab was followed by incubation
with donkey anti-mouse or goat anti-rabbit, both labeled with biotin. This
was followed by incubation with HRP-labeled avidin–biotin-complex
(Vectastain ABC; Vector Laboratories, Burlingame, CA). HRP activity
was revealed by incubation for 10 min at room temperature with 3-amino-9-
ethyl-carbozole (Sigma-Aldrich, Zwijndrecht, The Netherlands), leading to
a bright red precipitate. CD40 expression was enhanced with the tyramide
signal amplification kit (Invitrogen, Carlsbad, CA). Incubation with isotype-
matched primary Ab of irrelevant specificity and omission of the primary Ab
served as negative controls.
Statistical analysis
Data are presented as mean 6SEM of six control and seven treated
marmosets. Statistical analysis was performed using Prism 5.0b for Mac
Table II. Primer and probe combinations for qPCR
Gene Forward Primer (59–39) Reverse Primer (59–39) Probe
ABL CAGAGAAGGTCTATGAACTCATGC GGTGGATTTCAGCAAAGGAG GCAGTGGA
CD3 AGGCAAGAGTGTGTGAGAACTG GATGCAGATGTCCACTATGACAA GGAGGTGG
CD19 CAGCCCCGTCTTATAGAAACC CACTGTCCGGCTCCTCATAG AGAAGAGGA
IL-17A CCTCATTGGTGTCACTGCTG TGCAATTCCTGCCTTCACTA GCTGCTGA
IFN-gGGAGAGAGGAGGGTGACAGA TTGGATGCTCTGGTTGTCTTTA CAGAGCCA
TNF-aGGACGAGCTCTCCAAGGACT GTCACTCGGGATTCGAGAAG GGCCCTGG
IL-7 TGCACCAGCAAGGTTAAAGA CCAAACTCTTTGTCGGTTGG TGCCCTGG
IL-4 CTAAAACGGCTGGACAGGAA CCTTCACAGGACAGGAGTTCA CAGCCTGG
IL-6 CCAATCTGGATTCAATGAGGA AACTCCAAAAGACCAGTGGTGA GCCTGCTG
IL-10 GTTGCCTTCAGCAGAGTGAA GCAACCCAGGTAACCCTTAAA TGCTGGAG
IL-1bTGGTCCTAAACAGATGAAGTGC GTAGTGCTGGCGGGAGAGT GACCTGGA
The Journal of Immunology 3993

OS X (GraphPad Software, La Jolla, CA). Survival was analyzed using
a log-rank test. Other data were analyzed using the Mann-Whitney Utest.
Apvalue ,0.05 was considered statistically significant.
Results
Dose finding and PK/PD of HuMab 7D8
The effective Ab dose for maximum B cell depletion from blood and
lymph nodes was determined in 12 marmosets. Groups of four
monkeys each received a single i.v. injection with placebo (PBS) or
HuMab 7D8 at a dose of 10 or 20 mg/kg (Table I). At the indicated
time points during the first (Fig. 1A) and subsequent days (Fig. 1B),
small venous blood volumes were withdrawn for plasma isolation
in which HuMab 7D8 levels were determined. As expected, all of
the placebo-treated monkeys scored negative in the assay (data not
shown). The average HuMab 7D8 levels in the 10 and 20 mg/kg
dose groups measured in the 5-min blood sample were 56 and 181
mg/ml, respectively. The plasma concentration was maintained at
trough level .10 mg/ml during the following 7 d.
Predictably, the CD20 molecule on B cells in the treated group may
be bound by HuMab 7D8 and therefore could not bind the anti-CD20
Ab conjugate used in flow cytometry. Because anti-CD19 mAb cross-
reacted only poorly with marmosets, we also have determined CD40-
expressing cells to be a surrogate marker for B cell depletion. CD20
is a pan-B cell marker expressed throughout the B cell lineage with
the exception of plasma cells. CD40 is expressed besides on activated
APCs (dendritic cells and macrophages) also on resting and activated
mature B cells but not on plasma cells.
Seven days after the single administration of HuMab 7D8, two
animals of each group were sacrificed (Table I), and the extent of
B cell depletion from spleen and ALN was assessed by flow
cytometry. The profound depletion of CD20
+
cells by both doses of
HuMab 7D8 is depicted in Fig. 1C. The remaining six animals were
sacrificed 62 d after HuMab 7D8 administration (Table I). Fig. 1D
shows that even 2 mo after the administration of a single HuMab7D8
dose reduced percentages of CD20
+
and CD40
+
cells were found in
all of the lymphoid organs. However,the figure also shows that in one
monkey of each group (no. 8/Mi013067 and no. 12/Mi013362) in-
sufficient B cell depletion or partial repletion of B cells had oc-
curred in the spleen and ALN at that time (Fig. 1D).
Anti-CD20 mAb effectively depletes B cells throughout the
EAE experiment
Fourteen unrelated marmosets were immunized with rhMOG in
CFA. Seven animals were selected randomly for treatment with
FIGURE 1. A single dose of the human anti-human CD20 Ab HuMab 7D8 induces profound and long-lasting B cell depletion in naive marmosets. Aand
B, Circulating plasma levels of HuMab 7D8 were determined at 5, 15, 30, 60, 120, and 240 min (A) and 1, 3, 7, and 34 d (B) after administration of HuMab
7D8. Animals received a single dose of 10 mg/kg (closed symbols, Table I) or 20 mg/kg (open symbols, Table I). Plasma levels of the Ab (y-axis) are shown
in log scale. Plasma levels of the 20 mg/kg group were higher until day 34. Cand D, Seven or 62 d after administration of HuMab 7D8, two animals of each
group (Table I) were sacrificed, and CD20 expression was determined in lymphoid organs by flow cytometry. White bars, control; gray bars, 10 mg/kg
HuMab 7D8; black bars, 20 mg/kg HuMab 7D8. Cells underwent a stripping procedure to remove the in vivo administered HuMab 7D8 from the cells.
Shown are the animal numbers on the y-axis (corresponding to Table I), and the percentages of living CD20
+
or CD40
+
cells are shown on the x-axis. At day
7, the percentage of CD20
+
B cells was lower in both treatment groups (C). At day 62, animal 8 (Mi013067) and animal 12 (Mi013362) showed higher
percentages of CD20
+
and CD40
+
B cells than the other treated animals (D).
3994 LATE B CELL DEPLETION PREVENTS MARMOSET EAE

HuMab 7D8 from psd 21, and also seven animals were selected for
placebo treatment with PBS (Table I). On the basis of the PK/PD
data, we chose to induce complete B cell depletion with a single
loading dose of 20 mg HuMab 7D8 per kilogram of body weight
followed by a weekly i.v. maintenance dose of 5 mg/kg. This dosing
regimen aimed at a plasma trough level of 5–10 mg/ml, which was
described previously to be sufficient for sustained biological ac-
tivity in vivo (34).
Plasma levels of HuMab 7D8 were measured every week at
7 d after i.v. administration of HuMab 7D8 or PBS. The plasma
level of HuMab 7D8 remained .5mg/ml, with the exception of one
time point (day 42) in one monkey (M07075) (Fig. 2A). Every 2 wk,
percentages of CD20- and CD40-expressing cells in PBMCs were
determined by flow cytometryto confirmB cell depletion by HuMab
7D8. Seven days after the first dose of HuMab 7D8 (i.e., 28 d after
immunization), CD20
+
and CD40
+
cells were almost completely
depleted compared with those of the control group (Fig. 2B,Sup-
plemental Fig. 1). Throughout the study, the percentage of CD20
remained at a very low level in the treatment group, except at psd
84. At this time point, six of the seven animals, M07095 being the
only exception, contained elevated numbers of CD20
+
cells in the
PBMCs. However, because CD40 expression remained low at this
time point, we assume that these might be immature B cells repleting
the peripheral compartment (Fig. 2B,SupplementalFig.1).
At necropsy, the percentage of CD20
+
and CD40
+
cells present in
the PBMCs, spleen, bone marrow, and lymph nodes were de-
termined by flow cytometry. In the HuMab 7D8 treatment group,
CD20- and CD40-expressing cells were detected, but the levels
were still significantly lower than those in the control group (Fig.
2C, Supplemental Fig. 2). Also, the expression of CD19, assessed
in spleen and ALN by qPCR, was significantly lower in the treat-
ment group (Fig. 2D).
In conclusion, the chosen HuMab 7D8 dosing regimen induced
profound and persistent B cell depletion from blood and lymphoid
organs.
B cell depletion prevents the development of clinical signs
Six of the seven control animals developed clinically evident EAE
characterized by overt neurologic signs above EAE score 2 from psd
55 onward (Fig. 3A). One control animal died unexpectedly at psd
33 without any detectable neurologic signs (M06081). The most
likely cause of death deduced from pathology examination was
cardiac failure. Therefore, this monkey was excluded from further
analysis. Four of the six control animals were sacrificed with at least
one paralyzed limb (para- /hemiplegia; score = 3). M02052 was
sacrificed with a clinical score of 2.25, because of persistent optic
neuritis, which started at psd 48, and excessive weight loss.
M07048 was sacrificed at the predetermined end point psd 106 after
three short-lasting episodes of ataxia (Fig. 3A).
In contrast, four of the seven animals treated with HuMab 7D8
failed to develop detectable neurologic signs (Fig. 3A). The remain-
ing three treated animals developed neurologic signs only for one
day (M07075 and M07095) or two separate days (M04096). Paral-
ysis was observed in none of the treated animals, and all of the
animals were sacrificed with a clinical score of 0 or 0.5 at the-
predetermined end point psd 106 (Fig. 3A). The curves for disease-
free survival (i.e.,time to EAE score 2.0) and overall survival (time
to end point) show that the clinical differences between the two
groups are highly significant (Fig. 3B). In conclusion, late B cell
depletion abrogated the development of neurologic signs.
FIGURE 2. B cells are depleted significantly from blood and lymphoid organs in the marmoset EAE model. A, Treatment with HuMab 7D8 was started
21 d after immunization with rhMOG in CFA. Plasma levels of circulating HuMab 7D8 were determined at the indicated time points during the study and
are shown in log scale (y-axis). B, CD20 and CD40 expression in the PBMCs was determined by flow cytometry throughout the study. Shown are the
percentages of living CD20
+
or CD40
+
cells of total measured cells. The treatment period is indicated as a gray-shaded box. Open symbols represent the
control animals, and closed symbols represent the treated animals. CD20 was not removed with the stripping procedure, because the number of available
PBMCs was too small. CD40 was used to confirm B cell depletion. At psd 28, 42, 56, and 70, a significantly lower percentage of B cells was observed in
treated animals compared with that in control animals. It is of note that the number of animals decreased during the study: the number of control animals
was six until day 42; at psd 56, 70, 84, and 98, CD20 and CD40 expression were analyzed in five, four, two, and one control animals, respectively; the
number of HuMab 7D8-treated animals remained seven during the study. C, At necropsy, CD20 and CD40 expression was determined in the PBMCs and
lymphoid organs by flow cytometry. White bars are control animals, and black bars are treated animals. Cells underwent a stripping procedure to remove
anti-CD20 Ab from cells. Shown are the percentages of viable CD20
+
cells and CD40
+
cells that were gated from the total analyzed cell number using the
live/dead marker (mean 6SEM). B cells were depleted significantly from the PBMCs and lymphoid organs. D, CD19 mRNA expression was determined
by qPCR and normalized to expression levels of ABL. Shown are mean 6SEM. The y-axis is in log scale. CD19 mRNA expression was decreased
significantly in treated animals, confirming B cell depletion. pp,0.05 compared with the control group using the Mann-Whitney Utest.
The Journal of Immunology 3995

FIGURE 3. Late B cell depletionprevents the development of neurologic signs.A, The clinical scores of control (left column) andtreated (right column) animals
are depicted. The psd is indicated on thex-axis. Dotted linesindicate the percentage of body weight loss comparedwith the day of immunization (lefty-a xis). Solid
lines indicate clinical score (right y-axis). The treatment period is indicated with a gray-shaded box. The day of sacrifice of individual monkeysis indicated in the
figure with ciphers. Monkey M06081 succumbed without neurologic deficit from cardiac failure. Of the six remaining control animals, five developed sustained
neurologic signs (clinical score $2). Control animal M07048 developed neurologic signsfor three independent days, but postmortem MRI analysis confirmed the
presence of substantial brain white matterdemyelination (Fig. 4). Four of the seven HuMab 7D8-treated animals developed no neurologic signs, and three of the
seven animals developed neurologic signs for only 1 or 2 d. B, Survivalcurves. The upper pane l shows the disease-free survival, meaningthe time until the animals
developed EAE score 2. The lower panel is the survival time until the day of sacrifice, which was the humane or predetermined end point. B cell depletion sig-
nificantly increased both types of survival (p,0.05 log rank).
3996 LATE B CELL DEPLETION PREVENTS MARMOSET EAE

B cell depletion prevents (MRI-detectable) CNS pathology
MRI sequences of fixed hemispheres were recorded to confirm
that B cell depletion not only prevented the development of
neurologic signs but also of brain lesions. Fig. 4Aand 4Bshow
representative examples of T
2
-weighted (T
2
W) images and MTR
images of two control and two HuMab 7D8-treated marmosets.
Fig. 4Cshows that the lesion load is significantly lower in the
HuMab 7D8-treated group than that in the control group. No
lesions could be observed in three of the seven treated monkeys,
and only very small lesions could be observed in four of the seven
treated monkeys. A lower T
2
and a higher MTR of lesions in the
treatment group suggest that the tissue damage was less in the
HuMab 7D8-treated animals compared with that in the control
animals (Fig. 4C).
In conclusion, these data show that B cell depletion significantly
reduced EAE-associated brain pathology.
FIGURE 4. Reduced cerebral white matter lesion
load in B cell-depleted EAE marmosets. Aand B, For-
malin-fixed hemispheres were analyzed with MRI for
volume (mm
3
), T
2
signal intensity (ms), and MTR
(percentage reduction in signal intensity) of white mat-
ter lesions. T
2
W images were used to calculate the vol-
ume (mm
3
). Representative examples of T
2
W images
(A) and MTR images (B) of two control and two HuMab
7D8-treated animals are shown. White lines encircle the
lesions. C, B cell depletion significantly reduced the
volume of white matter lesions. Lower T
2
and higher
MTR within the lesions of the HuMab 7D8-treated
animals suggest less damage within the lesions of treated
animals. pp,0.05 compared with the control group
using a Mann-Whitney Utest.
FIGURE 5. Reduced plasma lev-
els of IgG after B cell depletion.
Plasma IgG levels against rhMOG
and MOG
54–76
, being the dominant
binding site of anti-MOG IgG Ab,
were determined by ELISA. Recor-
ded OD values were transformed into
A.U. (y-axis, log scale) using home-
made software. A, The upper panel
shows the control animals, and the
lower panel shows the HuMab 7D8-
treated animals with the treatment
period indicated as a gray-shaded
box. The psd is shown on the x-axis.
Shown are the IgG levels of in-
dividual animals. B, Area under the
curve was calculated for each in-
dividual animal and is depicted as
mean 6SEM. Plasma IgG levels
against rhMOG and MOG
54–76
were
reduced significantly after B cell
depletion. Shown is mean 6SEM. C,
Reduced IgG levels also were ob-
served in treated animals at necropsy,
which reflects the peak of the disease
in control animals. Results are
depicted as mean 6SEM (C). pp,
0.05 compared with the control
group using a Mann-Whitney Utest.
A.U., arbitrary units.
The Journal of Immunology 3997

B cell depletion results in the reduction of plasma
autoantibodies
The immunological hallmark and most widely accepted biomarker
of B cell contribution in the EAE model is the production of
autoantibodies. To obtain evidence whether B cell functionality is
eliminated completely in HuMab 7D8-treated monkeys, we mea-
sured plasma levels of IgM and IgG against rhMOG and MOG
54–76
every 2 wk and at the start of the treatment. Abs against MOG
54–76
were measured, because this peptide comprises a dominant B cell
epitope of anti-MOG Abs generated in the rhMOG-induced EAE
model (21). IgM levels peaked in both groups at psd 28 and
declined after that (data not shown). The levels of rhMOG or
MOG
54–76
-specific IgG were clearly higher in the control group
than those in the HuMab 7D8-treated group (Fig. 5A). Until psd 28
(i.e., 7 d after the start of the treatment), IgG levels were compa-
rable between both groups. After psd 28, IgG levels did not increase
further in the treatment group, whereas a .10-fold increase was
detected in the control group (Fig. 5A). The area under the curves
was calculated for each individual animal, and group means were
calculated. Fig. 5Bshows that IgG autoantibodies against rhMOG
and MOG
54–76
were significantly lower in the treatment group
compared with those in the control group. Also at necropsy, a sig-
nificant reduction of the autoantibodies was observed (Fig. 5C).
Effect of B cell depletion on cell numbers, T cell phenotype,
and proliferation
To test the systemic effect of B cell depletion on the cellular immune
compartment in the marmoset EAE model, we first analyzed the
distribution of leukocyte and lymphocyte subsets. Fig. 6Ashows the
variation of WBC, lymphocyte, neutrophil, and monocyte numbers
in the PBMCs in both groups. Increased numbers of monocytes
were observed in the treatment group (Fig. 6A). At necropsy, we
also observed increased absolute numbers of WBCs, lymphocytes,
neutrophils, and monocytes in the treatment group, although not
significant (Fig. 6B). It is of note that the cell numbers at necropsy
are determined at different/individual time points (i.e., the day that
each animal is sacrificed with full-blown EAE in the control group
and the end of the study for treated animals).
During the study and at necropsy, the phenotype of the lym-
phocytes was analyzed by flow cytometry to assess the effect of
B cell depletion on the T cell compartment. We observed no effecton
the CD3 percentage or the CD4/CD8 ratio in the PBMCs throughout
FIGURE 6. Hematological effects of B cell depletion. Aand B, The absolute number of WBCs, lymphocytes, neutrophils, and monocytes was de-
termined during the study (A) and at necropsy (B). The gray-shaded box indicates the treatment period. Shown are mean 6SEM. The results of day 56 are
the mean of five instead of six control animals. At psd 42, a significantly higher number of monocytes was recorded in the treatment group compared with
that in the control group. At necropsy, higher numbers of all of the analyzed cell types were observed in the treatment group, although differences were not
significant. The higher number of lymphocytes at necropsy may be compensatory for the loss of B cells. C, During the study, the percentages of CD3
+
cells
were analyzed by flow cytometry. Shown is the change in CD3
+
cell frequencies relative to the day of immunization. No difference in CD3
+
cells or CD4/
CD8 ratio was observed throughout the study. Shown are the mean 6SEM until day 56, because after psd 56 we started to take control animals out of the
study. The gray-shaded area indicates the treatment period. D, At necropsy, a significant increase of CD3
+
cell percentage was observed by flow cytometry
in the PBMCs and secondary lymphoid organs but not in the bone marrow. E, At necropsy, CD3 mRNA expression in spleen (left y-axis) and ALN (right y-
axis) was analyzed by qPCR and normalized to the expression levels of ABL. Shown is the mRNA expression of CD3 relative to that of ABL (mean 6
SEM). CD3 mRNA was significantly increased in ALN but not in spleen. pp,0.05 compared with the control group.
3998 LATE B CELL DEPLETION PREVENTS MARMOSET EAE

the observation period (Fig. 6C). At necropsy, however, higher
percentages of CD3
+
cells were observed in the PBMCs, spleen,
and lymph nodes (Fig. 6D). Although we like to emphasize that this
is a percentage and not an absolute number and may be caused by
the depletion of the B cell population, CD3 mRNA levels also were
increased significantly in the ALN (Fig. 6E). The CD4/CD8 ratio
was not changed in the PBMCs or lymphoid organs at necropsy
(data not shown).
Next, we analyzed the effect of B cell depletion on proliferation
and cytokine production. At necropsy, we observed a higher level of
proliferation in the PBMCs from the treatment group stimulated with
rhMOG, MOG peptides 24–46 and 34–56, or Con A (Fig. 7A). By
contrast, the proliferative responses of MNCs from monkeys in the
treatment group to these Ags were lower in spleen, ALN, and LLN.
It is of note that also the background proliferation and the response
to OVA and Con A were reduced in these organs (Fig. 7A). No
differences were observed in inguinal or cervical lymph nodes (data
not shown).
The phenotype of the cells in spleen and ALN that proliferated
against rhMOG was assessed with the CFSE dilution assay. We
observed that depletion of CD20
+
cells led to reduced proliferation
of both CD4
+
and CD8
+
T cells from ALN and, albeit to a lesser
extent, spleen (Fig. 7Band data not shown).
In conclusion, the late depletion of B cells has profound effects on
the T cell compartment. The most obvious effect observed in blood
at necropsy was increment of monocyte numbers. The numbers of
CD3
+
T cells also were increased in blood and all of the analyzed
secondary lymphoid organs. The activity assessment showed that
proliferation was increased in blood but decreased in the secondary
lymphoid organs.
Reduced cytokine production after B cell depletion
The rhMOG-induced protein levels of IL-12 (p40/p70), IL-17A, and
IFN-gwere analyzed in supernatant of rhMOG-stimulated MNC
cultures. We observed IL-17A production by splenocytes in four of
the six control animals and by MNCs from ALNs and LLNs from
two of the six control animals in response to stimulation with
rhMOG. By contrast, we observed rhMOG-stimulated IL-17A
production only in splenocytes of one of the seven B cell-depleted
animals (Fig. 8A). No such obvious differences between control and
treated animals were observed for the production of IFN-gand
IL-12 (Fig. 8A).
Cytokine production in spleen and ALN also was analyzed at the
mRNA level. In treated animals, mRNA levels of IL-10 and IL-1b
were increased in ALN, and IL-7 mRNA levels were reduced in
both spleen and ALN compared with those of the control animals.
This indicates that B cells are an important source of IL-7 in the
rhMOG-induced EAE model. No differences between treated and
nontreated animals were observed for IL-17A, IFN-g, TNF-a,
IL-6, and IL-4 (Fig. 8B).
The data in the previous paragraph demonstrated that CD3
+
T cell numbers are increased in the lymphoid organs of B cell-
depleted monkeys, as also was reflected by increased CD3 mRNA
levels in the ALN (Fig. 6E). For this reason, we chose to normalize
the T cell cytokine mRNA levels (IL-17A, IFN-g, TNF-a, IL-6, and
IL-4) against CD3 instead of ABL. Indeed, the corrected data show
reduced IL-17A, IFN-g, TNF-a, and IL-6 levels in ALN of treated
animals, suggesting less cytokine production per T cell (Fig. 8C).
In conclusion, the reduction of T cell proliferation together with
the reduced cytokine production in lymphoid organs indicates that
the depletion of CD20
+
B cells impairs the activity and/or path-
ogenic function of cellular autoimmune mechanisms.
B cell depletion alters the composition of T cell and B cell
areas in spleen and lymph nodes
We have investigated in more detail the effect of B cell depletion on
the organization of spleen and ALN using H&E staining and
immunostaining of cryosections. The anti-CD20 Ab (clone L26)
used for immunostaining recognizes an intracellular epitope of
CD20 (35). Therefore, this Ab does not compete with the anti-
CD20 Ab administered in vivo.
The H&E staining of the spleen shows a similar structural or-
ganization in control and HuMab 7D8-treated animals. The spleen
of all of the animals, except M04096, is composed of similar areas
FIGURE 7. Increased T cell proliferation in blood versus reduced T cell proliferation in lymphoid organs after B cell depletion. A, Proliferation at
necropsy was assessed using the incorporation of [
3
H]thymidine. Shown are the mean 6SEM in cpm (y-axis). Proliferation in the spleen was assessed in
six of the seven HuMab 7D8-treated animals, because the spleen of M05073 could not be analyzed due to small cell numbers. Proliferation in the LLN was
analyzed in four animals of each group. Increased proliferation against rhMOG and MOG peptides was observed in PBMCs of treated animals. In contrast,
reduced general (no stimulation, OVA, or Con A) and MOG-specific proliferation was observed in lymphoid organs of treated animals. B, Percentage of
dividing CD3
+
CD4
+
or CD3
+
CD8
+
cells in the ALN. Percentages of total measured events are shown in mean 6SEM. Reduced proliferation against
rhMOG and OVA was observed in both T cell compartments. pp,0.05 compared with the control group using a Mann-Whitney Utest.
The Journal of Immunology 3999

of white pulp (WP) and red pulp (Fig. 9). In the control animals,
the WP consisted of T cell and B cell areas. In the HuMab 7D8-
treated animals, the WP consisted only of T cells, even in the areas
where B cells were expected (Fig. 9). M07095 showed a small
area of CD20
+
and CD40
+
cells (data not shown), but in none of
the other HuMab 7D8-treated animals CD20- or CD40 -expressing
B cells were observed in the WP. A few CD40
+
cells were detected
in the WP of HuMab 7D8-treated animals, but the morphology
suggests that these were follicular dendritic cells or macrophages
(Fig. 9, inset).
The structure of the medulla and the cortex in ALN was also
similar in both groups as assessed by H&E staining (Fig. 9). CD3
staining shows normal structural organization in control animals.
However, in the HuMab 7D8-treated animals, the number of CD3
+
cells appeared to be increased in the cortex (Fig. 9), which is in line
with the increased CD3 mRNA expression (Fig. 6E). A few CD20
+
cells were observed in M07075 and M07095, but in the other five
HuMab 7D8-treated animals, no CD20 staining was found. CD40
was detected in B cell areas of ALN of both control and HuMab
7D8-treated animals. However, in the HuMab 7D8-treated animals,
we observed that the B cell areas were hypocellular compared
with those of control animals. Furthermore, flow cytometry showed
a reduced number of B cells, and also the morphology of the
CD40
+
cells suggested that these cells were not B cells.
These data demonstrate that the general structure of secondary
lymphoid organs is not changed by B cell depletion. In the spleen,
FIGURE 8. Cytokine profiles in B cell-depleted and control EAE marmosets. A, Production of cytokine protein was determined with ELISA in
supernatants of cells stimulated for 48 h with rhMOG or OVA. Shown are the cytokine concentrations (pg/ml) produced in response to rhMOG from which
the OVA-induced cytokine production was subtracted. Cytokine levels in unstimulated cells were ,25 pg/ml. IL-17A was detected in four of the six control
animals but only in one of the seven treated animals. Band C, Cytokine gene transcript levels in tissue also were determined by qPCR and normalized to
expression levels of ABL. In the case of two y-axes, the left y-axis refers to the spleen, and the right y-axis refers to the ALN. B, mRNA expression levels of
the cytokines relative to those of ABL (mean 6SEM). No differences in mRNA levels of T cell-specific cytokines were observed, but IL-10 and IL-1b
mRNA levels were increased in ALN of treated animals compared with those of controls. IL-7 mRNA levels were substantially reduced in spleen and ALN
of treated animals compared with those of control animals. Because CD3 mRNA expression levels were increased significantly in the ALN of treated
animals (Fig. 6E), the levels of T cell-specific cytokines of Fig. 8Balso were expressed relative to the CD3 mRNA levels of Fig. 6E. This shows the
cytokine mRNA levels per CD3 mRNA (mean 6SEM). C, The normalized values show in the ALN, but not in the spleen, significantly lower levels of IL-
17A, IFN-g, TNF-a, and IL-6. pp,0.05 compared with the control group using a Mann-Whitney Utest.
4000 LATE B CELL DEPLETION PREVENTS MARMOSET EAE

the B cell areas appeared to be filled with T cells. In ALN, T cell
numbers seemed to be increased in T cell areas, and the B cell areas
were hypocellular and only contained CD40
+
non-B cells.
Discussion
Clinical trials with a chimeric CD20 mAb have shown that de-
pletion of B cells has beneficial effects in RRMS, while autoan-
tibody levels were unaffected (2, 3). This observation has raised
questions on the exact immunopathogenic role of B cells in MS.
We have investigated in a nonhuman primate model of MS (i.e.,
EAE in the common marmoset) immunopathogenic mechanisms
of which are altered by B cell depletion. Because the chimeric
anti-CD20 mAb (rituximab) does not cross-react with marmoset
CD20, we used the fully human CD20 mAb HuMab 7D8 (25, 26).
In the first part of the current study, we have analyzed the extent
and duration of B cell depletion after a single i.v. dose of HuMab
7D8 at 10 or 20 mg/kg. The results demonstrate the high potency
of HuMab 7D8 in the marmoset, because it induced profound and
long-lasting depletion of B cells from peripheral blood as well as
lymphoid organs. In the second part of the study, we have chosen
a dosing regimen with a high loading dose of 20 mg/kg HuMab 7D8
for obtaining a robust B cell depletion and thereby lowering the risk
of inducing neutralizing Ab, followed by a 4-fold lower weekly
maintenance dose at 5 mg/kg for maintaining maximum efficacy.
The data show that the applied dosing schedule completely abro-
gated the typical MS-like clinical and pathological signs of
this EAE model. This demonstrates the high in vivo efficacy of
the Ab in this model and emphasizes the important role of B cells
in MS.
We observed substantially lower levels of rhMOG-specific IgG
in marmosets treated with HuMab 7D8 compared with those of
control animals, although the early stage production of IgM auto-
antibodies was unaffected. It is important to note that at the time
that the HuMab 7D8 treatment was started (i.e., 21 d after im-
munization) the production of anti-MOG IgG production had al-
ready been initiated but had not reached peak levels. Peak levels of
IgG autoantibody in the control group were reached about ∼3wk
later. The reported data suggest that the HuMab 7D8 treatment did
not completely suppress anti-MOG IgG production but rather
arrested the further increased production of anti-MOG IgG. The
effect of B cell depletion on autoantibody production in MS is
unknown. Interestingly, in systemic lupus erythematosus patients,
treatment with rituximab led to suppression of IgG autoantibody
production, whereas no effect was observed on total IgG serum
levels (36).
The question is warranted whether the dramatic effect of HuMab
7D8 treatment on clinical scores and lesion formation in the
marmoset EAE model can be attributed completely to the observed
reduction of autoantibody levels. Previous research has shown that
the EAE development in marmosets immunized with rhMOG in
CFA involves the activation of cellular and humoral autoimmune
mechanisms (32). However, we would like to emphasize that
autoantibodies do not have an essential influence on the EAE
course, because lesions and neurologic signs develop also in the
absence of anti-MOG Abs (20–22). This is compatible with the
finding that axonal injury in lesions is more linked to the presence
of inflammation than the presence of demyelination (37). We like
to postulate here that although the capacity of anti-MOG Abs to
amplify demyelination and mild clinical signs in the marmoset
EAE model has been demonstrated clearly (14, 38), they are not
an indispensable factor in the immunopathogenic process.
The current study shows that depletion of CD20
+
B cells in-
duced a few changes in peripheral blood (i.e., increased numbers
of monocytes and increased proliferation of MNCs against
FIGURE 9. Histological analysis of T cell and B cell areas in the spleen and ALN of B cell-depleted and control monkeys. Shown are representative
examples of H&E (original magnification 340), CD20 (original magnification 3100), CD40 (original magnification 3100), and CD3 (original magni-
fication 3100) staining on spleen (two left columns) and ALN (two right columns). The H&E staining shows that the overall histology of the spleen and
ALN was not changed by B cell depletion. In the spleen, the CD20 staining of the control animal shows a clearly demarcated B cell area in the WP that is
also CD40
+
. CD40
+
cells also are present in the RP. The CD3 staining of the WP shows the CD3
+
T cell area. In the B cell-depleted spleen, no CD20
+
cells
are present. A few CD40
+
cells are present, but these morphologically resemble follicular dendritic cells or macrophages (inset). The WP of the B cell-
depleted animal seems to consist completely of T cells. For the ALN, the ALN of the control animal contains a clearly demarcated CD20
+
area, which
stains also CD40
+
. CD40
+
cells also are observed in the medulla. CD3
+
cells are confined to the T cell areas of the cortex. In the ALN of B cell-depleted
animals, the B cell area is hypocellular with a few CD20
+
and CD40
+
cells, but the latter do not have the morphology of B cells. The number of T cells
seems to be increased in the cortex of the ALN of B cell-depleted animals. RP, red pulp; WP, white pulp.
The Journal of Immunology 4001

rhMOG and MOG peptides). A more profound effect was found
in the lymphoid organs. The histological analysis of spleen and
lymph nodes demonstrated that B cell depletion dramatically
altered the relative proportions of B cells and T cells. Where
complete depletion was expected, we had not anticipated the
increase of T cells. It can be assumed safely that the altered
T cell/B cell ratio changes the environmental conditions under
which the activation of the MOG
34–56
-reactive T cells, which
mediate the expression of neurologic deficit, occurs (21, 22). The
immune profiling of spleen and lymph nodes indeed confirmed
that although these organs contain higher percentages of CD3
+
T cells, proliferation of MOG (peptide)-reactive T cells is im-
paired and cytokine production is skewed toward a more anti-
inflammatory profile characterized by reduced IL-17A and IFN-
gand increased IL-10. The strong reduction of IL-7 production
in the B cell-depleted monkeys may be of particular interest,
because this is a crucial cytokine for the survival of IL-17A-
producing T cells, which are thought to have a central pathogenic
role in MS and EAE models (39), including the EAE model in
marmosets (22). Impairment of T cell activation has been put
forward as a possible explanation for the clinical effect of B cell
depletion in RRMS (2, 3). Reduced T cell activity after B cell
depletion has been observed in various experimental systems,
including naive mice, NOD mice, two mouse models for arthritis,
and mice infected with Listeria monocytogenes (40, 41). Taken
together, these data suggest that the beneficial effect of systemic
B cell depletion may be mediated by mitigated T cell activation
in lymphoid organs.
In view of recent data on the pathogenic function of intra-CNS-
localized EBV-infected B cells in MS (42), although not confirmed
by others (43, 44), it is tempting to speculate whether the clinical
effect of the anti-CD20 Ab can be explained by the depletion of
B cells from the CNS. Several lines of evidence indicate that
MOG
34–56
-specific T cells, which have a key role in the clinical
expression of EAE in marmosets, can be activated ex vivo by EBV-
transformed B cells (21, 22) (K.G. Haanstra, J.A.M. Wubben,
D.M. Lopes Este
ˆva
˜o, M. Jonker, R.Q Hintzen, and B.A. ’t Hart.,
manuscript in preparation). Indeed, we have observed that the
CD20
+
cells that are clearly present in the CNS of EAE-affected
control marmosets cannot be detected in the anti-CD20 Ab-treated
monkeys (data not shown). We cannot exclude, however, that this
is due to masking of CD20 by the therapeutic Ab. CD40 expression
cannot be used as a control, because this marker is upregulated
strongly in the EAE-affected CNS and Abs for human CD19 do not
cross-react with the marmoset counterpart (45).
In conclusion, we have shown that B cell depletion in the
marmoset EAE model mitigated the activation of autoreactive
T cells. We like to postulate that this reduction in T cell activation
contributes to the remarkable clinical effect of B cell depletion, and
we hypothesize that a similar T cell change occurs in MS. It is
difficult to prove this directly in MS patients, because the T cell
activity in lymphoid organs cannot be examined. Current clinical
trials support the idea that B cell depletion is a major step in therapy
development for RRMS patients. Future studies are warranted to
elucidate further the Ag-presenting function of B cells, especially
in the CNS, and to investigate further the organization of lymphoid
organs after B cell depletion.
Acknowledgments
We thank Fred Batenburg, Mariska van Etten, and Martine Hoffmann for
excellent biotechnical assistance and daily care of the monkeys, Dr. Jaco
Bakker, Dr. Gerco Braskamp, and Dr. Merei Keehnen for expert veterinary
care, Tom Haaksma and Dr. Ivanela Kondova for autopsy of the monkeys,
Marjan van Meurs for help with in situ analysis, and Henk van Westbroek
for the artwork.
Disclosures
At the time that the reported study was executed, P.W.H.I.P. and W.K.B.
were employed by Genmab Utrecht, The Netherlands, and J.L.C. was
employed by GlaxoSmithKline, Stevenage, U.K.
References
1. Stu
¨ve, O., S. Cepok, B. Elias, A. Saleh, H. P. Hartung, B. Hemmer, and
B. C. Kieseier. 2005. Clinical stabilization and effective B-lymphocyte depletion
in the cerebrospinal fluid and peripheral blood of a patient with fulminant
relapsing-remitting multiple sclerosis. Arch. Neurol. 62: 1620–1623.
2. Bar-Or, A., P. A. Calabresi, D. Arnold, C. Markowitz, S. Shafer, L. H. Kasper,
E. Waubant, S. Gazda, R. J. Fox, M. Panzara, et al. 2008. Rituximab in relapsing-
remitting multiple sclerosis: a 72-week, open-label, phase I trial. Ann. Neurol.
63: 395–400.
3. Hauser, S. L., E. Waubant, D. L. Arnold, T. Vollmer, J. Antel, R. J. Fox,
A. Bar-Or, M. Panzara, N. Sarkar, S. Agarwal, et al; HERMES Trial Group.
2008. B-cell depletion with rituximab in relapsing-remitting multiple sclero-
sis. N. Engl. J. Med. 358: 676–688.
4. Hawker, K., P. O’Connor, M. S. Freedman, P. A. Calabresi, J. Antel, J. Simon,
S. Hauser, E. Waubant, T. Vollmer, H. Panitch, et al; OLYMPUS Trial Group.
2009. Rituximab in patients with primary progressive multiple sclerosis: results
of a randomized double-blind placebo-controlled multicenter trial. Ann. Neurol.
66: 460–471.
5. Monson, N. L., P. D. Cravens, E. M. Frohman, K. Hawker,and M. K. Racke. 2005.
Effect of rituximab on the peripheral blood and cerebrospinal fluid B cells in
patients with primary progressive multiple sclerosis. Arch. Neurol. 62: 258–264.
6. Cross, A. H., J. L. Stark, J. Lauber, M. J. Ramsbottom, and J. A. Lyons. 2006.
Rituximab reduces B cells and T cells in cerebrospinal fluid of multiple sclerosis
patients. J. Neuroimmunol. 180: 63–70.
7. Martin, Mdel. P., P. D. Cravens, R. Winger, B. C. Kieseier, S. Cepok,
T. N. Eagar, S. S. Zamvil, M. S. Weber, E. M. Frohman, B. K. Kleinschmidt-
Demasters, et al. 2009. Depletion of B lymphocytes from cerebral perivascular
spaces by rituximab. Arch. Neurol. 66: 1016–1020.
8. Noseworthy, J. H., C. Lucchinetti, M. Rodriguez, and B. G. Weinshenker. 2000.
Multiple sclerosis. N. Engl. J. Med. 343: 938–952.
9. Brehm, U., S. J. Piddlesden, M. V. Gardinier, and C. Linington. 1999. Epitope
specificity of demyelinating monoclonal autoantibodies directed against the hu-
man myelin oligodendrocyte glycoprotein (MOG). J. Neuroimmunol. 97: 9–15.
10. Zhou, D., R. Srivastava, S. Nessler, V. Grummel, N. Sommer, W. Bru
¨ck,
H. P. Hartung, C. Stadelmann, and B. Hemmer. 2006. Identification of a patho-
genic antibody response to native myelin oligodendrocyte glycoprotein in mul-
tiple sclerosis. Proc. Natl. Acad. Sci. USA 103: 19057–19062.
11. Haase, C. G., J. Guggenmos, U. Brehm, M. Andersson, T. Olsson, M. Reindl,
J. M. Schneidewind, U. K. Zettl, F. Heidenreich, T. Berger, et al. 2001. The fine
specificity of the myelin oligodendrocyte glycoprotein autoantibody response in
patients with multiple sclerosis and normal healthy controls. J. Neuroimmunol.
114: 220–225.
12. Morris-Downes, M. M., P. A. Smith, J. L. Rundle, S. J. Piddlesden, D. Baker,
D. Pham-Dinh, N. Heijmans, and S. Amor. 2002. Pathological and regulatory
effects of anti-myelin antibodies in experimental allergic encephalomyelitis in
mice. J. Neuroimmunol. 125: 114–124.
13. Linington, C., M. Bradl, H. Lassmann, C. Brunner, and K. Vass. 1988. Aug-
mentation of demyelination in rat acute allergic encephalomyelitis by circulating
mouse monoclonal antibodies directed against a myelin/oligodendrocyte gly-
coprotein. Am. J. Pathol. 130: 443–454.
14. Genain, C. P., M. H. Nguyen, N. L. Letvin, R. Pearl, R. L. Davis, M. Adelman,
M. B. Lees, C. Linington, and S. L. Hauser. 1995. Antibody facilitation of multiple
sclerosis-like lesions in a nonhuman primate. J. Clin. Invest. 96: 2966–2974.
15. Lucchinetti, C., W. Bru
¨ck, J. Parisi, B. Scheithauer, M. Rodriguez, and
H. Lassmann. 2000. Heterogeneity of multiple sclerosis lesions: implications for
the pathogenesis of demyelination. Ann. Neurol. 47: 707–717.
16. Serafini, B., B. Rosicarelli, R. Magliozzi, E. Stigliano, and F. Aloisi. 2004. De-
tection of ectopic B-cell follicles with germinal centers in the meninges of patients
with secondary progressive multiple sclerosis. Brain Pathol. 14: 164–174.
17. Magliozzi, R., O. Howell, A. Vora, B. Serafini, R. Nicholas, M. Puopolo,
R. Reynolds, and F. Aloisi. 2007. Meningeal B-cell follicles in secondary pro-
gressive multiple sclerosis associate with early onset of disease and severe
cortical pathology. Brain 130: 1089–1104.
18. ’t Hart, B. A., J. D. Laman, J. Bauer, E. Blezer, Y. van Kooyk, and R. Q. Hintzen.
2004. Modelling of multiple sclerosis: lessons learned in a non-human primate.
Lancet Neurol. 3: 588–597.
19. Kap, Y. S., J. D. Laman, and B. A. ’t Hart. 2010. Experimental autoimmune
encephalomyelitis in the common marmoset, a bridge between rodent EAE and
multiple sclerosis for immunotherapy development. J. Neuroimmune Pharmacol.
5: 220–230.
20. Jagessar, S. A., P. A. Smith, E. Blezer, C. Delarasse, D. Pham-Dinh, J. D. Laman,
J. Bauer, S. Amor, and B. ’t Hart. 2008. Autoimmunity against myelin oligo-
dendrocyte glycoprotein is dispensable for the initiation although essential for
the progression of chronic encephalomyelitis in common marmosets. J. Neuro-
pathol. Exp. Neurol. 67: 326–340.
4002 LATE B CELL DEPLETION PREVENTS MARMOSET EAE

21. Kap, Y. S., P. Smith, S. A. Jagessar, E. Remarque, E. Blezer, G. J. Strijkers,
J. D. Laman, R. Q. Hintzen, J. Bauer, H. P. Brok, and B. A. ’t Hart. 2008. Fast
progression of recombinant human myelin/oligodendrocyte glycoprotein
(MOG)-induced experimental autoimmune encephalomyelitis in marmosets is
associated with the activation of MOG34-56-specific cytotoxic T cells. J.
Immunol. 180: 1326–1337.
22. Jagessar, S. A., Y. S. Kap, N. Heijmans, N. van Driel, L. van Straalen,
J. J. Bajramovic, H. P. M. Brok, E. L. A. Blezer, J. Bauer, J. D. Laman, and
B. A. ’t Hart. 2010. Induction of progressive demyelinating autoimmune en-
cephalomyelitis in common marmoset monkeys using MOG34-56 peptide in
incomplete freund adjuvant. J. Neuropathol. Exp. Neurol. 69: 372–385.
23. Vergelli, M., H. Le, J. M. van Noort, S. Dhib-Jalbut, H. McFarland, and
R. Martin. 1996. A novel population of CD4+CD56+ myelin-reactive T cells
lyses target cells expressing CD56/neural cell adhesion molecule. J. Immunol.
157: 679–688.
24. Van der Aa, A., N. Hellings, C. C. Bernard, J. Raus, and P. Stinissen. 2003.
Functional properties of myelin oligodendrocyte glycoprotein-reactive T cells in
multiple sclerosis patients and controls. J. Neuroimmunol. 137: 164–176.
25. Teeling, J. L., R. R. French, M. S. Cragg, J. van den Brakel, M. Pluyter,
H. Huang, C. Chan, P. W. Parren, C. E. Hack, M. Dechant, et al. 2004. Char-
acterization of new human CD20 monoclonal antibodies with potent cytolytic
activity against non-Hodgkin lymphomas. Blood 104: 1793–1800.
26. Teeling, J. L., W. J. Mackus, L. J. Wiegman, J. H. van den Brakel, S. A. Beers,
R. R. French, T. van Meerten, S. Ebeling, T. Vink, J. W. Slootstra, et al. 2006.
The biological activity of human CD20 monoclonal antibodies is linked to
unique epitopes on CD20. J. Immunol. 177: 362–371.
27. Beum, P. V., M. A. Lindorfer, F. Beurskens, P. T. Stukenberg, H. M. Lokhorst,
A. W. Pawluczkowycz, P. W. Parren, J. G. van de Winkel, and R. P. Taylor. 2008.
Complement activation on B lymphocytes opsonized with rituximab or ofatu-
mumab produces substantial changes in membrane structure preceding cell lysis.
J. Immunol. 181: 822–832.
28. Ruuls, S. R., J. J. Lammerts van Bueren, J. G. van de Winkel, and P. W. Parren.
2008. Novel human antibody therapeutics: the age of the Umabs. Biotechnol. J.
3: 1157–1171.
29. Kerlero de Rosbo, N., M. Hoffman, I. Mendel, I. Yust, J. Kaye, R. Bakimer,
S. Flechter, O. Abramsky, R. Milo, A. Karni, and A. Ben-Nun. 1997. Pre-
dominance of the autoimmune response to myelin oligodendrocyte glycoprotein
(MOG) in multiple sclerosis: reactivity to the extracellular domain of MOG is
directed against three main regions. Eur. J. Immunol. 27: 3059–3069.
30. ’t Hart, B. A., R. Q. Hintzen, and J. D. Laman. 2008. Preclinical assessment of
therapeutic antibodies against human CD40 and human interleukin-12/23p40 in
a nonhuman primate model of multiple sclerosis. Neurodegener. Dis. 5: 38–52.
31. Blezer, E. L., J. Bauer, H. P. Brok, K. Nicolay, and B. A. ’t Hart. 2007. Quan-
titative MRI-pathology correlations of brain white matter lesions developing in
a non-human primate model of multiple sclerosis. NMR Biomed. 20: 90–103.
32. Brok, H. P., A. Uccelli, N. Kerlero De Rosbo, R. E. Bontrop, L. Roccatagliata,
N. G. de Groot, E. Capello, J. D. Laman, K. Nicolay, G. L. Mancardi, et al. 2000.
Myelin/oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis in
common marmosets: the encephalitogenic T cell epitope pMOG24-36 is pre-
sented by a monomorphic MHC class II molecule. J. Immunol. 165: 1093–1101.
33. Beillard, E., N. Pallisgaard, V. H. van der Velden, W. Bi, R. Dee, E. van der
Schoot, E. Delabesse, E. Macintyre, E. Gottardi, G. Saglio, et al. 2003.
Evaluation of candidate control genes for diagnosis and residual disease de-
tection in leukemic patients using ‘real-time’ quantitative reverse-transcriptase
polymerase chain reaction (RQ-PCR) - a Europe against cancer program. Leu-
kemia 17: 2474–2486.
34. Bleeker, W. K., M. E. Munk, W. J. Mackus, J. H. van den Brakel, M. Pluyter,
M. J. Glennie, J. G. van de Winkel, and P. W. Parren. 2008. Estimation of dose
requirements for sustained in vivo activity of a therapeutic human anti-CD20
antibody. Br. J. Haematol. 140: 303–312.
35. Mason, D. Y., W. M. Comans-Bitter, J. L. Cordell, M. A. Verhoeven, and J. J. van
Dongen. 1990. Antibody L26 recognizes an intracellular epitope on the B-cell-
associated CD20 antigen. Am. J. Pathol. 136: 1215–1222.
36. Vallerskog, T., I. Gunnarsson, M. Widhe, A. Risselada, L. Klareskog, R. van
Vollenhoven, V. Malmstro
¨m, and C. Trollmo. 2007. Treatment with rituximab
affects both the cellular and the humoral arm of the immune system in patients
with SLE. Clin. Immunol. 122: 62–74.
37. Mancardi, G., B. Hart, L. Roccatagliata, H. Brok, D. Giunti, R. Bontrop,
L. Massacesi, E. Capello, and A. Uccelli. 2001. Demyelination and axonal
damage in a non-human primate model of multiple sclerosis. J. Neurol. Sci. 184:
41–49.
38. McFarland, H. I., A. A. Lobito, M. M. Johnson, J. T. Nyswaner, J. A. Frank,
G. R. Palardy, N. Tresser, C. P. Genain, J. P. Mueller, L. A. Matis, and
M. J. Lenardo. 1999. Determinant spreading associated with demyelination in
a nonhuman primate model of multiple sclerosis. J. Immunol. 162: 2384–2390.
39. Liu, X., S. Leung, C. Wang, Z. Tan, J. Wang, T. B. Guo, L. Fang, Y. Zhao,
B. Wan, X. Qin, et al. 2010. Crucial role of interleukin-7 in T helper type 17
survival and expansion in autoimmune disease. Nat. Med. 16: 191–197.
40. Bouaziz, J. D., K. Yanaba, G. M. Venturi, Y. Wang, R. M. Tisch, J. C. Poe, and
T. F. Tedder. 2007. Therapeutic B cell depletion impairs adaptive and autore-
active CD4+ T cell activation in mice. Proc. Natl. Acad. Sci. USA 104: 20878–
20883.
41. Hamel, K., P. Doodes, Y. Cao, Y. Wang, J. Martinson, R. Dunn, M. R. Kehry,
B. Farkas, and A. Finnegan. 2008. Suppression of proteoglycan-induced arthritis
by anti-CD20 B Cell depletion therapy is mediated by reduction in autoanti-
bodies and CD4+ T cell reactivity. J. Immunol. 180: 4994–5003.
42. Serafini, B., B. Rosicarelli, D. Franciotta, R. Magliozzi, R. Reynolds, P. Cinque,
L. Andreoni, P. Trivedi, M. Salvetti, A. Faggioni, and F. Aloisi. 2007. Dysreg-
ulated Epstein-Barr virus infection in the multiple sclerosis brain. J. Exp. Med.
204: 2899–2912.
43. Willis, S. N., C. Stadelmann, S. J. Rodig, T. Caron, S. Gattenloehner,
S. S. Mallozzi, J. E. Roughan, S. E. Almendinger, M. M. Blewett, W. Bru
¨ck, et al.
2009. Epstein-Barr virus infection is not a characteristic feature of multiple scle-
rosis brain. Brain 132: 3318–3328.
44. Sargsyan, S. A., A. J. Shearer, A. M. Ritchie, M. P. Burgoon, S. Anderson,
B. Hemmer, C. Stadelmann, S. Gattenlo
¨hner, G. P. Owens, D. Gilden, and
J. L. Bennett. 2010. Absence of Epstein-Barr virus in the brain and CSF of
patients with multiple sclerosis. Neurology 74: 1127–1135.
45. Kap, Y. S., M. van Meurs, N. van Driel, G. Koopman, M. J. Melief, H. P. Brok,
J. D. Laman, and B. A. ’t Hart. 2009. A monoclonal antibody selection for
immunohistochemical examination of lymphoid tissues from non-human pri-
mates. J. Histochem. Cytochem. 57: 1159–1167.
The Journal of Immunology 4003