Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family

Abstract

Genetic susceptibility to familial colorectal cancer (CRC), including for individuals classified as Familial Colorectal Cancer Type X (FCCTX), remains poorly understood. We describe a multi-generation CRC-affected family segregating pathogenic variants in both BRCA1 , a gene associated with breast and ovarian cancer and RNF43 , a gene associated with Serrated Polyposis Syndrome (SPS). A single family out of 105 families meeting the criteria for FCCTX (Amsterdam I family history criteria with mismatch repair (MMR)-proficient CRCs) recruited to the Australasian Colorectal Cancer Family Registry (ACCFR; 1998–2008) that underwent whole exome sequencing (WES), was selected for further testing. CRC and polyp tissue from four carriers were molecularly characterized including a single CRC that underwent WES to determine tumor mutational signatures and loss of heterozygosity (LOH) events. Ten carriers of a germline pathogenic variant BRCA1 :c.2681_2682delAA p.Lys894ThrfsTer8 and eight carriers of a germline pathogenic variant RNF43 :c.988 C > T p.Arg330Ter were identified in this family. Seven members carried both variants, four of which developed CRC. A single carrier of the RNF43 variant met the 2019 World Health Organization (WHO ²⁰¹⁹ ) criteria for SPS, developing a BRAF p.V600 wildtype CRC. Loss of the wildtype allele for both BRCA1 and RNF43 variants was observed in three CRC tumors while a LOH event across chromosome 17q encompassing both genes was observed in a CRC. Tumor mutational signature analysis identified the homologous recombination deficiency (HRD)-associated COSMIC signatures SBS3 and ID6 in a CRC for a carrier of both variants. Our findings show digenic inheritance of pathogenic variants in BRCA1 and RNF43 segregating with CRC in a FCCTX family. LOH and evidence of BRCA1-associated HRD supports the importance of both these tumor suppressor genes in CRC tumorigenesis.

Full text

ORIGINAL ARTICLE
Familial Cancer (2024) 23:9–21
https://doi.org/10.1007/s10689-023-00351-2
proposed to dene families with a strong CRC family his-
tory that meet the Amsterdam I criteria [3] where the tumors
are DNA mismatch repair (MMR)-procient/microsatellite
stable and do not carry a germline pathogenic variant in one
of the MMR genes (Lynch syndrome) [4, 5]. The genetic
factors underlying FCCTX are poorly understood and are
likely to be heterogeneous involving multiple susceptibility
genes [6].
Serrated polyposis syndrome (SPS) is characterized by
the presence of multiple serrated colorectal polyps (hyper-
plastic polyp, sessile serrated lesion (SSL) and traditional
serrated adenoma) resulting in an increased risk of devel-
oping CRC [7–9]. The diagnostic criteria for SPS was
Introduction
Colorectal cancer (CRC) has one of the highest rates of
aggregation within families (familial CRC), with up to
35% of CRC thought to be caused by inherited genetic risk
factors [1]. However, the underlying cause of CRC can be
assigned to one of the inherited CRC and polyposis syn-
dromes in only 5–10% of cases [2], therefore, the genetic
cause of the majority of familial CRC remains unknown.
The term Familial Colorectal Cancer Type X (FCCTX) was
Extended author information available on the last page of the article
Abstract
Genetic susceptibility to familial colorectal cancer (CRC), including for individuals classied as Familial Colorectal
Cancer Type X (FCCTX), remains poorly understood. We describe a multi-generation CRC-aected family segregating
pathogenic variants in both BRCA1, a gene associated with breast and ovarian cancer and RNF43, a gene associated with
Serrated Polyposis Syndrome (SPS). A single family out of 105 families meeting the criteria for FCCTX (Amsterdam
I family history criteria with mismatch repair (MMR)-procient CRCs) recruited to the Australasian Colorectal Cancer
Family Registry (ACCFR; 1998–2008) that underwent whole exome sequencing (WES), was selected for further testing.
CRC and polyp tissue from four carriers were molecularly characterized including a single CRC that underwent WES to
determine tumor mutational signatures and loss of heterozygosity (LOH) events. Ten carriers of a germline pathogenic vari-
ant BRCA1:c.2681_2682delAA p.Lys894ThrfsTer8 and eight carriers of a germline pathogenic variant RNF43:c.988 C > T
p.Arg330Ter were identied in this family. Seven members carried both variants, four of which developed CRC. A single
carrier of the RNF43 variant met the 2019 World Health Organization (WHO2019) criteria for SPS, developing a BRAF
p.V600 wildtype CRC. Loss of the wildtype allele for both BRCA1 and RNF43 variants was observed in three CRC tumors
while a LOH event across chromosome 17q encompassing both genes was observed in a CRC. Tumor mutational signature
analysis identied the homologous recombination deciency (HRD)-associated COSMIC signatures SBS3 and ID6 in a
CRC for a carrier of both variants. Our ndings show digenic inheritance of pathogenic variants in BRCA1 and RNF43
segregating with CRC in a FCCTX family. LOH and evidence of BRCA1-associated HRD supports the importance of
both these tumor suppressor genes in CRC tumorigenesis.
Keywords Colorectal cancer · Serrated polyposis syndrome · FCCTX · Digenic inheritance · BRCA1 · RNF43 ·
Germline pathogenic variant
Received: 6 June 2023 / Accepted: 21 November 2023 / Published online: 8 December 2023
© The Author(s) 2023
Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal
cancer type X family
James M.Chan1,2 · MarkClendenning1,2 · SharelleJoseland1,2· PeterGeorgeson1,2 · KhalidMahmood1,2,3 ·
Jihoon E.Joo1,2· RomyWalker1,2 · JuliaComo1,2· SusanPreston1,2· Shuyi MarciChai1,2· Yen LinChu1,2·
Aaron L.Meyers1,2· Bernard J.Pope1,2,3 · DavidDuggan4· J. LynnFink5,6 · Finlay A.Macrae7,8 ·
ChristopheRosty1,2,9,10 · Ingrid M.Winship8,11 · Mark A.Jenkins2,12· Daniel D.Buchanan1,2,8
1 3
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

J. M. Chan et al.
re-dened by the World Health Organization (WHO) in
2019 [10] to include (i) 5 or more serrated polyps proxi-
mal to the rectum, all 5 mm or greater in size, with 2 or
more 10 mm or greater in size or (ii) more than 20 serrated
polyps of any size in the large bowel, with 5 or more proxi-
mal to the rectum. The progression from serrated polyp to
carcinoma, referred to as the serrated neoplasia pathway of
tumorigenesis, is characterized by distinct molecular fea-
tures, including the presence of microsatellite instability
(MSI), high levels of the CpG island methylator phenotype
(CIMP) and somatic mutations in the oncogenes BRAF or
KRAS [11]. However, the genetic etiology of SPS remains
poorly understood [12, 13]. Recently, germline pathogenic
variants in RNF43 have been proposed to underlie SPS [14–
18], but they account for only a small proportion of cases
[19]. As such, expert groups are yet to recommend the inclu-
sion of RNF43 in multi-gene testing panels for patients with
SPS [12].
The BRCA1 gene acts as a tumor suppressor through its
role in DNA repair [20]. Germline pathogenic variants in
BRCA1 confer high risks of breast and ovarian cancers [21].
The association between BRCA1 pathogenic variants and
CRC development is more uncertain [22]. Multiple stud-
ies have investigated whether carriers of germline BRCA1
pathogenic variants have an increased risk of developing
CRC, with mixed results [23, 24].
It has been suggested that digenic inheritance may account
for some cases of familial CRC and polyposis syndromes,
however there are few reports in the literature [25–27]. In
this study, we describe a family meeting FCCTX criteria
where multiple cancer-aected individuals carried germline
pathogenic variants in both the BRCA1 and RNF43 genes on
chromosome 17q. The tumor characteristics from carriers
were assessed to characterize the drivers of tumorigenesis.
Our ndings demonstrate a possible role for digenic inheri-
tance in the predisposition to familial CRC.
Methods
Study cohort
The family presented was identied from the Austral-
asian Colorectal Cancer Family Registry (ACCFR)
(HREC:13,094) [28–30]. The ACCFR recruited multiple-
member CRC-aected families from Family Cancer Clinics
across Australia and New Zealand between 1998 and 2008.
Participants provided written consent to access their tumor
tissue and provided a blood sample [30]. Methodology for
germline MMR and MUTYH gene testing and tumor charac-
terization have been described previously [28].
Germline sequencing and variant detection
CRC-aected individuals 009 and 014 had germline whole
exome sequencing (WES) performed. Briey, 50ng of
genomic DNA was fragmented to an average size of 180 bp
in length using a Covaris focused-ultrasonicator (Covaris,
Woburn, MA, USA). An Illumina sequencing technology
compatible whole genome library was created using Kapa
Biosystems Hyper Prep Kits (Kapa Biosystems Inc., Wilm-
ington, MA, USA). These libraries were then subjected to
whole exome target enrichment using Agilent SureSelect
hybrid capture version 4 kits (Agilent Technologies, Santa
Clara, CA, USA). Parallel sequencing of libraries was per-
formed on Illumina HiSeq2000/2500 system using version
1.5 or version 3 chemistry using paired-end 2 × 100 bp reads
(Illumina, San Diego, CA, USA). All sequencing reads
were converted to industry standard FASTQ les using
BCL2FASTQ v1.8.4. FASTQ les were processed using a
pipeline based on industry standard software packages and
programs. Sequencing reads were aligned to the GRCh37
human genome reference using v0.7.8 BWA-MEM aligner
[31] to generate BAM les. SAMtools v0.1.19 [32] was
used to sort BAM les and Picard v1.111 (http://broadin-
stitute.github.io/picard/) to mark duplicate read pairs. Post
alignment joint insertion/deletion (indel) realignment and
base quality scores recalibration was performed on the
BAM les using GATK v3.1-1 [33]. Variants were called
from germline BAM les individually using GATK Haplo-
type Caller v3.1-1 [34] and SAMtools v0.1.19 [35].
Germline variant annotation
Germline variants were annotated with the Ensembl Variant
Eect Predictor release 105 (December 2021) for the human
genome reference GRCh37 including the CADD predicted
pathogenicity scores for each variant [36, 37]. The RefSeq
transcript NM_007300.4 was used for BRCA1. The Ref-
Seq transcript NM_017763.5 was used for RNF43. Sanger
sequencing of the BRCA1 and RNF43 pathogenic variants
was used for conrmation of the variants in persons 009 and
014 and to segregate the variants in 19 other family mem-
bers with available DNA.
Tumor tissue sample processing and nucleic acid
preparation
Where available, formalin-xed paran-embedded (FFPE)
tumor tissue blocks were obtained. MMR status was deter-
mined with immunohistochemistry as previously described
[28]. Sections were stained with haematoxylin and eosin
and prepared for pathological review. Tumor, polyp and
histologically normal mucosa were macrodissected and
1 3
10
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family
processed independently. DNA was extracted with the
QIAamp DNA FFPE Tissue kit following standard proto-
cols (Qiagen, Hilden, Germany).
Tumor tissue sequencing and variant detection
CRC tumor tissue and matched blood-derived DNA from
person 009 were prepared according to the procedure for
Hybridization Capture using the Agilent SureSelectXT Low
Input Clinical Research Exome v2 kit. The prepared librar-
ies were sequenced with Illumina sequencing technology
comprising 150 bp paired. Raw FASTQ les underwent
adapter sequence trimming using trimmomatic v.0.38 [38]
and alignment to the human genome reference GRCh37
using BWA v.0.7.12 [31]. Duplicate reads were identied
with Picard v2.8.2. Mean on target coverage for the tumor
and buy coat samples was 499.3 and 79.5 respectively.
Germline variants were called with HaplotypeCaller from
GATK 4.0.0 [39] using GATK’s recommended workow.
Somatic single-nucleotide variants (SNVs) and short inser-
tions and deletions (indels) were called with Mutect2 [40]
with the recommended GATK practices and Strelka v.2.9.2
[41] with Illumina’s recommended workow. Mutations
reported by both callers were ltered to PASS variants with
a minimum variant allele frequency of 0.1 and minimum
depth of 50 reads.
Tumor loss of heterozygosity analysis
Two CRC and two polyp tissue DNA samples from two
carriers of both variants were assessed for loss of hetero-
zygosity (LOH) of the wildtype alleles of the BRCA1 and
RNF43 variants using standard Sanger sequencing pro-
tocols. Short (179 bp) BRCA1 amplicons were gener-
ated using GCAGAAGAGGAATGTGCAACATTCT and
TTATCTTTCTGACCAACCACAGGAA with sequenc-
ing occurring in the reverse direction. Short (182 bp)
RNF43 amplicons were generated using ACAGGC-
TACTCAGGGTCAAATAGAT and CGAATGAGGTG-
GAGTCTTCGA with sequencing occurring in the forward
direction. Tumor tissue DNA was available for a single
CRC from person 009 for extended LOH assessment using
WES tumor data. The captured regions of the genome were
assessed for evidence of LOH by interrogating heterozygous
germline variants in the tumor for their presence as homo-
zygous reference or homozygous alternative in the tumor
tissue. A tumor cellularity estimate of 80% was used. Germ-
line variants with an allele frequency of between 0.4 and 0.6
were considered heterozygous. An allele frequency dier-
ence of 0.3 or greater in the somatic tissue, limited to vari-
ants with a germline depth ≥ 10 and tumor depth ≥ 30, was
considered evidence of LOH. Individual variants suggesting
the presence of LOH were aggregated to determine likely
genomic regions of LOH. The algorithm used is available at
https://github.com/supernifty/LOHdeTerminator.
Tumor mutational signature analysis
SNVs and indels were ltered to those in the capture region.
These ltered SNVs and indels were used to calculate tumor
mutational signatures according to the method given by Sig-
natureEstimation [42] from the set of COSMIC version 3.2
signatures [43] limited to signatures observed in CRC tis-
sue comprising 15 single base substitution (SBS) signatures
and 5 indel (ID) signatures [44] as commonly recommended
[45], including SBS3 and ID6 given their association with
BRCA1 mutations. SBS3 or ID6 present at > 10% or > 20%
proportion in the tumor signature prole, respectively, was
considered positive for defective homologous recombina-
tion-based DNA damage repair (HRD).
Results
Two germline pathogenic variants were identied; one in
BRCA1:c.2681_2682delAA, a frameshift pathogenic vari-
ant located in exon 10 encoding p.Lys894ThrfsTer8, and
another in RNF43:c.988 C>T, a nonsense pathogenic vari-
ant located in exon 9 encoding p.Arg330Ter, in one family
meeting the FCCTX criteria. The family pedigree with can-
cer-aected and carrier status is shown in Fig. 1. No other
loss of function or predicted pathogenic variants were iden-
tied in established hereditary CRC and polyposis genes.
Ten individuals carried the BRCA1:c.2681_2682delAA
variant and eight individuals carried the RNF43:c.988 C>T
variant. Seven individuals carried both pathogenic variants
of whom six were cancer-aected (4 CRC, 1 breast/ovarian
cancer, 1 metastatic cancer of unknown primary). All four
of the CRC-aected relatives tested carried both pathogenic
variants. Only a single carrier of both variants was cancer-
unaected at age 58 (person 026). Where both variants were
tested, two individuals were found to carry only a single
variant, person 018 carried only the BRCA1 variant and per-
son 028 carried only the RNF43 variant, where each likely
represents a separate homologous recombination event on
chromosome arm 17q. Details of carrier status and their
tumors are provided in Table 1.
The proband (person 001), a carrier of both the BRCA1
and RNF43 variants, was diagnosed with an adenocarci-
noma of the caecum at age 53, a peritoneal cancer at age 62
and an ovarian cancer at age 63. MMR immunohistochem-
istry (IHC) of the metastatic lymph nodes indicated the
CRC tumor was MMR-procient. Three colonoscopies per-
formed between the ages of 52 and 62 identied “numerous
1 3
11
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

J. M. Chan et al.
pharyngeal squamous cell carcinoma at age 57 and pros-
tate adenocarcinoma at age 58. Two of the BRCA1 carri-
ers developed breast cancer (persons 025 and 056), one of
whom was diagnosed at 34 years of age; the subtype was
unavailable.
Tumor analysis
The CRCs from persons 009 and 014 were both MMR-pro-
cient by IHC, wildtype for BRAF p.V600 and KRAS codon
12 and 13 somatic mutations and were CIMP-negative
(Table 2) suggesting they had not developed via the serrated
pathway of tumorigenesis. The MMR-procient CRC and
contiguous SSL from person 010 were both BRAF p.V600E
mutation positive and CIMP-high, consistent with develop-
ment via the serrated pathway (Table 2). Sanger sequencing
of the BRCA1 and RNF43 variants in the tubular adenoma,
SSL and CRC from person 010 showed evidence of LOH of
the wildtype allele for both variants in the SSL and adeno-
carcinoma but not the tubular adenoma (Table 2; Fig. 2).
To further investigate tumor etiology, the CRC from per-
son 009 underwent WES. No somatic mutations in BRCA1
and RNF43 were observed, however, loss of the wildtype
allele was evident for both variants. LOH of a larger region
across chromosome arm 17q was detected that included the
BRCA1 and RNF43 genes (Fig. 3). Analysis of COSMIC
tumor mutational signature proles revealed SBS3 (61.8%),
SBS1 (11.3%) and SBS30 (8.9%) as the SNV-derived
small metaplastic polyps” although the number and specic
pathology were not reported, and, therefore, unclear if this
person met the criteria for SPS. She died at age 67.
Two of the proband’s daughters (009 and 010) carried
both the BRCA1 and RNF43 variants and both were CRC-
aected. Person 009 was diagnosed with an MMR-pro-
cient adenocarcinoma of the transverse colon at age 44.
There was no report of synchronous polyps. Person 010 was
diagnosed with a 15 mm moderately dierentiated adeno-
carcinoma of the sigmoid colon at age 56, which appeared
to have arisen from an SSL. Nine colonoscopy procedures
between the ages of 40 and 63 revealed multiple serrated
and adenomatous polyps. At the age of 56, a colonoscopy
revealed a 10 mm hyperplastic polyp in the transverse colon
in addition to the CRC. At the age of 59, a repeat colonos-
copy showed a 6–8 mm adenomatous polyp and a 6–8 mm
SSL in the ascending colon and two 6–8 mm hyperplastic
polyps in the left colon. At the age of 62, a further colo-
noscopy showed a 5–8 mm hyperplastic polyp in the rec-
tum. Including the SSL from which the adenocarcinoma
had arisen from, person 010 met the 2019 WHO diagnostic
criterion 1 for SPS [10].
Person 014 (a brother of the proband) was a carrier of
the BRCA1 and RNF43 variants. He was diagnosed with an
MMR-procient adenocarcinoma of the transverse colon at
age 56 and a prostate cancer at age 71. Person 018 (another
brother of the proband) was a carrier of the BRCA1 vari-
ant but not the RNF43 variant. He was diagnosed with
Fig. 1 Pedigree diagram for a family with colorectal cancer, serrated polyposis syndrome and BRCA1:c.2681_2682delAA and RNF43:c.988 C>T
germline pathogenic variants. The indicated carriers include obligate carriers
1 3
12
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family
Table 1 Cancer and colonic polyp history together with the carrier status of the BRCA1:c.2681_2682delAA and RNF43:c.988 C>T germline
pathogenic variants in people from a family meeting FCCTX criteria
Person Sex BRCA1:c.2681_2682delAA RNF43:c.988 C>TAge at
diagnosis
Tumor type Tumor location Tumor histologic type
001 F Carrier Carrier 53 CRC Caecum Adenocarcinoma
62 Peritoneal NA NA
63 Ovarian NA NA
002 F unknown unknown 58 CRC Colon Adenocarcinoma
005 F unknown unknown 67 Intestinal NA NA
006 M unknown unknown 80 Laryngeal Larynx NA
009 F Carrier Carrier 44 CRC Transverse colon Adenocarcinoma
010aF Carrier Carrier 44 Colonic polyp Ascending colon Tubular adenoma
56 CRC Sigmoid colon Adenocarcinoma
(15 mm) (background of
SSL on histology)
56 Colonic polyp Transverse colon Hyperplastic polyp
(10 mm)
59 Colonic polyp Ascending colon Adenomatous polyp
(6–8 mm)
59 Colonic polyp Ascending colon SSL (6–8 mm)
59 Colonic polyp Sigmoid colon 2 hyperplastic polyps
(6–8 mm)
62 Colonic polyp Rectum Hyperplastic polyp
(5–8 mm)
011 F Wildtype Wildtype 61bunaected
012 M Wildtype Wildtype 60bunaected
013 F unknown unknown NA Uterine NA NA
014 M Carrier Carrier 56 CRC Transverse colon Adenocarcinoma
71 Prostate Prostate NA
016 M Wildtype Wildtype 46 Lymphoma Right neck lymph
node
Follicular lymphoma
017 F Wildtype Wildtype 50bunaected
018 M Carrier Wildtype 57 Laryngeal Larynx Squamous cell carcinoma
58 Prostate Prostate (Right
lobe)
Adenocarcinoma
021 F Wildtype Wildtype 34 Cervical Uterus cervix NA
023 M Wildtype Wildtype 54bunaected
024 F Wildtype Wildtype 84bunaected
025 F Obligate carrier Obligate carrier 34 Breast NA NA
026 M Carrier Carrier 58bunaected
027 M Carrier Carrier 57 Metastatic
cancer of liver
with unknown
primary
Liver NA
028 F Wildtype Carrier 54bunaected
030 M Wildtype Wildtype 82bunaected
034 F unknown unknown NA Intestinal NA NA
036 F Wildtype Wildtype 50 Endometrial Uterus Adenocarcinoma
042 F Wildtype Wildtype 44bunaected
045 M unknown unknown NA Lung NA NA
047 F unknown unknown NA Kidney NA NA
055 M Wildtype NA c35bunaected
056 F Carrier NA cNA Breast NA NA
100 F Carrier NA 28bunaected
101 F Wildtype NA 26bunaected
a cumulative serrated polyp history fulls criteria for Serrated Polyposis Syndrome
b age at last contact
c clinical testing for the BRCA1 variant only was undertaken
Abbreviations: NA, not available; CRC, colorectal cancer; F, female; M, male; SSL, sessile serrated lesion
1 3
13
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

J. M. Chan et al.
Table 2 Molecular characteristics of tumors from the family co-segregating the BRCA1:c.2681_2682delAA and RNF43:c.988 C>T germline pathogenic variants
Person Germline
BRCA1:c.2681_2682delAA
Germline
RNF43:c.988 C > T
Sample
description
Ana-
tomical
site
MMR
status
by
IHC
LOH in
BRCA1
LOH
in
RNF43
SBS
mutational
signature
proportions
ID muta-
tional
signature
proportions
CIMP
status
BRAF
p.V600E
KRAS
codon
12 &
13
Somatic mutations
001 Carrier Carrier Lymph
node
metastasis
from cecal
cancer
Lymph
node
Pro-
cient
NA NA NA NA NA NA NA
009 Carrier Carrier Adenocar-
cinoma
Trans-
verse
colon
Pro-
cient
YesaYe saSBS3
(61.8%),
SBS1
(11.3%),
SBS30
(8.9%)
ID6
(65.2%),
ID5
(30.5%),
ID1 (4.3%)
Nega-
tive
Absent WT TP53
NM_000546.5:c.949del
010 Carrier Carrier Tubular
adenoma
Ascend-
ing
colon
Pro-
cient
No No NA NA Nega-
tive
Absent WT
010 Carrier Carrier Sessile ser-
rated lesion
Sig-
moid
colon
NA Yes Yes NA NA Posi-
tive
(high)
Present WT
010 Carrier Carrier Adenocar-
cinoma
Sig-
moid
colon
NA Yes Yes NA NA Posi-
tive
(high)
Present WT
014 Carrier Carrier Adenocar-
cinoma
Trans-
verse
colon
Pro-
cient
NA NA NA NA Nega-
tive
Absent WT
018 Carrier WT Squa-
mous cell
carcinoma
Larynx Pro-
cient
NA NA NA NA NA NA NA
a Loss of heterozygosity (LOH) was determined from the whole exome sequencing data for this tumor
Abbreviations: WT, wild type; NA, no information/not tested; MMR, mismatch repair; IHC, immunohistochemistry; LOH, loss of heterozygosity; CIMP, CpG Island Methylator Phenotype,
SBS, single base substitution; ID, insertion/deletion
1 3
14
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family
suppressor genes (Fig. 3) conrms that both BRCA1 and
RNF43 had biallelic inactivation. The presence of both
the tumor mutational signatures SBS3 and ID6 at high
levels (> 50%), which is associated with HRD, and the
absence of serrated pathway molecular characteristics,
namely the BRAF p.V600E mutation and CIMP-high,
suggests that tumorigenesis for the CRC from person 009
was driven by HRD deciency related to BRCA1 inacti-
vation. In contrast, biallelic inactivation of BRCA1 and
RNF43 was also present in the CRC from person 010
with the tumor demonstrating characteristics of the ser-
rated pathway (BRAF p.V600E mutation and high levels
of CIMP), suggesting that for this tumour tumorigenesis
may have been driven by RNF43 deciency.
Germline pathogenic variants in BRCA1 predispose
carriers to signicantly elevated risks of breast and ovar-
ian cancers [46], but the relationship between BRCA1
and CRC susceptibility is less clear [22]. A recent meta-
analysis and systematic review showed BRCA1 and/or
BRCA2 pathogenic variant carriers did not have a higher
risk of developing CRC [47]. Past studies have suggested
BRCA2 may underlie CRC development in FCCTX fami-
lies, however, there is little evidence implicating BRCA1
[48, 49]. In the current study, ten family members carried
signatures with the highest proportion. The observed indels
in this tumor were decomposed into the signatures ID6
(65.2%), ID5 (30.5%) and ID1 (4.3%), with the predomi-
nance of both SBS3 and ID6 indicative of defective homol-
ogous recombination-based DNA damage repair (HRD); the
contexts of SBS3 and ID6 are compared to those observed
in 009 in Fig. 4.
The top plot covers the whole of chromosome 17. The
middle plot covers a region around BRCA1. The bottom plot
covers a region around RNF43.
Discussion
This study identies a family meeting the criteria for
FCCTX where a germline BRCA1:c.2681_2682delAA
p.Lys894ThrfsTer8 pathogenic variant and a germline
RNF43:c.988 C>T p.Arg330Ter pathogenic variant co-
segregated with CRC in four carriers, one of whom was
conrmed to meet the WHO2019 diagnostic criteria 1 for
SPS. Tumor analysis demonstrated loss of the wildtype
allele for both variants in the two CRCs tested. As both
BRCA1 and RNF43 reside on chromosome 17q, the LOH
observed across the region encompassing both these tumor
Fig. 2 Sanger sequencing of the BRCA1:c.2681_2682delAA (left col-
umn) and RNF43:c.988 C>T (right column) pathogenic variants in a
tubular adenoma, sessile serrated lesion (SSL), and colorectal cancer
(CRC) for person 010 showing loss of heterozygosity (LOH) of the
wildtype allele for both variants in the sessile serrated lesion and CRC
but not the tubular adenoma
1 3
15
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

J. M. Chan et al.
Fig. 3 Allele frequency plot for a colorectal tumor of a person (person 009) with BRCA1:c.2681_2682delAA and RNF43:c.988 C>T germline
pathogenic variants showing loss of heterozygosity across chromosome 17, including BRCA1 and RNF43
1 3
16
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family
high proportion of HRD-related SBS3 and ID6 muta-
tional signatures. Despite this, it is possible that RNF43
deciency has also contributed to the initiation and/or
progression of tumorigenesis in this person together with
HRD.
the BRCA1 variant, four developing CRC with only
three developing a breast or ovarian cancer. Tumor WES
derived analysis from the single CRC from person 009
demonstrated that tumorigenesis was dominated by the
BRCA1 variant-related HRD process, evidenced by the
Fig. 4 Comparing SNV-derived
mutational contexts of a person
with BRCA1:c.2681_2682delAA
and RNF43:c.988 C > T germline
pathogenic variants (person 009)
(A) with defective homologous
recombination-based DNA dam-
age repair associated signature
SBS3 (B), and similarly, indel-
derived contexts of person 009
(C) with ID6 (D)
1 3
17
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

J. M. Chan et al.
Conclusion
In summary, we have identied coinheritance of patho-
genic germline variants in BRCA1 and RNF43 segregating
with CRC in a family previously characterized as FCCTX.
One individual satised the diagnostic criteria for SPS, and
there was evidence for a somatic second-hit in BRCA1 and
RNF43 in the form of LOH. Bioinformatic analysis showed
that the tumorigenesis was predominantly driven by the
BRCA1 variant with LOH, as indicated by the HRD-related
mutational signatures in the tumor. Our study highlights a
possible role of digenic inheritance underlying FCCTX.
Acknowledgements We thank the members of the Colorectal Oncoge-
nomics Group for their support of this manuscript. We thank the par-
ticipants and sta from the Australasian Colorectal Cancer Family
Registries (ACCFR) and especially thank Allyson Templeton, Maggie
Angelakos, and Samantha Fox for supporting this study. We thank the
Australian Genome Research Facility and Melbourne Bioinformatics
for their collaboration and support of this work.
Author contributions D.D.B., M.C., F.A.M., I.M.W., and M.A.J. con-
ceived the project and designed the study and analysis. S.J., M.C., P.G.,
K.M., J.E.J., R.W., J.C., S.P., S.M.C., Y.C. A.L.M., B.J.P., D.D., C.R.,
M.A.J. and D.D.B. contributed to the acquisition of study data. J.M.C.,
M.C., P.G., K.M., J.E.J., R.W., J.C., S.P. and D.D.B. contributed to the
analysis of the data. J.M.C. and D.D.B. drafted the manuscript. All
authors provided critical revision of the manuscript and approved the
nal version.
Funding The design, analysis and interpretation of data for this study
was supported by a Cancer Council Victoria project grant (PI Winship).
DDB is supported by an NHMRC Investigator grant (GNT1194896)
and University of Melbourne Dame Kate Campbell Fellowship. RW
is supported by Lynch syndrome Australia. PG is supported by Can-
cer Council of Victoria Fellowship. MAJ is supported by an NHMRC
Investigator grant (GNT1195099). Research reported in this publica-
tion was supported by the National Cancer Institute of the National
Institutes of Health under Award Number U01CA167551 and through
a cooperative agreement with the Australasian Colorectal Cancer
Family Registry (NCI/NIH U01 CA074778 and U01/U24 CA097735)
and by the Victorian Cancer Registry, Australia. The content of this
manuscript does not necessarily reect the views or policies of the Na-
tional Cancer Institute or any of the collaborating centres in the Colon
Cancer Family Registry (CCFR), nor does mention of trade names,
commercial products, or organizations imply endorsement by the US
Government or the CCFR.
Declarations
Conicts of interests The authors report there are no conicts of inter-
ests to be declared.
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation, distribution and reproduction in any medium or format,
as long as you give appropriate credit to the original author(s) and the
source, provide a link to the Creative Commons licence, and indicate
if changes were made. The images or other third party material in this
article are included in the article’s Creative Commons licence, unless
indicated otherwise in a credit line to the material. If material is not
Somatic mutations in RNF43 play a role in colorectal
tumorigenesis including in the serrated pathway [50–54].
Furthermore, although rare in SPS [19], several studies
have now provided evidence that germline RNF43 vari-
ants are associated with SPS [14–19, 53]. Only a few
of these studies have investigated segregation of the
RNF43 variant with SPS in the family. Of note, a study
by Taupin et al. [15] identied a germline nonsense vari-
ant in RNF43 (c.394 C>T p.Arg132Ter) in two siblings
aected with SPS, one developed CRC and a study by
Yan et al. [17] identied a germline splice site variant
(c.953-1 G>A) in RNF43 carried by six people from the
family. Five of the six carriers met the WHO2010 criteria
for SPS with a second somatic hit in RNF43 (predomi-
nantly LOH) identied in all 22 cancers/polyps analyzed
[17]. There were eight carriers of the RNF43:c.988 C>T
p.Arg330Ter variant in the family from this study, four
were CRC-aected and a single carrier was conrmed to
meet the WHO2019 criteria for SPS. Furthermore, LOH
was observed as the second somatic hit in both CRCs
tested and in an SSL polyp. [16, 17] Our ndings add fur-
ther support for the association between germline RNF43
variants and susceptibility to SPS and CRC.
Tumor mutational signature analysis is an important
tool for understanding tumor etiology and for predicting
response to cancer therapies, including the use of PARP
inhibitors for cancers with HRD [55]. Of the current
COSMIC mutational signatures, SBS3 and ID6 are asso-
ciated with HRD, which are associated with defects in
BRCA1, BRCA2 or other genes involved in the homolo-
gous recombination pathway [55, 56], although HRD in
CRC is not commonly observed [57]. In the CRC from
person 009, both SBS3 and ID6 were the dominant muta-
tional signatures, supporting HRD related to the germline
BRCA1 variant.
This study has several limitations. Phenotype data was
not available from all family members including incom-
plete or historic colonoscopy and/or pathology reports
that meant some of the colonic polyp number and mor-
phological classication was not denitive or equivalent
to contemporary polyp classication. Little data was
obtained from earlier generations as those generations
were deceased prior to commencing a detailed investiga-
tion. Furthermore, the tumor tissue for molecular testing
was limited with only a single CRC with sucient DNA
for WES and therefore, conrmation that HRD associ-
ated mutational signatures were the dominant mutational
process in the other CRCs from BRCA1 carriers could
not be determined. Further investigation of HRD in CRC
tumorigenesis is needed.
1 3
18
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family
16. Quintana I, Mejías-Luque R, Terradas M, Navarro M, Piñol V,
Mur P et al (2018) Evidence suggests that germline RNF43 muta-
tions are a rare cause of serrated polyposis. Gut 67(12):2230–2232
17. Yan HHN, Lai JCW, Ho SL, Leung WK, Law WL, Lee JFY
et al (2017) RNF43 germline and somatic mutation in serrated
neoplasia pathway and its association with BRAF mutation. Gut
66(9):1645–1656
18. Mikaeel RR, Young JP, Li Y, Poplawski NK, Smith E, Horsnell M
et al (2022) RNF43 pathogenic germline variant in a family with
Colorectal cancer. Clin Genet 101(1):122–126
19. Buchanan DD, Clendenning M, Zhuoer L, Stewart JR, Joseland
S, Woodall S et al (2017) Lack of evidence for germline RNF43
mutations in patients with serrated polyposis syndrome from a
large multinational study. Gut 66(6):1170–1172
20. Moynahan ME, Chiu JW, Koller BH, Jasin M (1999) Brca1 con-
trols homology-directed DNA repair. Mol Cell 4(4):511–518
21. Kuchenbaecker KB, Hopper JL, Barnes DR, Phillips KA, Mooij
TM, Roos-Blom MJ et al (2017) Risks of breast, ovarian, and
contralateral Breast Cancer for BRCA1 and BRCA2 mutation
carriers. JAMA 317(23):2402–2416
22. Sopik V, Phelan C, Cybulski C, Narod SA (2015) BRCA1 and
BRCA2 mutations and the risk for Colorectal cancer. Clin Genet
87(5):411–418
23. Phelan CM, Iqbal J, Lynch HT, Lubinski J, Gronwald J, Moller
P et al (2014) Incidence of Colorectal cancer in BRCA1 and
BRCA2 mutation carriers: results from a follow-up study. Br J
Cancer 110(2):530–534
24. Thompson D, Easton DF (2002) Cancer incidence in BRCA1
mutation carriers. J Natl Cancer Inst 94(18):1358–1365
25. Morak M, Massdorf T, Sykora H, Kerscher M, Holinski-Feder
E (2011) First evidence for digenic inheritance in hereditary
Colorectal cancer by mutations in the base excision repair genes.
Eur J Cancer 47(7):1046–1055
26. Schubert SA, Ruano D, Tiersma Y, Drost M, de Wind N, Nielsen
M et al (2020) Digenic inheritance of MSH6 and MUTYH vari-
ants in familial Colorectal cancer. Genes Chromosomes Cancer
59(12):697–701
27. Ciavarella M, Miccoli S, Prossomariti A, Pippucci T, Bonora E,
Buscherini F et al (2018) Somatic APC mosaicism and oligogenic
inheritance in genetically unsolved colorectal adenomatous pol-
yposis patients. Eur J Hum Genet 26(3):387–395
28. Buchanan DD, Clendenning M, Rosty C, Eriksen SV, Walsh MD,
Walters RJ et al (2017) Tumor testing to identify lynch syndrome
in two Australian Colorectal cancer cohorts. J Gastroenterol Hep-
atol 32(2):427–438
29. Jenkins MA, Win AK, Templeton AS, Angelakos MS, Buchanan
DD, Cotterchio M et al (2018) Cohort Prole: the Colon Cancer
Family Registry Cohort (CCFRC). Int J Epidemiol 47(2):387–8i
30. Newcomb PA, Baron J, Cotterchio M, Gallinger S, Grove J, Haile
R et al (2007) Colon Cancer Family Registry: an international
resource for studies of the genetic epidemiology of colon Cancer.
Cancer Epidemiol Biomarkers Prev 16(11):2331–2343
31. Li H, Durbin R (2010) Fast and accurate long-read alignment
with Burrows-Wheeler transform. Bioinformatics 26(5):589–595
32. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N et
al (2009) The sequence Alignment/Map format and SAMtools.
Bioinformatics 25(16):2078–2079
33. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K,
Kernytsky A et al (2010) The genome analysis Toolkit: a MapRe-
duce framework for analyzing next-generation DNA sequencing
data. Genome Res 20(9):1297–1303
34. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR,
Hartl C et al (2011) A framework for variation discovery and
genotyping using next-generation DNA sequencing data. Nat
Genet 43(5):491–498
included in the article’s Creative Commons licence and your intended
use is not permitted by statutory regulation or exceeds the permitted
use, you will need to obtain permission directly from the copyright
holder. To view a copy of this licence, visit http://creativecommons.
org/licenses/by/4.0/.
References
1. Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J,
Koskenvuo M et al (2000) Environmental and heritable factors
in the causation of Cancer — analyses of cohorts of twins from
Sweden, Denmark, and Finland. N Engl J Med 343(2):78–85
2. Lorans M, Dow E, Macrae FA, Winship IM, Buchanan DD
(2018) Update on Hereditary Colorectal Cancer: improving the
clinical utility of Multigene Panel Testing. Clin Colorectal Cancer
17(2):e293–e305
3. Vasen HF, Mecklin JP, Khan PM, Lynch HT (1991) The Interna-
tional Collaborative Group on Hereditary Non-polyposis Colorec-
tal Cancer (ICG-HNPCC). Dis Colon Rectum 34(5):424–425
4. Shiovitz S, Copeland WK, Passarelli MN, Burnett-Hartman AN,
Grady WM, Potter JD et al (2014) Characterisation of familial
Colorectal cancer type X, Lynch syndrome, and non-familial
Colorectal cancer. Br J Cancer 111(3):598–602
5. Lindor NM, Rabe K, Petersen GM, Haile R, Casey G, Baron J et
al (2005) Lower Cancer incidence in Amsterdam-I criteria fami-
lies without Mismatch Repair Deciency: familial Colorectal
Cancer type X. JAMA 293(16):1979–1985
6. Zetner DB, Bisgaard ML (2017) Familial Colorectal Cancer type
X. Curr Genomics 18(4):341–359
7. Carballal S, Rodríguez-Alcalde D, Moreira L, Hernández L,
Rodríguez L, Rodríguez-Moranta F et al (2016) Colorectal cancer
risk factors in patients with serrated polyposis syndrome: a large
multicentre study. Gut 65(11):1829–1837
8. JE IJ, Rana SA, Atkinson NS, van Herwaarden YJ, Bastiaan-
sen BA, van Leerdam ME et al (2017) Clinical risk factors of
Colorectal cancer in patients with serrated polyposis syndrome: a
multicentre cohort analysis. Gut 66(2):278–284
9. Rosty C, Parry S, Young JP (2011) Serrated polyposis: an enig-
matic model of Colorectal Cancer Predisposition. Patholog Res
Int 2011:157073–157013
10. Rosty C, Brosens L, Dekker E, Nagtegaal ID (2019) WHO Classi-
cation of Tumours of the Digestive System: Serrated polyposis.
11. Pai RK, Bettington M, Srivastava A, Rosty C (2019) An update
on the morphology and molecular pathology of serrated colorectal
polyps and associated carcinomas. Mod Pathol 32(10):1390–1415
12. Heald B, Hampel H, Church J, Dudley B, Hall MJ, Mork ME et
al (2020) Collaborative Group of the Americas on inherited gas-
trointestinal Cancer position statement on multigene panel testing
for patients with Colorectal cancer and/or polyposis. Fam Cancer
19(3):223–239
13. Clendenning M, Young JP, Walsh MD, Woodall S, Arnold J, Jen-
kins M et al (2013) Germline mutations in the polyposis-Asso-
ciated genes BMPR1A, SMAD4, PTEN, MUTYH and GREM1
are not common in individuals with serrated polyposis syndrome.
PLoS ONE 8(6):e66705
14. Gala MK, Mizukami Y, Le LP, Moriichi K, Austin T, Yamamoto
M et al (2014) Germline mutations in oncogene-induced senes-
cence pathways are associated with multiple sessile serrated ade-
nomas. Gastroenterology 146(2):520–529
15. Taupin D, Lam W, Rangiah D, McCallum L, Whittle B, Zhang Y
et al (2015) A deleterious RNF43 germline mutation in a severely
aected serrated polyposis kindred. Hum Genome Var 2:15013
1 3
19
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

J. M. Chan et al.
48. Garcia FAO, de Andrade ES, de Campos Reis Galvão H, da Silva
Sábato C, Campacci N, de Paula AE et al (2022) New insights on
familial Colorectal cancer type X syndrome. Sci Rep 12(1):2846
49. Garre P, Martín L, Sanz J, Romero A, Tosar A, Bando I et al
(2015) BRCA2 gene: a candidate for clinical testing in familial
Colorectal cancer type X. Clin Genet 87(6):582–587
50. Giannakis M, Hodis E, Jasmine Mu X, Yamauchi M, Rosen-
bluh J, Cibulskis K et al (2014) RNF43 is frequently mutated in
colorectal and endometrial cancers. Nat Genet 46(12):1264–1266
51. Bond CE, McKeone DM, Kalimutho M, Bettington ML, Pearson
SA, Dumenil TD et al (2016) RNF43 and ZNRF3 are commonly
altered in serrated pathway colorectal tumorigenesis. Oncotarget
7(43):70589–70600
52. Tsai JH, Liau JY, Yuan CT, Lin YL, Tseng LH, Cheng ML et al
(2016) RNF43 is an early and specic mutated gene in the ser-
rated pathway, with increased frequency in traditional serrated
adenoma and its Associated Malignancy. Am J Surg Pathol
40(10):1352–1359
53. van Herwaarden YJ, Koggel LM, Simmer F, Vink-Börger EM,
Dura P, Meijer GA et al (2021) RNF43 mutation analysis in ser-
rated polyposis, sporadic serrated polyps and Lynch syndrome
polyps. Histopathology 78(5):749–758
54. Fennell LJ, Clendenning M, McKeone DM, Jamieson SH,
Balachandran S, Borowsky J et al (2018) RNF43 is mutated less
frequently in Lynch Syndrome compared with sporadic microsat-
ellite unstable colorectal cancers. Fam Cancer 17(1):63–69
55. Póti Á, Gyergyák H, Németh E, Rusz O, Tóth S, Kovácsházi C
et al (2019) Correlation of homologous recombination deciency
induced mutational signatures with sensitivity to PARP inhibitors
and cytotoxic agents. Genome Biol 20(1):240
56. Stok C, Kok YP, van den Tempel N, van Vugt M (2021) Shaping
the BRCAness mutational landscape by alternative double-strand
break repair, replication stress and mitotic aberrancies. Nucleic
Acids Res 49(8):4239–4257
57. Moretto R, Elliott A, Zhang J, Arai H, Germani MM, Conca V
et al (2022) Homologous recombination Deciency alterations in
Colorectal Cancer: clinical, molecular, and prognostic implica-
tions. J Natl Cancer Inst 114(2):271–279
Publisher’s Note Springer Nature remains neutral with regard to juris-
dictional claims in published maps and institutional aliations.
35. Li H (2011) A statistical framework for SNP calling, muta-
tion discovery, association mapping and population genetical
parameter estimation from sequencing data. Bioinformatics
27(21):2987–2993
36. McLaren W, Gil L, Hunt SE, Riat HS, Ritchie GR, Thormann A
et al (2016) The Ensembl variant eect predictor. Genome Biol
17(1):122
37. Rentzsch P, Witten D, Cooper GM, Shendure J, Kircher M (2019)
CADD: predicting the deleteriousness of variants throughout the
human genome. Nucleic Acids Res 47(D1):D886–d94
38. Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a ex-
ible trimmer for Illumina sequence data. Bioinformatics
30(15):2114–2120
39. Poplin R, Ruano-Rubio V, Depristo MA, Fennell TJ, Carneiro
MO, Geraldine AVDA et al (2018) Scaling accurate genetic vari-
ant discovery to tens of thousands of samples. Cold Spring Har-
bor Laboratory Press, Cold Spring Harbor
40. Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jae D,
Sougnez C et al (2013) Sensitive detection of somatic point muta-
tions in impure and heterogeneous cancer samples. Nat Biotech-
nol 31(3):213–219
41. Kim S, Scheer K, Halpern AL, Bekritsky MA, Noh E, Källberg
M et al (2018) Strelka2: fast and accurate calling of germline and
somatic variants. Nat Methods 15(8):591–594
42. Huang X, Wojtowicz D, Przytycka TM (2018) Detecting pres-
ence of mutational signatures in cancer with condence. Bioin-
formatics 34(2):330–337
43. Tate JG, Bamford S, Jubb HC, Sondka Z, Beare DM, Bindal N et
al (2019) COSMIC: the catalogue of somatic mutations in Can-
cer. Nucleic Acids Res 47(D1):D941–d7
44. Alexandrov LB, Kim J, Haradhvala NJ, Huang MN, Tian Ng
AW, Wu Y et al (2020) The repertoire of mutational signatures in
human cancer. Nature 578(7793):94–101
45. Koh G, Degasperi A, Zou X, Momen S, Nik-Zainal S (2021)
Mutational signatures: emerging concepts, caveats and clinical
applications. Nat Rev Cancer 21(10):619–637
46. Narod SA, Foulkes WD (2004) BRCA1 and BRCA2: 1994 and
beyond. Nat Rev Cancer 4(9):665–676
47. Cullinane CM, Creavin B, O’Connell EP, Kelly L, O’Sullivan
MJ, Corrigan MA et al (2020) Risk of Colorectal cancer associ-
ated with BRCA1 and/or BRCA2 mutation carriers: systematic
review and meta-analysis. Br J Surg 107(8):951–959
1 3
20
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Inherited BRCA1 and RNF43 pathogenic variants in a familial colorectal cancer type X family
Authors and Aliations
James M.Chan1,2· MarkClendenning1,2· SharelleJoseland1,2· PeterGeorgeson1,2· KhalidMahmood1,2,3·
Jihoon E.Joo1,2· RomyWalker1,2· JuliaComo1,2· SusanPreston1,2· Shuyi MarciChai1,2· Yen LinChu1,2·
Aaron L.Meyers1,2· Bernard J.Pope1,2,3· DavidDuggan4· J. LynnFink5,6· Finlay A.Macrae7,8·
ChristopheRosty1,2,9,10· Ingrid M.Winship8,11· Mark A.Jenkins2,12· Daniel D.Buchanan1,2,8
Daniel D. Buchanan
daniel.buchanan@unimelb.edu.au
1 Colorectal Oncogenomics Group, Department of Clinical
Pathology, Melbourne Medical School, Victorian
Comprehensive Cancer Centre, The University of
Melbourne, 305 Grattan Street, Parkville, VIC
3010, Australia
2 Centre for Cancer Research, University of Melbourne, The
University of Melbourne, Parkville, VIC, Australia
3 Melbourne Bioinformatics, The University of Melbourne,
Melbourne, VIC, Australia
4 Quantitative Medicine and Systems Biology Division,
Translational Genomics Research Institute (TGen), Phoenix,
AZ, USA
5 Faculty of Medicine, Frazer Institute, The University of
Queensland, Brisbane, QLD, Australia
6 Australian Translational Genomics Centre, Queensland
University of Technology, Brisbane, QLD, Australia
7 Colorectal Medicine and Genetics, Royal Melbourne
Hospital, Parkville, VIC, Australia
8 Genomic Medicine and Family Cancer Clinic, Royal
Melbourne Hospital, Parkville, VIC, Australia
9 Envoi Pathology, Brisbane, QLD, Australia
10 School of Medicine, University of Queensland, Herston,
QLD, Australia
11 Department of Medicine, The University of Melbourne,
Parkville, VIC, Australia
12 Centre for Epidemiology and Biostatistics, The University of
Melbourne, Melbourne, VIC, Australia
1 3
21
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com