Content uploaded by Mark A Kay
Author content
All content in this area was uploaded by Mark A Kay on Jun 28, 2014
Content may be subject to copyright.
Human tRNA-derived small RNAs in the global regulation
of RNA silencing
DIRK HAUSSECKER,
1,2
YONG HUANG,
1,2
ASHLEY LAU,
1,2
POORNIMA PARAMESWARAN,
3
ANDREW Z. FIRE,
2,4
and MARK A. KAY
1,2
1
Department of Pediatrics, Stanford University, Stanford, California 94305, USA
2
Department of Genetics, Stanford University, Stanford, California 94305, USA
3
Department of Microbiology and Immunology, Stanford University, Stanford, California 94305, USA
4
Department of Pathology, Stanford University, Stanford, California 94305, USA
ABSTRACT
Competition between mammalian RNAi-related gene silencing pathways is well documented. It is therefore important to
identify all classes of small RNAs to determine their relationship with RNAi and how they affect each other functionally. Here,
we identify two types of 59-phosphate, 39-hydroxylated human tRNA-derived small RNAs (tsRNAs). tsRNAs differ from
microRNAs in being essentially restricted to the cytoplasm and in associating with Argonaute proteins, but not MOV10. The first
type belongs to a previously predicted Dicer-dependent class of small RNAs that we find can modestly down-regulate target
genes in trans. The 59end of type II tsRNA was generated by RNaseZ cleavage downstream from a tRNA gene, while the 39end
resulted from transcription termination by RNA polymerase III. Consistent with their preferential association with the
nonslicing Argonautes 3 and 4, canonical gene silencing activity was not observed for type II tsRNAs. The addition, however, of
an oligonucleotide that was sense to the reporter gene, but antisense to an overexpressed version of the type II tsRNA, triggered
robust, >80% gene silencing. This correlated with the redirection of the thus reconstituted fully duplexed double-stranded RNA
into Argonaute 2, whereas Argonautes 3 and 4 were skewed toward less structured small RNAs, particularly single-strand RNAs.
We observed that the modulation of tsRNA levels had minor effects on the abundance of microRNAs, but more pronounced
changes in the silencing activities of both microRNAs and siRNAs. These findings support that tsRNAs are involved in the global
control of small RNA silencing through differential Argonaute association, suggesting that small RNA-mediated gene regulation
may be even more finely regulated than previously realized.
Keywords: Argonaute; RNA interference; microRNAs
INTRODUCTION
RNAi-related small RNAs have emerged early during evolu-
tion, and have subsequently been adapted as guide RNAs in
a wide range of genome and gene regulatory pathways (for
review, see Zamore and Haley 2005; Ghildiyal and Zamore
2009). Different classes of small RNAs can be distinguished
by their size and structure, biogenesis, and often coupled to
this, function (for review, see Kim et al. 2009). Many of
them are 21–22 nucleotides (nt) long 59-phosphorylated,
29–39-hydroxylated small RNAs, a consequence of the Dicer
processing of bimolecular or intramolecular hairpin double-
stranded RNAs (dsRNAs). Size and end modifications are
also consistent with how they are bound by Argonaute family
proteins, which are at the core of small RNA effector
complexes (Lingel et al. 2003; Wang et al. 2008). Some small
RNAs, such as microRNAs in plants (Yu et al. 2005) and
Piwi-associated RNAs (piRNAs) in mammals (Kirino and
Mourelatos 2007), are further 29-O-methylated at the 39end,
which may stabilize them. Secondary siRNAs in RNAi of
Caenorhabditis elegans are 59-triphosphorylated (Pak and Fire
2007)—apparently, the result of short transcripts produced
by an RNA-dependent RNA polymerase (RdRP)—and are
loaded into specialized members of the Argonaute family
(Aoki et al. 2007).
Small RNA populations can also be classified based on
their biogenesis (for review, see Kim et al. 2009), particularly
according to their requirement for processing by the RNase
III-type endonucleases Drosha, as part of the Microproces-
sor complex together with DGCR8, and Dicer. This also al-
lows for distinguishing between three major classes of small
Reprint requests to: Mark A. Kay, Department of Pediatrics or
Department of Genetics, Stanford University, Stanford, CA 94305, USA;
e-mail: markay@stanford.edu; fax: (650) 498-6540.
Article published online ahead of print. Article and publication date are at
http://www.rnajournal.org/cgi/doi/10.1261/rna.2000810.
RNA (2010), 16:673–695. Published by Cold Spring Harbor Laboratory Press. Copyright Ó2010 RNA Society. 673
RNAs: microRNAs, siRNAs, and piRNAs. While in many
organisms microRNAs are generated through the sequential
cropping by Drosha and Dicer from precursors containing
an imperfect hairpin RNA, Drosha is dispensable for the
processing of siRNAs from typically long dsRNAs. piRNAs
are generated by a pathway that is less well defined, but that
is most likely Dicer and Drosha independent, and in the
case of primary piRNAs may not involve a dsRNA interme-
diate at all. In vertebrates, a combination of deep sequenc-
ing and bioinformatics has brought to light a number of
additional small RNA populations that either somewhat
blur the boundaries between the main classes or may even
constitute entirely separate classes of small RNAs (for re-
view, see Kim et al. 2009). Mirtrons, for example, appear to
be microRNAs in which pre-mRNA intron splicing sub-
stitutes for Drosha processing of pri-miRNAs (Berezikov
et al. 2007). Similarly, Babiarz et al. (2008) deep sequenced
small RNAs from mouse embryonic stem cells and found
Drosha/Microprocessor-independent small RNAs that were
apparently derived from precursor microRNA-like hairpins
termed endo-shRNAs. The same study also identified tRNAs
as a source of Microprocessor-independent, Dicer-dependent
small RNAs in mice. While the bioinformatic evidence that
these were bona fide RNAi-related small RNAs was strong
and supported by RNA secondary structure predictions, a
more-detailed molecular analysis is needed to better under-
stand the structure, biogenesis, and potential activity of
these novel small RNAs. It is also typical of these small
RNA sequencing projects that many, often 10%–20% of the
small RNAs sequenced, cannot be matched to the genome
(e.g., Azuma-Mukai et al. 2008). This raises the possibility
that new small RNA populations might have been missed.
Common to all these RNAi-related small RNA pathways
is the central role of Argonaute proteins (for review, see
Farazi et al. 2008; Hock and Meister 2008). Small RNAs get
loaded into Argonautes and guide them to their target
RNAs. In humans, there are eight Argonaute proteins: four
of the AGO clade, which are ubiquitously expressed, and
four of the PIWI clade, which are restricted to the germline
and function in the piRNA pathway (for review, see Seto
et al. 2007). While the reported Argonaute-associated
microRNA profiles do not immediately suggest functional
specialization of the four AGOs in mammals (Azuma-
Mukai et al. 2008; Ender et al. 2008), Argonaute 2 knockout
in mice is embryonic lethal (Liu et al. 2004). Further
genetic support of nonredundancy of Argonaute 2 comes
from the observation that Argonaute 2 knockout hemato-
poietic stem cells have defects in hematopoiesis (O’Carroll
et al. 2007). Although the most obvious difference between
Argonaute 2 and the other Argonautes is in its Slicer
activity (Liu et al. 2004), the hematopoiesis phenotype
could be rescued with a Slicer-deficient Argonaute 2 mu-
tant, which correlated with restored pre-microRNA pro-
cessing (O’Carroll et al. 2007). Only little is known about
the functions of human Argonautes 1, 3, and 4. Argonaute
1 has been described to be involved in transcriptional gene
silencing in humans (Janowski et al. 2006; Kim et al. 2006),
and the siRNA knockdown of Argonaute 4 impaired HDV
replication (Haussecker et al. 2008).
Small RNA sorting into the different Argonautes in mam-
mals could be due to coupling of small RNA biogenesis
with loading and/or preferences of the Argonaute loading
complexes for the particular structures of small RNAs or
their precursors. Examples for the latter are found in plants
where some Argonautes have preferences for certain 59
bases over others (Mi et al. 2008), in C. elegans where one
class of Argonautes specializes in binding triphosphorylated
RNAs (Aoki et al. 2007), and in D. melanogaster where the
fate of the small RNA is determined by the perfect or
imperfect double strandedness of the precursor Dicer
substrate (Tomari et al. 2007). It will be of interest to
determine whether there are additional small RNA pop-
ulations that are sorted according to and tightly coupled to
their biogenesis. This may be especially likely for single-
strand RNA-derived small RNAs that lack pronounced
precursor RNA secondary structures.
Considering these complex relationships between small
RNAs and the RNAi silencing apparatus, it is important to
identify and characterize all RNAi-related small RNAs. In
addition to potentially uncovering new classes of small
RNAs and their functions, novel modes of gene regulation
based on the functional interaction between classes of small
RNAs are also of interest.
The existence of such functional interactions in humans
is suggested by the demonstrated limited RNAi silencing
capacity of mammalian cells, which is subject to a number
of autoregulatory feedback regulations (Forman et al. 2008;
Han et al. 2009). As a result, RNAi-related competition
has been observed between experimentally introduced
si/shRNAs and endogenous microRNAs (Grimm et al.
2006), and also between Argonautes for a given small
RNA and/or their targets (Diederichs et al. 2008). Based on
our studies, we provide a model for how competition
between classes of small RNAs may account for the global
control of microRNAs, as have been observed in cancer
cells (Lu et al. 2005) and in response to changes in cell
densities (Hwang et al. 2009).
RESULTS
Small RNA screen uncovers 59-phosphate,
39-hydroxyl tRNA-derived small RNAs
In a previous study, we reported on the discovery of two
HDV small RNAs, 20–25 nt in length and with mRNA-
like cap structures (Haussecker et al. 2008). While the
antigenomic small RNA was only seen by 59-phosphate-
dependent semideep sequencing in an RNA preparation
enriched for 59-capped RNAs consistent with biochemical
analyses, a corresponding small RNA of genomic polarity
Haussecker et al.
674 RNA, Vol. 16, No. 4
was found with and without prior 59-cap enrichment.
Based on the hypothesis that this might be a reflection of
the function of this particular class of small RNAs, we set
out to discover cellular counterparts of the HDV small
RNAs through a Northern blot screen with probes target-
ing particularly those sequences that occurred in both the
59-cap-enriched and nonenriched samples (Fig. 1A; Sup-
plemental Table 1). Further selection criteria were a high
sequencing frequency to facilitate their subsequent analysis,
and not being annotated as obviously deriving from known
and abundant noncoding RNAs. The selected candidates
included a number of sequences without a perfect match to
the genome (nuclear or mitochondrial), as has also been
observed, but largely excluded from further analysis in pre-
vious small RNA sequencing studies (e.g., Azuma-Mukai
et al. 2008).
To screen for novel small RNAs based on their end
modifications, RNA from the human embryonic kidney cell
line HEK 293 was treated with the decapping enzyme
Tobacco Acid Phosphatase (TAP) and/or T4 RNA ligase.
While TAP removes 59caps, T4 RNA ligase can circularize
59-phosphorylated, 39-hydroxylated RNAs or ligate RNAs
that contain either of these end structures to each other in
trans. RNAs that have participated in these reactions are
marked by either a shift in their gel mobility or their
disappearance. In 44 of the 45 probes used in the screen,
including those directed at sequences for which no perfect
genomic match had been initially identified, RNAs with an
apparent size of 70–150 nt were readily detected (Supple-
mental Fig. 1). We note that probes with random sequences
do not recognize such RNAs under the experimental con-
ditions applied (data not shown). Based on their size and
apparent abundance, we expected that the detected RNAs
might include noncoding RNAs, such as members of the
tRNA, snoRNA, and snRNA families. We speculate that the
lack of perfect matches to the human genome for many of
the sequences could be due to post-transcriptional mod-
ifications (well characterized for numerous noncoding
RNAs) and consequent nucleotide changes as a result of
misincorporations during the reverse transcription step of
cDNA library preparation (Kawaji et al. 2008). A recent
analysis of apparent RNA sequencing errors strongly
supports this notion (Ebhardt et al. 2009).
None of the probes detected 20–25-nt small RNAs that
shifted upon TAP treatment, indicating a lack of prominent
capped small RNAs and that sequencing alone is not
sufficient to conclusively deduce end modifications. In-
stead, we noticed a number of T4 RNA ligase-sensitive
RNAs (Fig. 1A, the 12 candidates highlighted in bold;
Supplemental Fig. 1, highlighted in red) that, strikingly,
were in the 20–22-nt size range, the typical length of small
silencing RNAs. Many of the same probes also detected
a number of larger and smaller RNAs around the 20–22-nt
size range, which, however, were largely insensitive to T4
RNA ligase treatment (Fig. 1B, for salient examples, see
cand14, cand33) and varied in intensity from experiment to
experiment, consistent with these being T4 RNA ligase-
insensitive degradation products. The T4 RNA ligase-
sensitive small RNA detected with the probe directed at
candidate 45 (cand45) appeared to be distinct from the
other T4 RNA ligase-sensitive small RNAs in that its
intensity was comparable to that of its larger, z110-nt
counterpart (Fig. 1B). Further enzymatic analysis con-
firmed that these small RNAs, in notable contrast to the
T4 RNA ligase-insensitive RNAs, were indeed 59-phosphor-
ylated and 39-hydroxylated (Fig. 1C). Accordingly, similar
to a control 59-phosphorylated, 39-hydroxylated microRNA
(miR-20/cand22), treatment of all five accordingly investi-
gated candidates (cand14, cand23, cand33, cand35, cand45)
with the Terminator nuclease (Fig. 1C, lanes 4), an exo-
nuclease that degrades (unstructured) 59-phosphorylated
RNAs, selectively removed the T4 RNA ligase-sensitive
RNAs; 39-adapter ligation with an activated 39-adapter
and in the absence of ATP led to the disappearance of
the T4 RNA ligase-sensitive small RNAs (Fig. 1C, lanes 8),
as did treatment with polyA polymerase (Fig. 1C, lanes 11),
both of which are indicative of 39-hydroxyl ends.
Closer inspection of the T4 RNA ligase-sensitive se-
quences (Fig. 1A, in bold) strongly suggested that most, if
not all of these, were indeed tRNA-derived. First, eight out
of the 12 T4 RNA ligase-sensitive small RNA sequences
contained a tRNA-like ‘‘CCA’’ motif at their 39ends. Some
of the reported Dicer-dependent tsRNAs had similarly been
reported to be CCA-ylated at their 39ends (Babiarz et al.
2008). Second, when blasted manually, perfect genomic
matches could now be identified for candidates 11, 15, and
35 and were found to be derived from predicted tRNAs.
Cand22 was found to correspond to miR-20 and served as
a positive control in subsequent analyses. Moreover, in the
absence of a perfect genomic match, candidates 14 and 23
had initially been tentatively annotated as being derived
from human endogenous retroviral elements (HERV). This
is reminiscent of the human tRNA-derived RNAs reported
by Kawaji and colleagues, some of which appeared to be
misannotated as endogenous retroviral elements due to the
role that tRNAs play in the replicative priming of retrovi-
ruses and nucleotide misincorporations opposite of mod-
ified bases during the reverse transcription step of cDNA
library preparation (Kawaji et al. 2008).
Two types of tRNA-derived small RNAs
The absence of RNAs detected with probes directed toward
the antisense strand of the T4 RNA ligase-sensitive small
RNAs (data not shown) is consistent with the previous
suggestion (Babiarz et al. 2008) that imperfectly base-
paired tRNA stem structures, rather than paired sense-an-
tisense transcripts, were the substrates for Dicer processing.
We note that while Dicer-dependent tsRNAs had been
identified in mice, based on sequencing and bioinformatic
tRNA-derived small RNAs
www.rnajournal.org 675
FIGURE 1. (Legend on next page)
Haussecker et al.
676 RNA, Vol. 16, No. 4
prediction, their direct detection by alternative methods, as
well as further structural and functional analyses had been
lacking. Manual BLAST analysis of candidate 45 mapped its
59end to directly downstream from the discriminator base
of a predicted serine-tRNA, and ending in a short stretch of
uracils. This immediately suggested a Dicer-independent
mode of biogenesis in which the 59and 39ends are
determined by the tRNA processing enzyme RNaseZ, an
endonuclease leaving a 39-hydroxyl and 59-phosphate at the
cleavage site (Mayer et al. 2000), and transcription termi-
nation by RNA polymerase III, respectively. Accordingly,
we failed to detect a decrease in cand45 abundance either
when 293 cells were treated with Dicer siRNAs (although
insufficient Dicer knockdown could not be ruled out) (data
not shown), or in a HCT116-derived human colorectal
cancer cell line in which the Dicer helicase domain had
been mutated, leading to a decrease in most, albeit not all,
microRNAs (Fig. 2A; Cummins et al. 2006). In contrast,
treatment of an in vitro transcribed cand45 tRNA precursor
with recombinant RNaseZ yielded the predicted 39trailer
small RNA (Fig. 2B). Interestingly, at least in this assay, the
efficiency of 39processing was independent of whether the
precursor tRNA had been pretreated with RNaseP or not.
RNaseP is the enzyme that cleaves off the 59leaders of
precursor tRNAs and may be required for the functioning
of RNaseZ for at least some tRNAs (Nashimoto et al. 1999;
Dubrovsky et al. 2004). We will refer to this type of tsRNA
as type II tsRNA, as opposed to the Dicer-dependent type I
tsRNAs (see the model illustrated in Fig. 2C).
Removal of the 39trailers of nuclear encoded pre-tRNAs
by RNaseZ is thought to take place in the nucleus (Lund
and Dahlberg 1998). It is therefore notable that following
nuclear-cytoplasmic fractionation, essentially all detectable
cand45 tsRNA was recovered in the cytoplasmic fraction
(Fig. 3). We confirmed our fractionation results by exam-
ining the distribution of known RNA markers. In partic-
ular, both positive controls for nuclear RNAs tested,
snoRNA 38b and U6 snRNA, were almost entirely re-
stricted to the nuclear fraction. This suggests that cand45 is
either rapidly exported following RNaseZ cleavage or that
a population of cytosolic RNaseZ that has been described to
function as the effector endonuclease in a new type of gene
silencing guided by 59half-tRNAs (Elbarbary et al. 2009),
may be responsible for RNaseZ-dependent cand45 bio-
genesis in the cytoplasm. Like cand45, the four type I
tsRNAs that we investigated (cand14, cand20, cand23,
cand33), which could be identified by size and T4 RNA
ligase-sensitivity were each almost exclusively detected in
the cytoplasmic fraction and is consistent with cleavage by
cytoplasmic Dicer. Of note, while tsRNAs were absent from
the nuclear fraction, a portion of microRNAs was always
detected in the nucleus (Fig. 3, miR-20, let-7a), albeit at
generally lesser intensity than their cytoplasmic counter-
parts. This is consistent with other observations that
microRNAs can be readily detected in the nuclei of
mammalian cells (Hwang et al. 2007). More importantly,
however, the distinct fractionation patterns of microRNAs
and tsRNAs indicate that their intracellular distributions
differ.
tRNA-derived small RNAs have relative preference
for Argonaute 3–4 association
The interpretation of tsRNAs forming a distinct population
of small RNAs was also consistent with our analysis of the
interactions of tsRNAs and microRNAs with the small RNA
effector proteins Argonautes 1–4 and the microRNA factor
Mov10. To facilitate this analysis, FLAG-tagged versions
of the various proteins were expressed with comparable
efficiencies in 293 cells (Fig. 4A) so that associated small
RNAs could be immunoprecipitated with the same mono-
clonal FLAG antibody across all cell lysates. The use of
FLAG-tagged Argonautes in elucidating bona fide Argo-
naute function and small RNA association has been well
FIGURE 1. Small RNA Northern blot screen reveals a population of tRNA-derived 21–22-nt small RNAs that are 59-phosphorylated and
39-hydroxylated. (A) Northern blot screen candidate sequences. T4 RNA ligase-sensitive small RNAs in bold, except for known microRNA miR-20/
cand22, which is indicated by an asterisk (*); tRNA 39‘‘CCA’’ motif in italics; number of sequence hits in parentheses (out of 8554). (B)Northern
blot screen examples of z21–22-nt T4 RNA ligase-sensitive small RNAs (293 cell RNA). Ligase-sensitive small RNAs evidenced by either
disappearance and/or band shift (arrows). Cand22: 59-phosphorylated, 39-hydroxylated miR-20 (positive control); Cand14, Cand23, Cand33, and
Cand35: type I tsRNA examples; Cand45: type II tsRNA. Initial genomic annotation of the small RNAs shown below the blots; subsequent manual
blast revealed Cand35 and Cand45 to be derived from predicted tRNAs (in parentheses); still no perfect match could be identified for Cand14,
Cand23, and Cand33. TAP: tobacco acid pyrophosphatase; ligase: T4 RNA ligase; : untreated; +: treated; M: Decade (Ambion) RNA size marker.
(C) tsRNAs are 59-phosphorylated and 39-hydroxylated (Northern blot of diagnostic enzyme treatments). Two hundred ninety-three cell RNA was
treated with the following enzymes (potential activities described in parentheses), and enzyme susceptibility of the 21–22-nt small RNAs of interest
deduced by their shift in gel mobility and/or disappearance in the Northern blot: (1)buffer;(2) T4 polynucleotide kinase (PNK) +ATP
(59phosphorylation of 59-OH and 39dephosphorylation); (3) T4 PNK, then Terminator (degrades 59monophosphorylated, unstructured RNAs; PNK-
dependent RNA removal would indicate 59-OH RNAs); (4) Terminator; (5) T4 RNA ligase +ATP (for 59P-39OH RNAs: intramolecular
circularization; trans-ligation of RNAs containing either of these modifications); (6) TAP (hydrolyzes phosphoric acid anhydride bonds in
triphosphorylated and capped RNAs, leaving 59monophosphate), then T4 RNA ligase (TAP-dependent T4 RNA ligation would indicate 59cap or
59triphosphate); (7)TAP;(8) T4 RNA ligase, no ATP + activated 39-adapter oligo (adapter ligation would indicate 39OH); (9)T4PNK,thenT4RNA
ligase, no ATP + activated 39-adapter oligo (PNK-dependent adapter ligation would indicate either 39-P, or 29–39cyclic phosphate); (10)
39-phosphatase-negative T4 PNK, then T4 RNA ligase, no ATP + activated 39-adapter oligo (would confirm that a reaction in treatment ‘‘9’’ was
dependent on 39dephosphorylation by T4 PNK); (11) polyA polymerase (PAP; adds polyA to 39-hydroxyl RNAs); (12) buffer (same as 1). Blots were
stripped and rehybridized with the indicated probes. Arrows indicate 21–22-nt RNAs of interest; HERV: human endogenous retroviral element.
tRNA-derived small RNAs
www.rnajournal.org 677
FIGURE 2. RNaseZ-dependent, Dicer-independent cand45 biogenesis. (A) Cand45 expression is unchanged in a HCT116-derived cell line that
contains a mutation in the Dicer helicase domain. Most (e.g., miR-20 and miR-21), but not all (e.g., let-7a) microRNAs are down-regulated in this
cell line. wt: Parental HCT Dicer wild-type cell line; Dcr mut: HCT-derived Dicer helicase mutant cell line; T4: test for T4 RNA ligase sensitivity (:
untreated; +: treated). (B) In vitro RNaseZ/P processing of cand45 tRNA. A radioactively labeled, in vitro transcribed cand45 precursor tRNA was
treated with buffer alone (‘‘mock’’), recombinant human RNaseZ and/or purified human RNaseP. Arrows indicate that RNA was treated sequentially
with stated conditions. Reaction products (schematic for predicted fragments shown on the right) were visualized on a polyacrylamide gel. M:
Decade (Ambion) RNA size marker. (C) Model for tsRNA biogenesis: RNA polymerase III (Pol III) generates a precursor tRNA (1). The 59leader
and 39trailers are removed by RNaseP (2)andZ(3), respectively. The mature tRNA is then exported into the cytoplasm (4). There, Dicer recognizes
some, potentially misfolded tRNAs to produce Type I tsRNAs (5). The small RNA produced by nuclear RNaseZ cleavage and Pol III termination is
a Type II tsRNA. Based on the near-exclusive cytoplasmic localization of type II tsRNAs, it is possible that a cytoplasmic pool of RNaseZ is
responsible for the processing into type II tsRNAs of immature tRNAs have evaded nuclear quality control (data not shown).
validated in previous studies. Accordingly, such epitope-
tagged Argonautes cofractionate with their endogenously
expressed counterparts (Hock et al. 2007), no obvious
changes in the small RNA profiles were observed following
transient overexpression of a FLAG-tagged Argonaute 2
(Zhang et al. 2009), and no gross differences were noted
in small RNA immunoprecipitations with antibodies
against endogenous Argonautes when compared with
earlier studies immunoprecipitating FLAG-tagged Argo-
nautes (Azuma-Mukai et al. 2008; Ender et al. 2008). On
the other hand, overexpression experiments with similar
Argonaute constructs have been shown to result in com-
petition with endogenously expressed Argonaute function
(Diederichs et al. 2008). A conservative interpretation of
such Argonaute co-IP experiments would be, therefore,
that they illustrate the relative abilities of Argonautes to
load various small RNAs under conditions when they are
not limiting. FLAG-Gfp and cand8 served as negative
controls for nonspecific FLAG-protein interactions and
for non-T4 RNA ligase-sensitive small RNAs (i.e., small
RNAs presumably unrelated to RNAi), respectively.
All type I tsRNAs tested (cand14, cand20, cand23,
cand33) were readily immunoprecipitated with FLAG-
Argonautes 1–4, but could not be detected following
FLAG-Mov10 immunoprecipitation (Fig. 4B; Supplemental
Fig. 2). This is in contrast to the investigated microRNAs,
miR-20, miR-21, and let-7a, which coimmunoprecipitated
also with Mov10 (Fig. 4B; Supplemental Fig. 2), albeit to
a lesser extent than with the Argonautes. Interestingly, only
in the case of type I tsRNAs, there were, in addition to the
21–22-nt species identified in the original screen smaller,
T4 RNA ligase-sensitive (data not shown), 18–20-nt RNAs
detected with the same oligonucleotide probes that were
even more efficiently enriched in the Argonaute immuno-
precipitates. The type II tsRNA cand45 similarly coimmu-
noprecipitated with all Argonautes and could not be
detected following Mov10 immunoprecipitation. In this
case, however, no <20-nt species was enriched in the
immunoprecipitates. Moreover, unlike microRNAs, which
appeared to coimmunoprecipitate equally well with all the
Argonautes, cand45 associated more efficiently with Argo-
nautes 3 and 4 than with Argonautes 1 and 2 (Fig. 4B;
Supplemental Fig. 2). The same Argonaute 3–4 over
Argonaute 1–2 preference was observed when the cand45
sequence downstream from the predicted RNaseZ site was
replaced with two arbitrary sequences and expressed in 293
cells (Fig. 4C, Cand45-targ1, Cand45-targ2). This suggests
that the particular pathway/biogenesis, not the sequence
per se determines the Argonaute association pattern (see
Supplemental Fig. 3 for a graphical representation of the
FLAG-protein association patterns). We also tested tsRNA
association with a FLAG-tagged version of the hepatitis delta
virus antigen (HDAg) which we had reported to be associated
with both Mov10 and HDV small RNAs (Haussecker et al.
2008). Only very little tsRNAs were immunoprecipitated
with FLAG-HDAg (<5% of Ago4 immunoprecipitation)
suggesting that the tsRNA-associated Argonaute pool was
also distinct from the HDV-related small RNA pathway.
The FLAG-HDAg coimmunoprecipitation of microRNAs
20 and 21 could reflect its association with Mov10. We also
FIGURE 3. tsRNAs localize to the cytoplasm (Northern blot analysis of nuclear-cytoplasmic RNA fractionation). Sno38b and U6 snRNA serve as
nuclear markers. Equal amounts of nuclear and cytoplasmic RNA were loaded; blots were stripped and rehybridized. N: nuclear RNA fraction; C:
cytoplasmic RNA fraction; arrow: T4 RNA ligase (T4)-sensitive RNA of interest (: untreated; +: treated); M: Decade (Ambion) RNA size marker.
tRNA-derived small RNAs
www.rnajournal.org 679
FIGURE 4. tsRNA Argonaute coimmunoprecipitations. (A) FLAG-Argonautes and FLAG-MOV10 were expressed at similar levels in 293 cells
(Western blot); actin was used as a loading control. (B,C) Northern blot analysis of RNA coimmunoprecipitations with FLAG epitope-tagged Gfp
(negative control), human Argonautes 1–4 (A1–A4), Mov10 (M10), and either HDAg (B), or TRBP (C). Blots were stripped and rehybridized. (B)
tsRNAs associate with human Argonautes 1–4, but not MOV10. (C) Small RNAs that are generated from a cand45 tRNA expression system in
which cand45 had been replaced with the (arbitrary) sequences ‘‘targ1’’ and ‘‘targ2’’ preferentially associate with FLAG-Argonaute 3 and 4. Input:
RNA isolated from 10% lysate used per immunoprecipitation; IP: immunoprecipitated RNA; M: Decade (Ambion) RNA size marker.
note that small RNAs of z22 nt corresponding to cand6,
which detects a SINE-derived RNA, were significantly
enriched by Argonaute immunoprecipitation. Repetitive
elements are a known source of endo-siRNAs in mamma-
lian cells (Tam et al. 2008; Watanabe et al. 2008), and may
reflect yet another population of small RNAs associated
with Argonautes, but not Mov10. In summary, in addition
to the nuclear-cytoplasmic fractionation patterns, tsRNAs
are further differentiated from microRNAs by their appar-
ent lack of Mov10 association. Moreover, while our over-
expression studies may not quantitatively recapitulate the
normal distribution patterns of tsRNAs between the Argo-
nautes, they at the very least demonstrate a relative pro-
pensity of the type II tsRNA pathway for Argonaute 3–4
utilization.
Abundance and size of type II tsRNA-like small RNAs
are sensitive to Argonaute dosage
To search for additional cand45-like type II tsRNAs that
may have been generated via RNaseZ cleavage and RNA
polymerase III termination, we examined four candidates
in our small RNA database (cand193, cand401, cand500,
and cand520) that met the criteria of mapping to the 39
ends of predicted tRNAs and ending in a stretch of uracils
(Fig. 5A). However, unlike cand45, none of the 59ends for
these candidates coincided precisely with the predicted
major RNaseZ cleavage sites, with those of cand193,
cand401, and cand500 mapping slightly upstream of, and
that of cand520 downstream from, the RNaseZ site.
Northern blot analysis confirmed the existence of corre-
sponding small RNAs (Fig. 5B). Cand500 and cand520
were identified as Terminator-sensitive and therefore
59-phosphorylated small RNAs of 24–28 nt, while cand193
and cand401 yielded 59-phosphorylated 20–21-nt RNAs.
Like type I and II tsRNAs, cand45-like small RNAs were
predominantly localized to the cytoplasm (see Fig. 3 for
examples of cand500, cand520). As RNAi knockdown of
RNAi components to levels that affected the steady-state
abundance of microRNAs proved challenging in 293 cells
(data not shown), we sought to investigate the relationship
between RNAi and tsRNA pathways by testing the effect of
overexpressing Dicer, Ago1–Ago4, and Mov10 on small
RNA abundance. Interestingly, all four cand45-like small
RNAs were affected when overexpressing Argonautes 1–4
(Fig. 5B). Accordingly, Argonaute overexpression robustly
increased the abundances of the 20–21-nt long cand193
and cand401 RNAs, by z20-fold in the case of Argonaute 3
overexpression, which showed the strongest effect. In
contrast, while the abundances of the 24–28-nt cand500
and cand520 RNAs were essentially unchanged, Argonaute
overexpression triggered the appearance of 21–23-nt RNAs
that were readily detected by the same probes and were of
higher abundance than the uninduced longer counterparts.
One possible explanation may be that the proximity of
Argonautes with tRNA 39processing allowed Argonautes,
acting as molecular rulers (Wang et al. 2008), to selectively
capture and stabilize the tsRNAs. This is consistent with the
observation that although both the induced shorter and
noninduced longer cand45-like small RNAs coimmuno-
precipitated with Argonautes (but not Mov10), the process
was more efficient for the induced species (Supplemental
Fig. 2, cand520, arrow b; data not shown). Alternatively,
the induced species may be the result of a catalytic activity
of Argonautes upstream of target cleavage in the RNAi
pathway, as has been suggested for Argonaute 2 (Diederichs
and Haber 2007; O’Carroll et al. 2007). Importantly, the
abundance of cand45 itself was not affected by Argonaute
overexpressions, as was the case for microRNAs 20 and 21
and the bioinformatically predicted endo-shRNAs 320 and
484 (Babiarz et al. 2008), arguing that these are already
efficiently incorporated into Argonautes at physiological
expression levels (for a graphical representation of the
relative changes in small RNA abundances following
RNAi-related protein overexpression see Supplemental
Fig. 4). It will be interesting to test whether the differences
in Argonaute responsiveness is determined by whether or
not the 59end of the tRNA trailer-derived small RNAs
precisely coincides with the predicted major RNaseZ
cleavage site.
Differential trans-silencing capacity of type I
and type II tsRNAs
The post-transcriptional trans-silencing capacity of tsRNAs
was tested using standard reporter assays (Fig. 6). Specif-
ically, target sites complementary to the type I and II tsRNA
cand14 and cand45, respectively, were inserted into the 39
UTR of a Renilla luciferase reporter gene. These constructs
were then transfected into tissue culture cells expressing the
tsRNAs. Renilla luciferase activity was normalized for the
luminescence of a firefly luciferase reporter gene on the same
plasmid, as well as for the Renilla-Firefly ratio of a second
plasmid that lacked a tsRNA target site at the correspond-
ing position of the Renilla 39UTR. Modest cand14 trans-
silencing capacity was deduced based on the z30%–40%
increase in Renilla activity when cells were treated with a
cand14 antisense oligonucleotide, compared to all four neg-
ative control (antisense) oligonucleotides tested (P< 0.01)
(Fig. 6A). It is possible that the trans-silencing capacity of
cand14 is inherently modest, perhaps reflecting preferential
Ago3–Ago4 over Ago1–Ago2 interaction (Fig. 4B). It is,
however, also possible that the extent of the silencing was
limited either due to the specific context of the reporter or
as the target site might not have been entirely complemen-
tary to cand14, based on the absence of a perfect match in
the genome for cand14. Similarly, since simple antisense
inhibition of small RNAs, however, may not necessarily be
the most efficient way of antagonizing their activities (see
Fig. 8B, below, for an example of let-7a), we cannot be
tRNA-derived small RNAs
www.rnajournal.org 681
certain that the antisense-dependent up-regulation reflects
the full degree of cand14-mediated trans silencing. In sum-
mary, cand14 exhibits canonical microRNA-/siRNA-like
trans-silencing capacity.
In contrast to the type I tsRNA cand14, cand45 did not
exhibit apparent trans-silencing activity (Fig. 6C). Even
when Argonautes were overexpressed (Fig. 6E), there was
no strong cand45 antisense-reversible trans-silencing, al-
though Argonaute 2 overexpression caused a small 20%–
30% reduction in reporter gene activity in some data sets,
which was reversed by an oligonucleotide antisense to
cand45 (e.g., Supplemental Fig. 5). We reasoned that by
overexpressing cand45 we would be able to achieve cand45-
dependent gene silencing. For this, a cloned version of the
cand45 tRNA was transfected into HCT116 cells and
cand45 overexpression confirmed by Northern blot (Fig.
6B). Nevertheless, the cotransfected Renilla luciferase re-
porter was still not silenced (Fig. 6C). Unexpectedly, when
a cand45 antisense oligonucleotide was added (100 nM),
originally intended to relieve any cand45-mediated trans-
silencing, there was a robust induction of cand45-Renilla
luciferase silencing that was further responsive to the
number of target sites in the reporter (an over 80% de-
crease with two target sites, and a 65% decrease with one
target site; Supplemental Fig. 6). The gene knockdown did
not depend on the exact antisense modification chemistry
FIGURE 5. Investigation of Cand45-like small RNAs. (A) Selected Cand45-like candidate sequences (in red) with predicted RNaseZ cleavage sites
(‘‘Z’’). Shown are the sequences of the tRNA 39ends and the RNA polymerase III termination region. (B) Cand45-like small RNA candidate
expression analysis (Northern blot). Cand45-like small RNAs can be detected as discrete 21–28-nt small RNAs and are modulated by Argonaute
overexpression. Gfp (negative control), Dicer, Ago1–Ago4, Mov10: transfected expression plasmids. Terminator treatment (‘‘TER’’; : untreated; +:
treated) was used to determine the 59-phosphorylation status of cand45-like small RNA candidates. In these blots, the amount of ‘‘+/’’
Terminator-treated Argonaute 4-associated RNA loaded was half that of the other samples. M: Decade (Ambion) RNA size marker.
Haussecker et al.
682 RNA, Vol. 16, No. 4
as a fully 29-O-methylated oligonucleotide worked at least
as efficiently as the original chemistry which contained
unmodified as well as a mix of LNA and 29-O-methyl
modified bases (Fig. 6F; Supplemental Fig. 7). In the case of
the fully 29-O-methylated cand45 antisense, a slight, z25%,
reduction in target reporter gene activity was already
observed in the absence of cand45 overexpression. Similar
results, including the observation that sense DNA oligos do
not induce such silencing, were obtained with mouse
embryonic fibroblast cells, thereby excluding this to be
a human-specific phenomenon or a peculiarity of the 293
cell line (Supplemental Fig. 8). This response, in which an
oligonucleotide sense to the target gene induces gene
knockdown, was quite distinct from our own experience
(data not shown) and that of many others in the literature
where antisense oligos against RNAi-related small RNAs,
such as microRNAs, relieve target gene repression. We there-
fore refer to this phenomenon as ‘‘sense-induced trans-
silencing’’ (SITS). The specificity of SITS was confirmed by
the use of three additional control oligonucleotides (Fig. 6D).
Cand45 antisense-mediated gene knockdown was more-
over RNAi-related as it could be modulated by Argonaute
overexpression (Fig. 6E) similar to how Argonaute over-
expressions affect the silencing of perfectly complementary
small RNA target genes (Diederichs et al. 2008): Argonaute
2 enhanced the anti-45 knockdown effect (to >90% si-
lencing), while the nonslicing Argonautes 1, 3, and 4 each
relieved it (to z50%–55% silencing), probably by compe-
tition with Argonaute 2 for either the target site and/or
small RNA.
Argonaute 2 uniquely selects for perfectly
complementary dsRNA of ;21 base pairs
To elucidate the mechanism of SITS, we considered
potential changes in Argonaute loading following sense
oligo addition. Both the original cand45 tsRNA and
a cand45 version extended by 2 nt at its 59end were tested
in combination with various complementary sense oligo-
nucleotides, differing slightly in the double-strand RNA
FIGURE 6. Trans-silencing capacity of tsRNAs (dual luciferase assay). (A) Cand14-mediated trans-silencing. Dual luciferase assay with the
Renilla luciferase reporter gene carrying a fully cand14-complementary target site in its 39UTR (psi-cand14). Addition of a cand14 antisense
molecule increased Renilla luciferase expression, as expected, if cand14 had RNAi-like trans-silencing capacity. Likewise, overexpression of Ago2
enhanced cand14-mediated trans-silencing. The specificity of the de-repression with anti-cand14 was confirmed with three (antisense) control
oligonucleotides (anti-con1, anti-con2, anti-con3). (B) Cand45 overexpression from a plasmid into which the genomic sequence of cand45 had
been cloned (cand45-45; by Northern blot). Cand45-empty: cand45 cloning plasmid with only a cloning site between the cand45 RNaseZ cleavage
site and the RNA PolIII terminator; cand45-con: cand45-derived expression plasmid in which the cand45 sequence in cand45-45 was replaced
with an arbitrary control sequence; M: Decade (Ambion) RNA size marker. (C) Cand45 overexpression (cand45-45)-dependent, anti-cand45
oligo-induced trans-silencing in HCT116 cells. Dual luciferase assay with reporter gene carrying a fully cand45-complementary target site in the
Renilla luciferase 39UTR (psi-cand45). Cand45-empty, cand45-con, cand45-45 as in C.(D) Confirmation of the specificity of the anti-cand45
induced trans-silencing effect in panel Dby the use of three additional (antisense) control oligonucleotides (anti-con1, anti-con2, anti-con3). (E)
Anti-cand45 induced trans-silencing is RNAi-related. Cand45 overexpression (cand45-45)-dependent, anti-cand45 (‘‘anti-45’’)-induced trans-
silencing is enhanced by overexpression of slicing-competent Argonaute 2, but mitigated by overexpression of the nonslicing Argonautes 1, 3, and
4. (F) Predicted cand45:anti-cand45 duplex; A.U.: arbitrary units; error bars indicate standard deviation from n= 3 transfections.
tRNA-derived small RNAs
www.rnajournal.org 683
structure that would be reconstituted (Fig. 7; Supplemental
Fig. 9). Strikingly, and in agreement with the notion that
Ago2-loaded small RNAs are the main effectors of the trans
silencing of perfect complementary target genes, the addi-
tion of all complementary sense oligonucleotides enhanced
Ago2 loading by two- to fourfold. By contrast, Ago3 and
Ago4 loading, which was very efficient for the single-
stranded cand45 (z50% on input was immunoprecipi-
tated) was not further enhanced by sense oligo addition,
and in some cases appeared to be slightly impaired by it.
Ago1 was somewhat intermediate with no, or slightly
enhanced loading following sense oligonucleotide addition.
Of note, the sense oligonucleotides that enhanced Ago2
loading in this experiment were fully 29-O-methylated. As
such a modification pattern would be predicted to interfere
with passenger strand cleavage by Ago2 (Leuschner et al.
2006), our results suggest that the relative ability of Ago2
for loading fully duplexed small RNAs is independent of its
Slicer activity. These findings are consistent with the
relative Ago-association patterns observed for microRNAs
and tsRNAs and suggest a rule whereby the degree of
complementarity of the small RNA loading substrate de-
termines the efficiency with which it is loaded onto the
various Argonautes: extensively duplexed small RNAs into
preferentially Ago2, and somewhat Ago1, and less stably
duplexed and single-stranded RNAs into Ago3 and Ago4
(see Table 2 below). While double-strandedness appeared
to be the main determinant for Ago2 loading and SITS
efficiency, a more extensive screen of guide strand-sense
oligo combinations revealed some differences in SITS ef-
ficiencies depending on the exact duplex structure (Sup-
plemental Fig. 9). Although the nature of 59and 39over-
hangs could significantly impact SITS, SITS efficiency only
poorly correlated with siRNA design rules, such as 2-nt 39
overhangs. The length of the guide strand, however, had
a more obvious impact on SITS efficiency with 20- and
22-nt guides functioning better than 18- and 24-nt guides.
Interestingly, Argonaute 2 appeared to discriminate against
guide RNAs of unusual length through its PAZ domain, as
deleting the PAZ domain of Ago2 conferred onto it the
ability to immunoprecipitate cand45-derived small RNAs
of various sizes (Fig. 7A, Ago2, delta PAZ). This further
correlated with impaired Ago loading, in the case of the
original 20-nt cand45 loss of sense-enhanced Ago loading,
and ultimately SITS efficiency. To exclude that the hetero-
geneous small RNAs isolated with the Ago2 PAZ mutant
was an experimental artifact as a result of the fact that the
PAZ domain binds the 39end of the guide RNA (Lingel
et al. 2003) and the absence of the PAZ domain might
render a bound small RNA susceptible to RNase degrada-
tion, we rehybridized the blot for endogenous microRNAs.
This showed that such an artifact was unlikely since only
single microRNA bands were observed, while microRNA
association was similarly diminished in the PAZ deletion
mutant. The Argonaute distributions of microRNAs were
largely unaffected in the presence of SITS. Interestingly,
however, in a number of instances there was a noticeable
decrease in Ago2 association, potentially the result of
competition between the SITS guide RNA and microRNAs
for Ago2 (Fig. 7B, down arrows).
tsRNA levels correlate with microRNA and siRNA
silencing activities
To further test whether tsRNAs could affect the function
of other classes of small RNAs, we sought to evaluate
microRNA and siRNA silencing activity following the mod-
ulation of tsRNA levels. To find conditions under which
tsRNA levels may be changed, we took two approaches.
One was based on changing the serum concentration in the
cell growth media since tRNA transcription rates had been
linked cell proliferation (for review, see Marshall and White
2008). Alternatively, we overexpressed the RNA polymerase
III transcription factor Brf 1 that had been found to
specifically up-regulate tRNA transcription in mouse cells
(Marshall et al. 2008). Transient Brf 1 overexpression in
293 cells led to a 1.5–2.5-fold increase of tsRNAs cand45
and cand520 (Fig. 8A). At the same time, there was
a tendency for microRNAs to be down-regulated. Increas-
ing the serum concentration from 1.5% to 10% had
a similar effect on relative small RNA levels: tsRNA cand45
and cand520 were increased at high serum concentrations,
while microRNAs were largely unchanged (Fig. 8A), the
latter finding being consistent with what had been reported
for microRNA levels of subconfluent, serum-starved cells
(Hwang et al. 2009). We note that the serum experiments
were performed in HCT cells as these proved to be more
resistant to outwardly adverse effects of low serum condi-
tions. In both cases, changes in the levels of the type I
tsRNA cand14 and cand33 were not consistently observed,
although it is possible that some type I tsRNAs not tested
for were elevated (data not shown).
We next assessed whether small RNA silencing activity
was changed with Brf 1 overexpression or changes in serum
concentrations. Depending on the type of competition
between tsRNAs and other small RNAs, we would expect
the outcome of such experiments to be quite complex. For
example, increased tsRNAs would primarily compete with
other small RNAs for Ago3 and Ago4 incorporation. The
Argonaute distributions of these small RNAs may therefore
be shifted toward Ago1 and Ago2, the degree of which,
however, would depend on the relative Argonaute affinities
and abundances of each particular small RNA. Since
tsRNAs will also compete with other small RNAs for
Ago1 and Ago2, the net effect of such a redistribution
may be muted. In this way, Ago3 and Ago4 may serve as
buffers ensuring, e.g., relatively constant microRNA occu-
pancies of Ago1 and Ago2, which may be particularly
important for their function. It is also possible that tsRNAs
interact with the RNAi machinery upstream of Argonautes,
Haussecker et al.
684 RNA, Vol. 16, No. 4
FIGURE 7. Sense-induced trans-silencing due to preferential loading by Argonaute 2, but not by Argonautes 3 and 4 of the reconstituted double-
stranded RNA. (A) Cand45-Argonaute coimmunoprecipitation before and after addition of cand45-complementary sense oligonucleotides
(Northern blot; HCT116 cells). FLAG-Gfp and FLAG-Agos used in IPs indicated for each row; ‘‘Ago2, deltaPAZ’’ is a PAZ-deletion mutant of
Ago2. Predicted structures of overexpressed cand45 and (29-O-methyl) complementary oligonucleotides indicated with red (cand45) and black
lines (sense); the green line marks the 2-nt 59extension of a cand45-derivative (‘‘cand45 + 2’’). Arrows indicated cand45 of interest, a double
asterisk (**) indicates the results of cross-hybridization of the probe with the transfected sense oligonucleotides; and asterisk (*) marks an input
that was incorrectly loaded (correct input requantitated based on separate experiment). For each input/IP pair, the knockdown efficiency is
indicated below (‘‘kd,’’ 100 = no knockdown; summary shown in Fig. 2C) showing correlation between Ago2 IP and silencing efficiencies. Blots
were stripped and rehybridized with microRNAs let-7a and miR-20; input: RNA isolated from 10% lysate used per immunoprecipitation. (B)
Cand45-AgoIP efficiencies (phosphorimage quantitations of A). Down arrows indicate instances where microRNA-Ago2 associations are reduced
under conditions in which cand45-Ago2 associations are increased. (C) Summary of sense-induced trans-silencing results corresponding to the
cand45-Ago IP experiment shown in Figure 2A,B (dual luciferase assay with reporter ‘‘psi-cand45wt 2x’’). Color scheme as in B.
FIGURE 8. Increased tsRNA abundance correlates with reduction and increase in microRNA and siRNA efficacies, respectively. (A) tsRNA
abundance can be modulated by varying serum concentrations or overexpressing the tRNA transcription factor Brf1 (Northern blot; cor-
responding U6snRNA-normalized phosphorimage quantitations shown below). Blots were stripped and rehybridized. Total RNA from 293
cells was harvested on day 4 after Brf1 transfections on days 0 and 2. For the serum experiments, HCT116 cells cultured for 5 d under 1.5% or
10% serum were chosen. (B, i) MicroRNA silencing capacity is reduced in the presence of increased tsRNA abundance (dual luciferase assay). The
target sites of the Renilla luciferase reporters are indicated with ‘‘c.14’’ (cand14) on the X-axis; PM/MM: perfect match/translational reporters.
Results are normalized to the Renilla/Firefly ratios of reporter plasmid with no predicted small RNA target site (‘‘bantam’’), with 1.5% serum and
control pcDNA3Tempty set at 100 for each reporter. (B, ii) Silencing efficiency of translational psi-let-7aMM reporter as indicated by let-7a
inhibition (dual luciferase assay). anti-Dharm miR-20: control microRNA hairpin inhibitor; anti-Dharm let7a: let7a hairpin inhibitor; let-7a
antisense inhibitor. ‘‘anti-Dharm let-7a’’ where most apparent let-7a inhibition was observed was set = 100. (C) SiRNA silencing is improved in
the presence of increased tsRNA abundance (real-time qRT-PCR). Three different siRNAs (si-1–si-3) targeting endogenously expressed RALY
RNA were transfected at two concentrations, 500 pM and 50 nM and remaining RALY RNA levels normalized to actin measured.
686 RNA, Vol. 16, No. 4
which in turn may make them more available for small
RNAs that enter RNAi at the Argonaute stage, e.g.,
synthetic siRNAs. As a final example of the potentially
complex functional outcomes of modulating small RNA
levels, although the absolute abundance of a given small
RNA may be increased, if it has a higher affinity for the less
efficiently silencing Argonautes 3 and 4 and there was
competition for target sites, then overall silencing may also
be inhibited (both cleavage and translational silencing
pathways).
Brf 1 was overexpressed in 293 cells and this was
followed by the introduction of various Renilla luciferase
reporter genes that only differed in their small RNA target
sites located in the 39UTRs. Firefly luciferase on the same
plasmid and a Renilla luciferase construct containing mock
target sites were used for normalization. There was no or
little effect of Brf 1 overexpression on the type I cand14,
type I cand33, and type II cand45 reporters, consistent with
no changes and/or preferential Ago3 and Ago4 incorpora-
tion for these tsRNAs. For the microRNA reporters we
chose let-7a and miR-20. For each microRNA, two re-
porters were constructed: one version with three tandem
perfect complementary target sites (‘‘PM’’) for assessing
slicing activity, and a corresponding translational reporter
version with complementarity for the microRNA seeds, but
mismatched downstream thereof, including at positions
10 and 11 which is predicted to abrogate Ago2 slicing
(‘‘MM’’). Unlike the tsRNA reporters, both let-7 reporters
were de-repressed by z2.5-fold in the presence of increased
tRNA transcription factor Brf 1 (Fig. 8B), while let-7a
steady-state levels were not significantly changed (Fig. 8A).
This result is consistent with tsRNAs modulating let-7
silencing activity. The miR-20 reporters were slightly
affected by Brf-1 overexpression with a z50% increase
for miR-20PM, and none for miR-20MM. As discussed
above, such differences between reporters for different
microRNAs could be due to various factors, such as pos-
sible differences in loading efficiencies, absolute abundances
and dose sensitivities of the reporter genes. Increased
tsRNA levels in the presence of higher serum concentra-
tions were accompanied by ztwofold de-repressions of
both let-7a and miR-20 perfect match reporters, whereas
the corresponding translational reporters that differed from
the perfect match reporters by only a few nucleotides were
unaffected (Fig. 8B). To exclude that inefficient silencing of
the translational microRNA reporters in HCT cells was
responsible for lack of de-repression in 10% serum, we
cotransfected a let-7a antisense inhibitor and observed
az75% up-regulation of the reporter gene activity. In-
terestingly, this simple antisense-mediated inhibition of
let-7a underestimated the true extent of let-7a translational
repression of the reporter, as the addition of a type of
microRNA inhibitor with a region complementary to the
microRNA flanked on both sides by small hairpins and that
had been reported to be more efficient than simple anti-
sense for microRNA inhibition (Vermeulen et al. 2007),
increased reporter gene activity by over fivefold compared to
a control inhibitor directed against miR-20 (Fig. 8B, ii). We
conclude that the lack of up-regulation of the translational
microRNA reporters was not due to their inefficient response
to microRNAs. We speculate that given the little changed
steady-state level of let-7a at 1.5% versus 10% serum, the
difference between the PM and MM reporters is due to a
redistribution of let-7a between the Argonautes (more in
Ago2 at 1% than 10%, which is predicted to mainly affect
PM, and not MM reporters).
To test the effect of Brf-1 overexpression on siRNA
efficacy, we transfected three different siRNAs that were
directed against the endogenously expressed gene RALY
both at a low (500 pM) and a high (50 nM) concentration,
and then measured RALY mRNA levels by qRT-PCR (Fig.
8C). ‘‘No siRNA’’ and actin mRNA served for control and
normalization purposes, respectively. As expected and in
support of the sensitivity of the assay, in each case increased
siRNA concentrations more effectively silenced RALY un-
der standard tissue culture conditions of 10% serum. Inter-
estingly, Brf1 overexpression in 293 cells increased siRNA
efficacy. In the case of RALY siRNA 3, the fold knockdown
was increased from about two- to fourfold at the low, and
from about 2.5- to fivefold at the high siRNA concentra-
tion. It is unlikely that this is due to Brf 1 increasing
transfection efficiency, because (1) plasmid DNA trans-
fection was not affected by Brf1 overexpression based on no
significant changes in nontargeted firefly luciferase expres-
sion (data not shown) and (2) silencing at 500 pM of
siRNA 3 with Brf 1 overexpression exceeded its perfor-
mance at the 100-fold higher concentration of 50 nM in the
absence of Brf 1 overexpression. Instead, we speculate that
Brf 1 overexpression further shifts incorporation of the
perfectly duplexed siRNA into Ago2 relative to the other
Argonautes resulting in reduced competition for the target
mRNA. The results are also consistent with tsRNAs com-
peting for components of small RNA silencing upstream of
Argonaute loading, thus increasing the availability of
Argonautes for the siRNAs. Essentially the same increase
in siRNA silencing efficiency was observed in HCT cells
when raising serum concentrations from 1% to 10% (Fig.
8B), strengthening the notion that these effects were
mediated by tsRNAs and not other changes taking place
in the presence of Brf1 overexpression or variations in
serum concentrations.
DISCUSSION
Our discovery that there exists in mammals a class of
tRNA-derived small RNAs that interacts with the RNAi
machinery prompted investigations that contribute to our
nascent understanding of the differential properties of the
four human Argonautes. Since tsRNAs are not well con-
served on a sequence level, yet are observed from yeast to
www.rnajournal.org 687
tRNA-derived small RNAs
Man (Girard et al. 2006; Babiarz et al. 2008; Buhler et al.
2008), we introduce the concept of how the function of one
class of naturally occurring small RNAs may be used to
regulate the global activity of another class of small RNAs.
Global suppression of microRNA abundance and function
has been noted for proliferative diseases such as cancer (Lu
et al. 2005) and in response to changes in cell densities
(Hwang et al. 2009). It will be of interest to test whether
these phenomena converge on signaling pathways regulat-
ing the expression of tsRNAs. A general, but modest
decrease of microRNA abundance, as seen in cancer (Lu
et al. 2005), may be explained by increased turnover of
microRNAs that cannot be loaded when increased levels of
tsRNAs are present. Indeed, increased tRNA transcription
rates and steady-state levels have been linked to cancer
(Marshall and White 2008; Pavon-Eternod et al. 2009).
Given the critical roles of microRNAs in cancer (Iorio and
Croce 2009), it is tempting to speculate that the outcome of
such competition between tsRNAs and microRNAs may at
least partly explain the link between tRNA overexpression
and cancer. In fact, modest changes in steady-state levels
of microRNAs could actually mask still more significant
functional differences given that competition would involve
four, also biochemically distinct, Argonaute proteins in
humans. This concept of small RNA class competition, cor-
roborated by our own studies on microRNA and synthetic
siRNA efficacies under conditions of varying tsRNA con-
centrations, is also based on the well-documented limited
capacity of RNA silencing, which is subject to autoregula-
tory feedback and in which Argonautes compete with each
other for small RNAs and targets (Grimm et al. 2006;
Diederichs et al. 2008; Forman et al. 2008; Han et al. 2009).
Clearly, for this reason alone, it is important to identify and
characterize all RNAs that interface with the RNA silencing
pathways, particularly many of the small RNAs that had
previously been sequenced, but have largely been ignored as
degradation products of abundant RNA of no particular
functional consequence, even when found to coimmuno-
precipitate with Argonaute and Piwi proteins. The inability
to detect many of them as distinct 21–22-nt small RNAs in
conventional Northern blots and to match a large number
of them to the genome, recently found to be largely the
result of RNA modifications common to highly abundant
RNA (Ebhardt et al. 2009), may have contributed to this
neglect. Careful bioinformatic analyses, however, have
started to reveal that some of the small RNAs derived from
abundant noncoding RNAs, particularly tRNAs, are the
product of specific processing by endonucleases such as
Dicer (Babiarz et al. 2008; Cole et al. 2009).
Additional evidence for competition between tsRNAs
and other classes of small RNAs not only in humans comes
from the observation that the loss of DGCR8 and Dicer in
mouse embryonic stem cells was accompanied by increased
tsRNA levels (Babiarz et al. 2008). In fission yeast, deletion
of a component of an RNA turnover complex was as-
sociated with an increase in tRNA- and rRNA-derived
small RNAs that were bound to Argonaute (Buhler et al.
2008). The fact that only little tsRNA was bound to
Argonaute in fission yeast may reflect the existence of only
one Argonaute protein in this organism. It therefore lacks
other Argonautes that could buffer the major functional
Argonaute from unwanted small RNAs. That a similar
interaction between exosome RNA turnover and RNAi may
also exist in mammals is suggested by the observation that
elevated beta-globin gene cluster intergenic transcription
following Dicer knockdown was particularly noted in cells
treated with trichostatin A, a histone deacetylase inhibitor
(Haussecker and Proudfoot 2005). As the global increase in
histone acetylation is predicted to globally increase inter-
genic transcription, this may overwhelm other RNA turn-
over mechanisms and make these transcripts increasingly
accessible for RNAi-related turnover.
The functional consequence of such competition is
predicted to be quite complex, particularly in organisms
with multiple Argonautes each with slightly different
expression patterns and relative specificities for the differ-
ent classes of small RNAs and even for different small RNAs
within a class. Moreover, as shown here, competition
between classes of small RNAs may also be a dynamic
property depending on the physiologic state of the cell.
tsRNAs differ in a number of respects from microRNAs
and can be grouped into two subclasses based on differ-
ences in biogenesis and biological activity (Table 1). We
demonstrate here that the Microprocessor-independent,
Dicer-dependent type I tsRNAs, when appropriately pre-
treated, can in fact be observed as distinct 59-phosphory-
lated, 39-hydroxylated small RNAs that are incorporated
into Argonautes and have trans-silencing capacity. Unlike
microRNAs, however, neither tsRNA subclass associated
with Mov10 and tsRNAs were essentially restricted to the
cytoplasm. Type II tsRNAs, as exemplified by cand45, are
generated by RNaseZ cleavage at the discriminator base of
tRNAs to generate the phosphorylated 59end and by RNA
polymerase III termination leaving a stretch of uracils at the
39end. As these processes are thought to occur in the
nucleus and quality control mechanisms exist to ensure
that only properly processed, mature tRNAs are exported
(Lund and Dahlberg 1998), this suggests type II tsRNAs to
be efficiently exported following synthesis. Since some
Argonautes, like microRNAs (Hwang et al. 2007), have
been demonstrated in the nuclei of mammalian cells (e.g.,
Rudel et al. 2008) and are able to shuttle between the
nucleus and cytoplasm (Guang et al. 2008; Weinmann et al.
2009), Argonautes themselves may be responsible for the
export and cytoplasmic localization of type II tsRNAs,
possibly through their association with the tsRNAs soon
after RNA polymerase III transcription termination. Alter-
natively, type II precursor tRNAs may escape nuclear
quality control and are processed by the less well-defined
pool of cytoplasmic RNaseZ (Elbarbary et al. 2009).
Haussecker et al.
688 RNA, Vol. 16, No. 4
Overlap between various noncoding RNA biogenesis
pathways is not uncommon. In this regard, the type II
tsRNAs are reminiscent of the RNaseZ-mediated separation
of dicistronic RNAs into upstream tRNAs and downstream
snoRNAs in plants (Kruszka et al. 2003). RNaseZ has also
been recently reported to act on the nascent long non-
coding human MALAT1 precursor RNA (Wilusz et al.
2008), thereby generating the mature 39end of MALAT1
RNA and liberating a downstream cytoplasmic tRNA-like
small RNA. The only relatively recently discovered RNaseZ
may therefore function in a much wider array of biological
pathways than previously anticipated. A link between
snoRNA and microRNA biogenesis was established by
Ender and colleagues who described a human gene origi-
nally thought to function only as a snoRNA, but that was
then found to be also processed in a Microprocessor-
independent, Dicer-dependent manner into an Argonaute-
associated silencing small RNA (Ender et al. 2008). Overall,
the evolution of small RNA biology appears to be highly
experimental and flexible in that various mechanisms that
can generate hairpins and/or 59-phosphorylated small
RNAs may all enter into RNAi-related pathways.
Although it remains to be elucidated why exactly
Argonaute 2 is genetically the most important Argonaute
for mammalian cell viability, its importance may also be
reflected in the relatively high molecular selectivity of guide
RNA loading (Table 2). Both the Argonaute distribution of
microRNAs and tsRNA and the mechanism of action of
the sense-induced trans-silencing phenomenon show that
Argonaute 2 has a preference for 20–22 base-pair (bp),
fully duplexed dsRNAs relative to the other Argonautes.
Deletion studies further indicated that the PAZ domain
contributes to this size and structural selectivity. By
contrast, particularly Argonautes 3 and 4, which lack slicing
capacity and have intrinsically less translational silencing
capacity (Su et al. 2009), may act as buffers soaking up
unstructured, especially small single-stranded RNAs. They
may thus serve to protect the cells from adventitious
degradation products, therefore preventing them from
having widespread impact on cellular gene expression
through guiding off-targeting. This property of Argonautes
3 and 4 is also of interest for the application of single-
stranded RNAs to induce RNAi (ssRNAi), since as the
cand45 example shows, the mere presence of a small
59-phosphorylated RNA is not sufficient for effective trans-
silencing. Because RNAi can be elicited by the transfection
of single-stranded RNAs (Martinez et al. 2002), small RNA
biogenesis may also play a role in determining the small
RNA Argonaute distribution pattern. The germline-restricted
(primary) piRNAs are another example of a small RNA
population that is apparently generated from single-stranded
precursor RNAs with no obvious secondary structures via
an unknown mechanism that, however, also does not
seem to involve Dicer (Vagin et al. 2006), yet loads into
TABLE 1. Comparison of microRNAs versus tsRNAs
Parameter MicroRNA
Type I tsRNA
(e.g., cand14)
Type II tsRNA
(e.g., cand45)
Biogenesis Drosha dependent Drosha independent 59RNaseZ
Dicer dependent Dicer dependent 39Pol III termination
Northern detection Distinct Obscured by variable
background
Distinct
Argonaute association Ago1,Ago2 =Ago3,Ago4 Ago1,Ago2 #Ago3,Ago4 Ago1,Ago2 <Ago3,Ago4
Enriches 18–20-nt species
Mov10 association Yes No No
Localization Nuclear <cytoplasmic Cytoplasmic only Cytoplasmic only
RNAi-type
trans-silencing
Yes Yes No
Sense oligonucleotide to
overexpressed tsRNA triggers
RNAi-related silencing
TABLE 2. Argonaute small RNA loading efficiencies with respect
to type and structure of small RNA substrate.
tRNA-derived small RNAs
www.rnajournal.org 689
Argonaute family proteins. While piRNAs in lower eukary-
otes serve to control transposon activity by a so-called
ping-pong mechanism, their function and molecular mech-
anism of action is less well understood in mammals (for
review, see Aravin et al. 2007). Of note, z6% of piRNA
complexes isolated from mouse testes contained tRNA-
derived small RNAs, yet were essentially entirely depleted of
ribosomal and micro-RNAs (Girard et al. 2006).
Given that RNAi efficiency is determined by siRNA-
guided slicing of target mRNA by Argonaute 2 (Liu et al.
2004), our results further highlight the importance of
achieving comparatively efficient Argonaute 2 loading.
Differential duplex end stabilities and consequently biased
passenger-guide strand loading is thought to be the single
most important determinant for siRNA efficacy (Khvorova
et al. 2003; Schwarz et al. 2003). This is surprising, however,
since absolute Argonaute 2 occupancy of a passenger strand
derived from a highly abundant siRNA should still be
higher than that of the preferred guide strand from
a much less abundant siRNA, yet silencing efficiencies are
not correlated with absolute Argonaute 2 occupancy. We
therefore speculate that the improved performance of
asymmetric siRNAs is due to their relative efficient loading
into Ago2 rather than their absolute ability to be loaded
into Argonautes in general. It is then the ability of Ago2 to
rapidly cleave the passenger strand (Matranga et al. 2005;
Rand et al. 2005) of asymmetric siRNAs that is ultimately
responsible for the observed strand bias. Passenger strands
of siRNAs that are equally well recognized by all Argo-
nautes, including nonslicing Ago1, Ago3, and Ago4 should
be more stable and such siRNAs should therefore exhibit
less apparent strand bias. Poor siRNA performance may thus
result from competition for the target with the nonslicing
Argonautes. This suggests relative Ago2 loading efficiency to
be an important consideration for siRNA design.
An unanticipated finding from our studies were that
despite the apparent lack of classical trans-silencing activity
by cand45, there was robust, >80% down-regulation of
a cand45 reporter gene in cells overexpressing cand45 upon
the addition of an oligonucleotide antisense to cand45, i.e.,
sense to the target gene. This is a quite unusual response to
oligonucleotides that are antisense to small guide RNAs as
this usually relieves, but does not induce gene repression. We
show that reconstitution of a fully duplexed siRNA that is
now preferentially loaded into Ago2 is responsible for this
phenomenon. In addition for exploiting this system to learn
about Argonaute substrate specificities, equally exciting is
the prospect of harnessing this mechanism as a new type of
RNA silencing tool in which genes can be silenced by the
addition of an oligonucleotide with sense polarity to the
target gene. This could not only be useful for studying gene
function in vitro, but it may be particularly valuable for
knocking down genes in vivo for target validation and
therapeutic purposes by combining the relative ease and
simplicity of delivering unformulated single-stranded oligo-
nucleotides to organs like the liver and spleen to, in
a temporally regulated manner, tap into the inherently more
potent RNAi pathway once inside cells. The ability to use at
least two different modification chemistries raises hopes that
the pharmacological requirements for in vivo applications
will not be limiting.
MATERIALS AND METHODS
Tissue culture
Human 293 and HCT116 cells (wild-type and derived Dicer
helicase mutant cells were a kind gift from B. Vogelstein, John
Hopkins University) were maintained in standard 10% FCS
DMEM medium. For the RNA immunoprecipitation experiment
in Figure 4B, the 293-derived FLAG-HDAg expressing cell line
and the induction of HDV replication by plasmid transfection
have been described before (Haussecker et al. 2008). Cells were
transfected with Lipofectamine 2000 (L2K, Invitrogen) for plas-
mid DNA and RNAiMax (Invitrogen) for siRNA according to the
manufacturer’s instructions. For the serum starvation experi-
ments, HCT116 cells were cultured at the indicated serum
concentrations by daily media change and split such that they
were growing at comparable cell densities. For the Brf1 over-
expression experiments, 293 cells were transfected with a Brf1
overexpression plasmid on days 0 and 2 with 2 mg of plasmid
DNA per 6 cm dish. For testing steady-state small RNA levels as
a function of serum concentrations/Brf1 overexpression, RNA was
isolated for Northern blot analysis on day 5; for testing small RNA
trans-silencing capacity under these conditions, luciferase reporter
constructs were introduced on day 4 of serum starvation/Brf1
overexpression and dual luciferase assays performed the next day.
Plasmids
For RNA analyses, 2 mg expression plasmids were used per six
wells of 293 cells and RNA analyzed 48 h after transfection. FLAG-
Argonautes 1 and 2 and FLAG-EGFP are as described by Meister
et al. (2004). To obtain similar expression levels for FLAG-
Argonautes 1–4, FLAG-Argonaute 3 and 4 described by Meister
et al. 2004 were codon optimized by GENEART AG. Codon
optimization did not change amino acids, only expression levels
(detailed sequence available upon request). The FLAG-Ago2 PAZ
deletion mutant in Figure 7 was generated according to Gu et al.
(2009). FLAG-Mov10 is as described in Meister et al. (2005),
FLAG-TRBP as described by Kok et al. (2007); and pCMV-Dicer
was a gift of Ian G. Macara (University of Virginia). A cand45
cloning vector (‘‘cand45-empty’’) genomic sequence was ampli-
fied with primers hsCand45gen-F cttaaAAGCTTaagcttCTCT
CGCAGAAATGCCAAAT and hsCand45gen-R cttaatctagaAAAAA
AAtgGTCTTCAGTGAAGCGAAGACgcaggg TTCGAACCTGCGC
GGGGAGAC, and cloned into the HindIII-XbaI sites of pCRII-
TOPO (Invitrogen). For cand45-45, cand45-targ1 (referred to as
‘‘cand45-con’’ in Fig. 6C), cand45-targ2, cand45-+2.45, cand45-
+4.45, and cand45-2.45 overexpression, the cloning vector was
digested with BbsI, de-phosphorylated, and the following phos-
phorylated and annealed oligos inserted:
Cand45-45: ccctGCTCGCTGCGGAAGCGGGTGCTCTTA and
aaaaTAAGAGCACCCGCTTCCGCAGCGAGC;
Haussecker et al.
690 RNA, Vol. 16, No. 4
Cand45-targ1: ccctGCTCGCTGCGttcagcccgtcctctaggc and AAAA
gcctagaggacgggctgaaCGCAGCGAGC;
Cand45-targ2: ccctGCTCGCTGCGctcctcgagcgtcagacgc and AAAA
gcgtctgacgctcgaggagCGCAGCGAGC;
Cand45-+2.45: ccctGCTCGCTGCGGAGAAGCGGGTGCTCTTA
and aaaaTAAGAGCACCCGCTTCTCCGCAGCGAGC;
Cand45-+4.45: ccctGCTCGCTGCGGAGAGAAGCGGGTGCTCTTA
and aaaaTAAGAGCACCCGCTTCTCTCCGCAGCGAGC; and
Cand45-2.45: ccctGCTCGCTGCGAGCGGGTGCTCTTA and aaaa
TAAGAGCACCCGCTCGCAGCGAGC.
In the cotransfection studies in Figure 4C, 2 mg of cand45 and
2mg of FLAG-protein expression vectors were cotransfected into
6-cm dishes of 293 cells. The Brf1 overexpression vector was created
by cloning the Brf1 ORF from pTRE2-Brf1 (Marshall et al. 2008)
into pcDNA3 just downstream from an N-terminal FLAG epitope
(Cao et al. 2009), while in the negative control vector the Brf1
ORF had been replaced with the truncated ORF of a replication-
deficient early nonsense mutant version of HDAg (Haussecker
et al. 2008).
Northern blot
For small RNA Northern blotting, RNA was separated by
20% urea-polyacrylamide gel electrophoresis, transferred onto
Hybond-N (Amersham) nitrocellulose by semidry transfer, and
hybridized to T4 PNK end-labeled oligonucleotide probes over-
night at 32°C with PerfectHyb Plus (Sigma). Blots were washed
three times with 6X SSC, 0.2% SDS (32°C, 34°C, 36°C), and then
once with 0.5X SSC, 0.1% SDS (42°C) for 10 min each. Images
were obtained by a PhosphorImager. Ambion’s ‘‘Decade’’ was
used as a size marker. Northern probe oligos were the following:
Cand1: gCACATGGTTAGATCAAGC;
Cand2: gAAAACCCACAATCCCTGGCTG;
Cand3: gAAAACCCACAATCCCTGGCTTA;
Cand4: gTCAATTAGTTGTAAACACCACTG;
Cand5: gTTCTAGGATAGGCCCAGGGGC;
Cand6: gCCAACTGAGCTAACCGGCC;
Cand7: gAACCCCACCAACATAGGGCTTCG;
Cand8: GGGCAGGCGAGAATTCTACCAC;
Cand9: GGATAACCACTACACTATGGAA;
Cand10: gTGGCGCCCGAACAGGGACA;
Cand11: GGCACCCCAGATGGGACACGA;
Cand12: gAAACGAGGTAACTCCGGA;
Cand13: GTGCCCGAGTGTGGTGGAGAATG;
Cand14: GAGTAGTGGTGCGTTGGCCGG;
Cand15: gTGGCGACCACGAAGGGACG;
Cand16: GAATTCTACCACTGAACCACAAT;
Cand17: GGCGACCACGAAGGGACACGA;
Cand18: GTTGTAAACACCACTGCACT;
Cand19: GGGCTTCAAAAAATTTGCTTGA;
Cand20: GGAGGGGGCACCCGGATTTGA;
Cand21: GGCGACCACGAAGGGACCCGA;
Cand22 (also known as miR-20): gACTACCTGCACTATAAGCAC;
Cand23: GGTGCGTTGGCCGGGAAACGA;
Cand24: gAAACAGCAAGCTAGTCAAGC;
Cand25: gCTTAGACCGCTCGGCCATCCTT;
Cand26: GACCGCTCGGCCACGCTACCCTC;
Cand27: gTGGCGAGCCAGCCAGGAG;
Cand28: gCCTTAGACCGCTCGGCCATCCT;
Cand29: GTCCTTGGTGCCCGAGGTGTCTA;
Cand30: GTGATATCCACTACACTACGGA;
Cand31: gCACCACTATACCACCAACGC;
Cand32: gCTCGCCAGGGCAAGGCTTACAA;
Cand33: GGTGCATGGGCCGGGAAACG;
Cand34: gACCACTGAACCACCAATGC;
Cand35: GGTTCCTGACCGGGAATCGAAC;
Cand36: GGTGCCGAAACCCGGGAACGA;
Cand37: gAACCCCACCAACATAGGGCTT;
Cand38: GTCCTTGGTGCCCGAGTGACCT;
Cand39: GACACCGTCCTTGGTGCCGCGT;
Cand40: GGACACCGTCCTTGGTGCCCAG;
Cand41: GCCCGAGGTGGTATGGCCGTAG;
Cand42: gTCTACCACTGAACCACCCATG;
Cand43: gACCACTGAACCACCCATGC;
Cand44: GAGAACCGTCCTTGGTGCCCGA;
Cand45: gAAAATAAGAGCACCCGCTTC;
Cand193: gCGAGGTAACTCCGGAGC;
Cand401: GAGGCACCTGCCAGGTGAC;
Cand500: gCTGAGCACAGGACTTCCTT;
Cand520: GAGCTTGGACGCTCGGTTGA;
sh320: gTCGCCCTCTCAACCCAGCTTTT;
sh484: gATCGGGAGGGGACTGAGCCTGA;
MALAT mascRNA: gtcctggaaaccaggagtgc;
let-7a: AACTATACAACCTACTACCTCA;
miR-15a: acaaaccattatgtgctgcta;
miR-18a: Gctatctgcactagatgcacct;
mir-21: Gtcaacatcagtctgataagc;
mir-103: Gtcatagccctgtacaatgctg;
mir-106a: Gctacctgcactgtaagcacttt;
mir-191: Gcagctgcttttgggattccgtt;
U6 snRNA: gccatgctaatcttctctgtatc;
sno38b: AGAACTGGACAAAGTTTTCATCAC;
Cand45-targ1: gcctagaggacgggctgaa;
Cand45-targ2: gcgtctgacgctcgaggag; and
HDV small RNA: ggcggcagtcctcagtactctta.
For the Northern blot screen in Figure 1 (Supplemental Fig. 1)
and the Dicer helicase mutant analysis in Figure 2A, 4 mgmirVana
(Ambion) low-molecular weight RNA was sequentially treated
with TAP and/or T4 RNA ligase as described in the following
section).
Analysis of small RNA 39and 59ends
Enzyme treatments were performed by denaturing 4 mgmirVana
(Ambion) RNA per sample at 65°C for 5 min, chilled on ice for
2 min, and followed by the addition of enzyme buffer, rRNasin
(Promega; except for Terminator Exonuclease treatments), and,
finally, enzyme. Fifteen-microliter reactions were incubated with
the indicated enzymes at 37°C (Terminator Exonuclease: 30°C)
for 60 min, acid phenol/chloroform extracted, ethanol precipi-
tated, and resuspended for the second round of enzyme treat-
ments, which was again followed by acid phenol/chloroform
extraction, ethanol precipitation, and resuspension in PAGE
loading buffer for Northern blot. Buffer indicates that no enzyme
was added. Amounts of enzymes used: 15 units (U) of T4 PNK,
39phophatase 6(NEB M0201/m0236); 8 U of Tobacco Acid
Pyrophosphatase (Epicentre Biotechnologies); 3 U of Terminator
tRNA-derived small RNAs
www.rnajournal.org 691
Exonuclease (Epicentre Biotechnologies); 4 U polyA polymerase
(PAP; Ambion); and 15 U T4 RNA ligase (NEB). For 39-adapter
ligation with T4 RNA ligase, a noncommercial buffer without ATP
was made up and 1 mg of the following activated 39-adapter
added: 59-AppCTGTAGGCACCATCAAT–NH2-39(NEB 1315).
RNA Immunoprecipitation
To test for the distribution of tsRNAs, cell lysate corresponding to
a 6 cm dish of confluent 293 cells were used for each immuno-
precipitation. Lysates were prepared by washing cells 48 h after
FLAG-protein transfection twice with ice-cold PBS and then
lysing them with 0.6-mL/10-cm dish M-PER lysis buffer (Pierce)
containing protease inhibitor cocktail (EDTA, Roche). Lysates
were diluted by the addition of 3X volumes IP buffer (20 mM
Tris-HCl [pH 8.0], 50 mM KCl, 0.2 mM EDTA, 10% glycerol).
One-tenth of the volume lysate per immunoprecipitation was
removed and RNA isolated with TRIzol (Invitrogen) for the input
RNA control. Per sample, 20 uL anti-Flag M2 agarose beads (Sigma
A2220) were added to the lysate for incubation with rotation
overnight at 4°C. The next day, immunoprecipitates were washed
extensively with IP buffer and RNA isolated by the addition of
TRIzol to the beads. To delineate the mechanism of sense-induced
trans-silencing, HCT116 cells were cotransfected in 6 cm dishes
with 2 mg of FLAG-bait, 2 mg of the cand45 overexpression vector,
and 0.1 mg of the luciferase reporter, 2 h after which 100 nM of the
sense oligonucleotide were added. Cells were split the next day into
one 6 cm dish and three 24 wells each, with lysates harvested and
processed for RNA immunoprecipitation (6 cm dish) or luciferase
assay (24 wells) 48 h after the first transfection.
RNaseZP processing assay
RNaseZP processing assays were as previously described (Wilusz
et al. 2008). Purified HeLa RNaseP and recombinant His-tagged
tRNaseZL (delta30) were generously provided by Sidney Altman
(Yale University) and Masayuki Nashimoto (Niigata University),
respectively. After the first enzyme treatments, RNA was acid
phenol/chloroform extracted and ethanol immunoprecipitated,
and resuspended for performing the second enzyme reaction.
Mock treatment was buffer without enzyme addition. An in-
ternally alpha-P32 UTP-labeled, gel-purified cand45 precursor
tRNA substrate was prepared by SP6 in vitro transcription of
XbaI-linearized plasmid SP6-cand45. SP6-cand45 was obtained by
cloning into the HindIII-XbaI sites of pCRII-TOPO (Invitrogen)
a genomic cand45 tRNA PCR fragment using primers SP6-
cand45-F (cttaaAAGCTTACTAAAGTGTCTCCGCCTG) and SP6-
cand45-R (ttaatctagaAAATAAGAGCACCCGCTTCCGCAGCGA
GCAGGGTTCGAACCTGCGCGGGG; starting 34 nt upstream of
the predicted RNaseP cleavage site and ending with the RNA
polymerase termination oligo-dT stretch).
Nuclear-cytoplasmic RNA fractionation
Nuclear-cytoplasmic fractionation was performed as previously
described (Haussecker et al. 2008). Two micrograms of each
fraction were used for Northern blot analysis.
Dual luciferase assay
The Dual-Luciferase Reporter (DLR) Assay (Promega) was per-
formed according to the manufacturer’s instructions, with the
following modifications. Cand14 and Cand45 reporter vectors
were derived by inserting the following phosphorylated and
annealed oligos into the XhoI-SpeI sites of Renilla luciferase in
psi-check2 (Promega):
psi-cand14:
TCGAcgagtagtggtgcgttggccgggaaAAAAAcgagtagtggtgcgttggccgg
gaa and
CTAGttcccggccaacgcaccactactcgTTTTTttcccggccaacgcaccactactcg;
psi-cand45 wt (also known as ‘‘psi-cand45wt 2x’’ in Supplemental
Fig. 6):
tcgaAAAATAAGAGCACCCGCTTCaaaaAAAATAAGAGCACC
CGCTTC and
ctagGAAGCGGGTGCTCTTATTTTttttGAAGCGGGTGCTCTT
ATTTT;
psi-cand45wt 1x:
TCGAAAAATAAGAGCACCCGCTTC and
CTAGGAAGCGGGTGCTCTTATTTT;
psi-cand45wt_extended (Fig. 7; Supplemental Fig. 9):
tcgaAAAAAAAATAAGAGCACCCGCTTCTCTCaaaaAAAAAA
AATAAGAGCACCCGCTTCTCTC and
ctagGAGAGAAGCGGGTGCTCTTATTTTTTTTttttGAGAGAA
GCGGGTGCTCTTATTTTTTTT;
psi-let-7aPM:
TCGAaactatacaacctactacctcAaaaaaaactatacaacctactacctcAaaaaaa
aactatacaacctactacctcA and
ctagTgaggtagtaggttgtatagttttttttTgaggtagtaggttgtatagtttttttTgagg
tagtaggttgtatagtt;
psi-let-7aMM :
TCGAaTcTAtTGaaGGAactacctcAaaaaaaaaTcTAtTGaaGGAacta
cctcAaaaaaaaaTcTAtTGaaGGAactacctcA and
ctagTgaggtagtTCCttCAaTAgAttttttttTgaggtagtTCCttCAaTAgAt
tttttttTgaggtagtTCCttCAaTAgAt;
psi-miR-20PM:
TCGActacctgcactataagcactttaaaaaaactacctgcactataagcactttaaaaaa
actacctgcactataagcacttta and
ctagtaaagtgcttatagtgcaggtagtttttttaaagtgcttatagtgcaggtagtttttttaaa
gtgcttatagtgcaggtag;
psi-miR-20MM:
TCGActTGctGCaGtaTAagcactttaaaaaaactTGctGCaGtaTAagcactt
taaaaaaactTGctGCaGtaTAagcacttta and
ctagtaaagtgctTAtaCtGCagCAagtttttttaaagtgctTAtaCtGCagCAagtt
tttttaaagtgctTAtaCtGCagCAag; and
psi-bantam:
tcgaTAGTTTTCACAATGATCTCGGTAGTTTTCACAATGAT
CTCGGTAGTTTTCACAATGATCTCGGTAGTTTTCACAATG
ATCTCGG and
ctagCCGAGATCATTGTGAAAACTACCGAGATCATTGTGAA
AACTACCGAGATCATTGTGAAAACTACCGAGATCATTGTG
AAAACTA.
Each transfection was performed in triplicate 24 wells by cotrans-
fecting the following amounts of nucleic acids with L2K into 293
(cand14 assays) or HCT116 (cand45 assays) cells: Fifty-nanogram
psi-check reporter plasmid, and either 225ng+225ng FLAG-
protein expression+cand45-45/-targ.1/-targ.2 or 450 ng FLAG-
protein expression vector. A number of antisense oligonucleotides
(100 nM) were applied 2 h after plasmid transfection, lysates
harvested for luciferase assays 48 h after the tranfections. With
the exception of the experiment shown in Supplemental Fig. 7, the
Haussecker et al.
692 RNA, Vol. 16, No. 4
Renilla:Firefly luciferase ratios of the target vectors were further
normalized to the Renilla:Firely luciferase ratio of a psi-check2-
derived reporter in which the tsRNA target sequences were re-
placed by bantam microRNA target sequences (not expressed in
human cells). Antisense oligonucleotides were the following
(where ‘‘+’’ denotes the number of nucleotides extended at the 59
end):
Anti-14: 59-+T+A+G+T+GGmUGmCGmUTmG+G+C+C+GG-39;
Anti-cand45/anti-45 LNA/methyl: 59-+A+A+A+ATmAAmGAmG
CmACmCC+G+C+T+TC-39;
Anti-cand45-methyl: 59-mAmAmAmAmUmAmAmGmAmGmC
mAmCmCmCmGmCmUmUmC-39;
Anti-cand45-LNA: 59-+A+A+A+A+U+A+A+G+A+G+C+A+C+
C+C+G+C+U+U+C-39;
Anti-con1: ATGGCCTCGAGCCTCCTCAATTCACAACCTG;
Anti-con2: mAmGmGmCmGmGmCmAmGmUmCmCmUmCm
AmGmUmAmCmUmCmUmUmA; and
Anti-con3: mUmAmAmGmAmGmUmAmCmUmGmAmGmGm
AmCmUmGmCmCmGmCmCmU.
Anti-cand45 oligonucleotides for testing structure-function of
sense-induced trans-silencing (Fig. 7; Supplemental Fig. 9) were
the following:
Anti-cand45 (2-nt matching cand45 59end removed): 59-mAmAm
AmAmUmAmAmGmAmGmCmAmCmCmCmGmCmU-39;
Anti-cand45 (with an additional 2-nt matching cand45-derivative
cand45-+2.45): 59-mAmAmAmAmUmAmAmGmAmGmCmAm
CmCmCmGmCmUmUmCmUmC-39;
Anti-cand45 (with an additional 4-nt matching cand45-derivative
cand45-+4.45): 59-mAmAmAmAmUmAmAmGmAmGmCmAm
CmCmCmGmCmUmUmCmUmCmUmC-39;
Anti-cand45 (with an additional 2 nt that would be able to match
a cand45-derivative with extended oligo-U 39tail): 59-mAmAm
AmAmAmAmUmAmAmGmAmGmCmAmCmCmCmGmCmU
mUmC-39;
Anti-cand45 (resulting in 2-nt 39overhang of cand45 with 4Us at
the 39end): 59-mAmAmUmAmAmGmAmGmCmAmCmCmCm
GmCmUmUmC-39;
Anti-cand45 (with an additional 4 nt matching cand45-derivative
cand45-+4.45 and resulting in 2-nt 39overhang of cand45 with
4Us at the 39end): 59-mAmAmUmAmAmGmAmGmCmAm
CmCmCmGmCmUmUmCmUmCmUmC-39;
Anti-cand45 (with a 39extension that would extend complemen-
tarily toward cand45, 2 nt upstream of the predicted RNaseZ
cleavage site): 59-mAmAmAmAmUmAmAmGmAmGmCmAm
CmCmCmGmCmUmUmCmCmG-39;
Anti-cand45 (with a 39extension that would extend complementarily
toward cand45, 2 nt upstream of the predicted RNaseZ cleavage
site, and resulting in a 2-nt 39overhang of cand45 with 4Us at the
39end): 59-mAmAmUmAmAmGmAmGmCmAmCmCmCmGm
CmUmUmCmUmC-39;and
Let-7a antisense: mAmAmCmUmAmUmAmCmAmAmCmCm
UmAmCmUmAmCmCmUmCmA (miRIDIAN miR-20 Hairpin
Inhibitor: Dharmacon Cat. No. IH-300491-05: miRIDIAN let-7a
Hairpin Inhibitor: Dharmacon Cat. No. IH-300473-07; +: LNA; m:
29-O-methyl; others: DNA bases).
RNAi
Two hundred ninety-three (Brf1) and HCT116 (serum) cells were
cultured for 4 d under the indicated conditions and then trans-
fected with siRNAs targeting the endogenously expressed RALY
gene using RNAiMax (Invitrogen). RNA was harvested the next
day with TRIzol (Invitrogen) and quantitative reverse transcription
realtime PCR (qRT-PCR) performed according to Haussecker
and Proudfoot (2005); actin was used for normalization. Two-
nucleotide dTdT 39overhang siRNAs of the following sequences
(sense/passenger) were obtained from Dharmacon/Thermo
Fischer:
si-1: GAUCAAGUCCAAUAUCGAUdtdt;
si-2: GCGUGUCAAAACUAACGUAdtdt;
si-3: AGACGACGGCGAUGAGGAAdtdt;
RT-PCR primers:
Actin RT: cttaatgtcacgcacgatttcc;
Actin forward: aaatctggcaccacaccttc;
Actin reverse: agaggcgtacagggatagca;
RALY RT: tcttcctcgctgtgtgtcag;
RALY forward: ttctgtgcacaagggctatg; and
RALY reverse: atggcagatgctgctctctt.
Western blot
Western blot was performed according to standard protocols.
Two micrograms of protein from 293 cells transfected with the
indicated expression plasmids were run on 4%–20% polyacryl-
amide gradient gels, blotted, and probed with the following
antibodies: mAb FLAG M2 (Sigma, A8592); mAb anti-actin
(Sigma, A5316).
SUPPLEMENTAL MATERIAL
Supplemental material can be found at http://www.rnajournal.org.
ACKNOWLEDGMENTS
This work was supported by grants from the NIH, NIAID 71068,
and DK 078424 to M.A.K. and by GM 37706 to A.Z.F. We thank
Masayuki Nashimoto (Niigata University) and Sidney Altman
(Yale University) for recombinant RNaseZ and purified human
RNaseP, respectively.
NOTE ADDED IN PROOF
Since submitting our manuscript, Lee et al. (2009) published on
tRNA-derived small RNAs in human cells. That study identified
three populations of 17–26 nt tRNA-derived small RNAs, one
corresponding to the 59end of mature tRNAs, the other two to the
class I and II tsRNAs reported here. Lee et al. (2009) also picked
cand45 (referred to as tRF-1001 in Lee et al. [2009]) for more
detailed analyses and found its expression to correlate with cell
proliferation, to have almost no trans-silencing capacity, and to be
the result of processing by an isoform of RNaseZ/ELAC possibly
in the cytoplasm. Beyond that, their studies suggest cand45 to be
tRNA-derived small RNAs
www.rnajournal.org 693
necessary for cell proliferation. Where the two studies overlap, the
conclusions are consistent with one another.
Received November 12, 2009; accepted December 22, 2009.
REFERENCES
Aoki K, Moriguchi H, Yoshioka T, Okawa K, Tabara H. 2007. In vitro
analyses of the production and activity of secondary small in-
terfering RNAs in C. elegans.EMBO J 26: 5007–5019.
Aravin AA, Hannon GJ, Brennecke J. 2007. The Piwi-piRNA pathway
provides an adaptive defense in the transposon arms race. Science
318: 761–764.
Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H,
Siomi MC. 2008. Characterization of endogenous human Argo-
nautes and their miRNA partners in RNA silencing. Proc Natl Acad
Sci 105: 7964–7969.
Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R. 2008. Mouse ES
cells express endogenous shRNAs, siRNAs, and other Micropro-
cessor-independent, Dicer-dependent small RNAs. Genes &Dev
22: 2773–2785.
Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC. 2007. Mammalian
mirtron genes. Mol Cell 26: 328–336.
Buhler M, Spies N, Bartel DP, Moazed D. 2008. TRAMP-mediated
RNA surveillance prevents spurious entry of RNAs into the
Schizosaccharomyces pombe siRNA pathway. Nat Struct Mol Biol
15: 1015–1023.
Cao D, Haussecker D, Huang Y, Kay MA. 2009. Combined proteomic-
RNAi screen for host factors involved in human hepatitis delta virus
replication. RNA 15: 1971–1979.
Cole C, Sobala A, Lu C, Thatcher SR, Bowman A, Brown JW, Green PJ,
Barton GJ, Hutvagner G. 2009. Filtering of deep sequencing data
reveals the existence of abundant Dicer-dependent small RNAs
derived from tRNAs. RNA 15: 2147–2160.
Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T,
Barad O, Bentwich Z, Szafranska AE, Labourier E, et al. 2006. The
colorectal microRNAome. Proc Natl Acad Sci U S A 103: 3687–3692.
Diederichs S, Haber DA. 2007. Dual role for argonautes in microRNA
processing and posttranscriptional regulation of microRNA ex-
pression. Cell 131: 1097–1108.
Diederichs S, Jung S, Rothenberg SM, Smolen GA, Mlody BG,
Haber DA. 2008. Coexpression of Argonaute-2 enhances RNA
interference toward perfect match binding sites. Proc Natl Acad Sci
105: 9284–9289.
Dubrovsky EB, Dubrovskaya VA, Levinger L, Schiffer S, Marchfelder A.
2004. Drosophila RNaseZ processes mitochondrial and nuclear pre-
tRNA 39ends in vivo. Nucleic Acids Res 9: 255–262.
Ebhardt HA, Tsang HH, Dai DC, Liu Y, Bostan B, Fahlman RP. 2009.
Meta-analysis of small RNA-sequencing errors reveals ubiquitous
post-transcriptional RNA modifications. Nucleic Acids Res 37:
2461–2470.
Elbarbary RA, Takaku H, Uchiumi N, Tamiya H, Abe M,
Takahashi M, Nishida H, Nashimoto M. 2009. Modulation of
gene expression by human cytosolic tRNase Z(L) through 59-half-
tRNA. PLoS One 4: e5908.
Ender C, Krek A, Friedlander MR, Beitzinger M, Weinmann L,
Chen W, Pfeffer S, Rajewski N, Meister G. 2008. A human
snoRNA with microRNA-like functions. Mol Cell 32: 519–528.
Farazi TA, Juranek SA, Tuschl T. 2008. The growing catalog of small
RNAs and their association with distinct Argonaute/Piwi family
members. Development 135: 1201–1214.
Forman JJ, Legesse-Miller A, Coller HA. 2008. A search for conserved
sequences in coding regions reveals that the let-7 microRNA
targets Dicer within its coding sequence. Proc Natl Acad Sci 105:
14879–14884.
Ghildiyal M, Zamore PD. 2009. Small silencing RNAs: An expanding
universe. Nat Rev Genet 10: 84–108.
Girard A, Sachidanandam R, Hannon GJ, Carmell MA. 2006. A
germline-specific class of small RNAs binds mammalian Piwi
proteins. Nature 442: 199–202.
Grimm D, Streetz KL, Joplin CL, Storm TA, Pandey K, Davis CR,
Marion P, Salazar F, Kay MA. 2006. Fatality in mice due to
oversaturation of cellular microRNA/short hairpin RNA pathways.
Nature 441: 537–541.
Gu S, Jin L, Zhang F, Sarnow P, Kay MA. 2009. Biological basis for
restriction of microRNA targets to the 39untranslated region in
mammalian mRNAs. Nat Struct Mol Biol 16: 144–150.
Guang S, Bochner AF, Pavelec DM, Burkhart KB, Harding S,
Lachowiec J, Kennedy S. 2008. An Argonaute transports siRNAs
from the cytoplasm to the nucleus. Science 321: 537–541.
Han J, Pedersen JS, Kwon SC, Belair CD, Kim YK, Yeom KH,
Yang WY, Haussler D, Blelloch R, Kim VN. 2009. Posttran-
scriptional crossregulation between Drosha and DGCR8. Cell 136:
75–84.
Haussecker D, Proudfoot NJ. 2005. Dicer-dependent turnover of
intergenic transcripts from the human b-globin gene cluster. Mol
Cell Biol 25: 9724–9733.
Haussecker D, Cao D, Huang Y, Parameswaran P, Fire AZ, Kay MA.
2008. Capped small RNAs and MOV10 in human hepatitis delta
virus replication. Nat Struct Mol Biol 15: 714–721.
Hock J, Meister G. 2008. The Argonaute protein family. Genome Biol
9: 210.1–210.8.
Hock J, Weinmann L, Ender C, Rudel S, Kremmer E, Raabe M,
Urlaub H, Meister G. 2007. Proteomic and functional analysis of
Argonaute-containing mRNA-protein complexes in human cells.
EMBO Rep 8: 1052–1060.
Hwang HW, Wentzel EA, Mendell JT. 2007. A hexanucleotide element
directs microRNA nuclear import. Science 315: 97–100.
Hwang HW, Wentzel EA, Mendell JT. 2009. Cell–cell contact globally
activates microRNA biogenesis. Proc Natl Acad Sci 106: 7016–7021.
Iorio MV, Croce CM. 2009. MicroRNAs in cancer: Small molecules
with a huge impact. J Clin Oncol 27: 5848–5856.
Janowski BA, Huffman KE, Schwartz JC, Ram R, Nordsell R,
Shames DS, Minna JD, Corey DR. 2006. Involvement of AGO1
and AGO2 in mammalian transcriptional silencing. Nat Struct Mol
Biol 13: 787–792.
Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S,
Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, et al. 2008. Hidden
layers of human small RNAs. BMC Genomics 9: 157. doi: 10.1186/
1471-2164-9-157.
Khvorova A, Reynolds A, Jayasena S. 2003. Functional siRNAs and
miRNAs exhibit strand bias. Cell 115: 209–216.
Kim DH, Villeneuve LM, Morris KV, Rossi JJ. 2006. Argonaute-1
directs siRNA-mediated transcriptional gene silencing in human
cells. Nat Struct Mol Biol 13: 793–797.
Kim VN, Han J, Siomi MC. 2009. Biogenesis of small RNAs in
animals. Nat Rev Mol Cell Biol 10: 126–139.
Kirino Y, Mourelatos Z. 2007. Mouse Piwi-interacting RNAs are 29-
O-methylated at their 39termini. Nat Struct Mol Biol 14: 347–348.
Kok KH, Ng MH, Ching YP, Jin DY. 2007. Human TRBP and PACT
directly interact with each other and associate with dicer to
facilitate the production of small interfering RNA. J Biol Chem
282: 17649–17657.
Kruszka K, Barneche F, Guyot R, Ailhas J, Meneau I, Schiffer S,
Marchfelder A, Echeverria M. 2003. Plant dicistronic tRNA-
snoRNA genes: A new mode of expression of the small nucleolar
RNAs processed by RNaseZ. EMBO J 22: 621–632.
Lee YS, Shibata Y, Malhotra A, Dutta A. 2009. A novel class of small
RNAs: tRNA-derived RNA fragments (tRFs). Genes &Dev 23:
2639–2649.
Leuschner PJ, Ameres SL, Kueng S, Martinez J. 2006. Cleavage of the
siRNA passenger strand during RISC assembly in human cells.
EMBO Rep 7: 314–320.
Lingel A, Simon B, Izaurralde E, Sattler M. 2003. Structure and
nucleic-acid binding of the Drosophila Argonaute 2 PAZ domain.
Nature 426: 465–469.
Haussecker et al.
694 RNA, Vol. 16, No. 4
Liu J, Carmell MA, Rivas FV, Marsden CG, Thomson JM, Song JJ,
Hammond SM, Joshua-Tor L, Hannon GJ. 2004. Argonaute2 is
the catalytic engine of mammalian RNAi. Science 305: 1437–1441.
Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-
Cordero A, Ebert BL, Mak RH, Ferrando AA, et al. 2005. MicroRNA
expression profiles classify human cancers. Nature 435: 834–838.
Lund E, Dahlberg JE. 1998. Proofreading and aminoacylation of
tRNAs before export from the nucleus. Science 282: 2082–2085.
Marshall L, White RJ. 2008. Noncoding RNA production by RNA
polymerase III is implicated in cancer. Nat Rev Cancer 8: 911–914.
Marshall L, Kenneth NS, White RJ. 2008. Elevated tRNA
i
Met
synthesis can
drive cellproliferationand oncogenic transformation.Cell 133: 78–89.
Martinez J, Patkaniowska A, Urlaub H, Luehrmann R, Tuschl T. 2002.
Single-stranded antisense siRNAs guide target RNA cleavage in
RNAi. Cell 110: 563–574.
Matranga C, Tomari Y, Shin C, Bartel DP, Zamore PD. 2005.
Passenger-strand cleavage facilitates assembly of siRNA into
Ago2-containing RNAi enzyme complexes. Cell 123: 607–620.
Mayer M, Schiffer S, Marchfelder A. 2000. tRNA 39processing in
plants: Nuclear and mitochondrial activities differ. Biochemistry
39: 2096–2105.
Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G,
Tuschl T. 2004. Human Argonaute2 mediates RNA cleavage
targeted by miRNAs and siRNAs. Mol Cell 23: 185–197.
Meister G, Landthaler M, Peters L, Chen PY, Urlaub H, Lu
¨hrmann R,
Tuschl T. 2005. Identification of novel Argonaute-associated
proteins. Curr Biol 15: 2149–2155.
Mi S, Cai T, Hu Y, Chen Y, Hodges E, Ni F, Wu L, Li S, Zhou H,
Long C, et al. 2008. Sorting of small RNAs into Arabidopsis
argonaute complexes is directed by the 59terminal nucleotide. Cell
133: 116–127.
Nashimoto M, Wesemann DR, Geary S, Tamura M, Kaspar RL. 1999.
Long 59leaders inhibit removal of a 39trailer from a precursor
tRNA by mammalian tRNA 39processing endoribonuclease.
Nucleic Acids Res 27: 2770–2776.
O’Carroll D, Mecklenbrauker I, Das PP, Santana A, Koenig U,
Enright AJ, Miska EA, Tarakhovsky A. 2007. A Slicer-independent
role for Argonaute 2 in hematopoiesis and the microRNA
pathway. Genes &Dev 21: 1999–2004.
Pak J, Fire A. 2007. Distinct populations of primary and secondary
effectors during RNAi in C. elegans.Science 315: 241–244.
Pavon-Eternod M, Gomes S, Geslain R, Dai Q, Rosner MR, Pan T.
2009. tRNA over-expression in breast cancer and functional
consequences. Nucleic Acids Res 37: 7268–7280.
Rand TA, Petersen S, Du F, Wang X. 2005. Argonaute2 cleaves the anti-
guide strand of siRNA during RISC activation. Cell 123: 621–629.
Rudel S, Flatley A, Weinmann L, Kremmer E, Meister G. 2008. A
multifunctional human Argonaute2-specific monoclonal antibody.
RNA 14: 1244–1253.
Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore P. 2003.
Asymmetry in the assembly of the RNAi enzyme complex. Cell
115: 199–208.
Seto AG, Kingston RE, Lau NC. 2007. The coming of age for Piwi
proteins. Mol Cell 26: 603–609.
Su H, Trombly MI, Chen J, Wang X. 2009. Essential and overlapping
functions for mammalian Argonautes in microRNA silencing.
Genes &Dev 23: 304–317.
Tam OH, Aravin AA, Stein P, Girard A, Murchison EP, Cheloufi S,
Hodges E, Anger M, Sachidnandam R, Schultz RM, et al. 2008.
Pseudogene-derived small interfering RNAs regulate gene expres-
sion in mouse oocytes. Nature 453: 534–538.
Tomari Y, Du T, Zamore PD. 2007. Sorting of Drosophila small
silencing RNAs. Cell 130: 299–308.
Vagin VV, Sigova A, Li C, Seitz H, Gvozdev V, Zamore PD. 2006. A
distinct small RNA pathway silences selfish genetic elements in the
germline. Science 313: 320–324.
Vermeulen A, Robertson B, Dalby AB, Marshall WS, Karpilow J,
Leake D, Khvorova A, Baskerville S. 2007. Double-stranded
regions are essential design components of potent inhibitors of
RISC function. RNA 13: 723–730.
Wang Y, Juranek S, Li H, Sheng G, Tuschl T, Patel DJ. 2008. Structure
of an argonaute silencing complex with a seed-containing guide
DNA and target RNA duplex. Nature 456: 921–926.
Watanabe T, Totoki Y, Toyoda A, Kaneda M, Kuramochi-
Miyagawa S, Obata Y, Chiba H, Kohara Y, Kono T, Nakano T,
et al. 2008. Endogenous siRNAs from naturally formed dsRNAs
regulate transcripts in mouse oocytes. Nature 453: 539–543.
Weinmann L, Hock J, Ivacevic T, Ohrt T, Mutz J, Schwille P,
Kremmer E, Benes V, Urlaub H, Meister G. 2009. Importin 8 is
a gene silencing factor that targets Argonaute proteins to distinct
mRNAs. Cell 136: 1–12.
Wilusz JE, Freier SM, Spector DL. 2008. 39end processing of a long
nuclear-retained noncoding RNA yields a tRNA-like cytoplasmic
RNA. Cell 135: 919–932.
Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R,
Chen X. 2005. Methylation as a crucial step in plant microRNA
biogenesis. Science 307: 932–935.
Zamore PD, Haley B. 2005. Ribo-gnome: The big world of small
RNAs. Science 309: 1519–1524.
Zhang X, Graves PR, Zeng Y. 2009. Stable Argonaute2 overexpression
differentially regulates microRNA productions. Biochim Biophys
Acta 1789: 153–159.
tRNA-derived small RNAs
www.rnajournal.org 695
