Content uploaded by Marianna Sikorska
Author content
All content in this area was uploaded by Marianna Sikorska
Content may be subject to copyright.
BioMed Central
Page 1 of 16
(page number not for citation purposes)
Molecular Neurodegeneration
Open Access
Research article
A novel brain-enriched E3 ubiquitin ligase RNF182 is up regulated
in the brains of Alzheimer's patients and targets ATP6V0C for
degradation
Qing Yan Liu*1,2, Joy X Lei1, Marianna Sikorska1,2 and Rugao Liu3
Address: 1Neurobiology Program, Institute for Biological Sciences, National Research Council of Canada, Ottawa, Ontario, K1A 0R6, Canada,
2Faculty of Medicine, University of Ottawa, Ottawa, Canada and 3Department of Anatomy and Cell Biology, University of North Dakota, School
of Medicine, 501 N. Columbia Road, Grand Forks, ND 58202, USA
Email: Qing Yan Liu* - qing_yan.liu@nrc.gc.ca; Joy X Lei - joy.lei@nrc.gc.ca; Marianna Sikorska - marianna.sikorska@nrc.gc.ca;
Rugao Liu - rliu@medicine.nodak.edu
* Corresponding author
Abstract
Background: Alterations in multiple cellular pathways contribute to the development of chronic
neurodegeneration such as a sporadic Alzheimer's disease (AD). These, in turn, involve changes in
gene expression, amongst which are genes regulating protein processing and turnover such as the
components of the ubiquitin-proteosome system. Recently, we have identified a cDNA whose
expression was altered in AD brains. It contained an open reading frame of 247 amino acids and
represented a novel RING finger protein, RNF182. Here we examined its biochemical properties
and putative role in brain cells.
Results: RNF182 is a low abundance cytoplasmic protein expressed preferentially in the brain. Its
expression was elevated in post-mortem AD brain tissue and the gene could be up regulated in vitro
in cultured neurons subjected to cell death-inducing injuries. Subsequently, we have established that
RNF182 protein possessed an E3 ubiquitin ligase activity and stimulated the E2-dependent
polyubiquitination in vitro. Yeast two-hybrid screening, overexpression and co-precipitation
approaches revealed, both in vitro and in vivo, an interaction between RNF182 and ATP6V0C,
known for its role in the formation of gap junction complexes and neurotransmitter release
channels. The data indicated that RNF182 targeted ATP6V0C for degradation by the ubiquitin-
proteosome pathway. Overexpression of RNF182 reduced cell viability and it would appear that
by itself the gene can disrupt cellular homeostasis.
Conclusion: Taken together, we have identified a novel brain-enriched RING finger E3 ligase,
which was up regulated in AD brains and neuronal cells exposed to injurious insults. It interacted
with ATP6V0C protein suggesting that it may play a very specific role in controlling the turnover
of an essential component of neurotransmitter release machinery.
Background
Alterations in multiple biological pathways contribute to
the development of a sporadic Alzheimer's disease (AD).
Amongst these are excessive oxidative stress and insuffi-
cient antioxidant defenses, disrupted calcium homeosta-
sis, altered cholesterol synthesis, inappropriate hormonal
Published: 25 February 2008
Molecular Neurodegeneration 2008, 3:4 doi:10.1186/1750-1326-3-4
Received: 15 November 2007
Accepted: 25 February 2008
This article is available from: http://www.molecularneurodegeneration.com/content/3/1/4
© 2008 Liu et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 2 of 16
(page number not for citation purposes)
and growth factor signaling, chronic inflammation, aber-
rant re-entry of neurons into the cell cycle and, especially,
altered protein processing, folding and turnover. The later
abnormalities lead to β-amyloid peptide production and
senile plagues development, tau hyperphosphorylation
and neurofibrillary tangles (NFTs) formation [1,2]. Col-
lectively these changes contribute the loss of synapse, neu-
ronal death and ultimately brain atrophy and dementia
characteristic of this disease. However, the scope and com-
plexity of these changes are such that the etiology of spo-
radic AD still remains elusive.
Recent advances in molecular biology have introduced
new, high-throughput tools for the analysis of differential
gene expression in complex diseases such as AD. They
allow simultaneous overviews of the changes in gene
expressions or protein levels for multiple cellular path-
ways. The most commonly used technology for the assess-
ment of gene expression changes in postmortem brains is
the DNA microarray [3-7]. However, this method requires
prior knowledge of gene sequences and cannot be applied
as a discovery tool for novel transcripts. Furthermore, the
expression levels of low abundance genes cannot readily
be assessed by DNA microarray hybridization, as reliable
results are usually obtained only for genes that are
expressed in high or moderate levels. This is a significant
limitation as many transcripts expressed preferentially in
the brain (e.g., neurotransmitter receptors and their regu-
latory factors) are present at very low levels [8,9].
Recently, we employed a subtractive hybridization and
RNA amplification method to enrich and isolate rare and
novel transcripts from AD brains [10]. Using this
approach, we have isolated more than 200 genes, which
are deferentially expressed, amongst these was a novel
brain-enriched sequence that not only was up regulated in
AD brains, but also in neuronal cells subjected to injuries.
Here we have described the cloning and characterization
of this gene, which encodes a RING finger domain con-
taining protein, resembling an ubiquitin E3 ligase and
designated RNF182. We have established that RNF182
can stimulate E2-dependent polyubiquitination in vitro
and identified an interaction between RNF182 and
ATP6V0C. This interaction facilitates the degradation of
ATP6V0C via the ubiquitin-proteosome pathway. Overex-
pression of RNF182 in N2a cells accelerated cell death and
it's downregulation reduced cells' response to injurious
insults.
Results
RNF182 is a novel RING finger-containing transmembrane
protein
We have isolated a 300 bp cDNA fragment, 360nh, by
subtractive hybridization using a pooled mRNA popula-
tion from AD brains as a "tester" and the first strand
cDNAs from a pooled age-matched control brains as a
"driver" [10]. BLAST searches revealed that this fragment
showed a significant sequence identity with human
genomic clone RP11-127P7 on chromosome 6 (GenBank
AL138718). No matching EST or mRNA for this 360nh
sequence was found in GenBank. Genome BLAT analysis
indicated that there exists a mRNA sequence (GenBank
AK090576) that appeared to be transcribed from the same
region of genomic DNA on chromosome 6. This mRNA
contains an open reading frame (ORF) encoding a protein
with a RING finger domain, dubbed RNF182. Although
this mRNA had a 5' end sequence matching the genomic
sequence upstream of where 360nh was derived, it did not
contain the 360nh sequence. We speculated that the
360nh sequence might be on an alternatively spliced exon
of the same gene. We, therefore, used a forward primer on
the 5' end of 360nh and a reverse primer within the cod-
ing region of RNF182 to amplify any alternative transcript
sequence from first strand cDNA synthesized from human
brain mRNA. Sequence analysis of the resulting PCR frag-
ment indicated that genomic fragment AL138718, indeed,
contained a gene of four exons giving rise to two alterna-
tively spliced transcripts by swapping exons 1 and 2 (Fig.
1). Both transcripts contain the same ORF, thus encoding
the same protein of 247 amino acids, with calculated
molecular mass of 27.4 kDa. The 360nh sequence was
located in exon 2, which constitutes part of the 5' untrans-
lated region of transcript II. Protein sequence comparison
revealed that human RNF182 is highly homologous to
those of rodents', with 98% and 97% sequence identity to
mouse and rat, respectively. The predicted primary struc-
ture of this protein contained a typical C3HC4-type RING
finger domain between amino acids C20 and C67. There
are two putative transmembrane helices located at the C-
terminus, spanning amino acids 178 to 200, 212 to 234,
respectively. In addition, the primary sequence of RNF182
also suggested four leucine repeats between amino acids
197 and 225. These repeats are within the two transmem-
brane domains, but do not correspond to a leucine zipper
(Fig. 1).
The expression patterns of RNF182
RNF182 is a weakly expressed gene, not detectable by
Northern blotting. Quantitative RT-PCR analysis indi-
cated that the gene was up regulated during retinoic acid
(RA) – induced differentiation of human NT2 cells. The
increased level of RNF182 transcripts II was detected in
both NT2 neurons and NT2 astrocytes (Fig. 2A). This was
further confirmed by Western analysis using anti-RNF182
antibody (Fig. 2B). Next, we analyzed the tissue distribu-
tion of RNF182 by semi-quantitative RT-PCR using a
primer pair from the coding region of the gene (Fig. 2C).
A single band of 395 bp product was detected in the
mouse cortex, hippocampus, cerebellum and spinal cord,
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 3 of 16
(page number not for citation purposes)
A schematic representation of the human RNF182 gene, transcript and protein structuresFigure 1
A schematic representation of the human RNF182 gene, transcript and protein structures. Solid lines refer to
introns or non-transcribed genomic DNA. Hatched bars represent exons. The RNF182 gene (GenBank AL138718) contains
four exons. The open reading frame (black bar) and 3' untranslated region of both transcripts are solely encoded by exon 4.
Structural motifs of the encoded protein were predicted by ExPASy tools.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 4 of 16
(page number not for citation purposes)
Expression pattern of RNF182 geneFigure 2
Expression pattern of RNF182 gene. A. Changes in mRNA levels of RNF182 transcript during RA-induced differentiation
of NT2 cells were determined by quantitative RT-PCR. The samples were measured against the cDNA of undifferentiated NT2
cells as a control, set at 100%. Percentage of each sample was calculated by 100x 2-ΔCt, where ΔCt is the cycle number differ-
ence between test sample and the control sample. undiff – undifferentiated NT2 cells (control), NT2N – NT2 neurons, NT2A
– NT2 astrocytes. The experiments were performed in triplicate. Asterisks indicate a significant difference (ρ < 0.05; ANOVA,
followed by Bonferronic test). B. Changes in RNF182 protein levels were determined by Western blotting with anti-RNF182
antibody using 100 μg/lane of total cellular protein. The Western blotting of β-actin was shown as loading control. C. Ethidium
bromide stained agarose gel of RT-PCR products amplified from the coding region of RNF182 (top panel) and β-actin (bottom
panel) from various mouse tissues: lane M – molecular size marker, lane 1 – kidney, lane 2 – skeletal muscle, lane 3 – liver, lane
4 – heart, lane 5 – cortex, lane 6 – hippocampus, lane 7 – cerebellum, lane 8 – spinal cord, lane 9 – negative PCR control.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 5 of 16
(page number not for citation purposes)
but not in heart, liver, kidney or skeletal muscle, indicat-
ing that RNF182 was a brain-enriched gene.
To examine the cellular localization of RNF182, we sub-
cloned the coding region of RNF182 into the pEGFP-N1
vector where EGFP was fused to the carboxy terminus of
RNF182. The plasmid construct was transiently trans-
fected into N2a cells to allow fluorescence detection. The
same cell culture was also stained with anti-RNF182 anti-
body. The non-transfected cell population demonstrated
a speckled distribution of endogenous RNF182 protein in
the cytoplasm (Fig. 3 panel RNF182, arrows). Fluorescent
microscopy of transiently transfected N2a cells revealed a
strong signal of the recombinant RNF182 protein
throughout the cytoplasm in both differentiated and
undifferentiated cells (panel EGFP). No fluorescent signal
was observed in the nuclei. Transfected cells showed
much stronger staining of RNF182 (Fig. 3 panel RNF182,
asterisk), representing a combined signal of both endog-
enous and exogenous RNF182 protein.
RNF182 is up regulated in AD brains and in NT2 neurons
subjected to injuries
Since the RNF182 was found in the subtracted cDNA
library containing genes potentially up regulated in AD
brains, we re-examined these changes by qRT-PCR analy-
sis (Fig. 4A) of the RNA pools used to construct the origi-
nal AD and control cDNA libraries [10]. These results were
subsequently confirmed using 10 individual brain sam-
ples from a tissue bank (Table 1). As shown in Fig. 4B the
RNF182 transcript level was consistently higher in AD
brain in comparison to the age-matched controls. We also
analyzed the RNF182 expression level in post-mitotic NT2
neurons subjected to oxygen and glucose deprivation
(OGD), which has been previously reported to trigger
neuronal cell death [11]. Here, initially the cells were sub-
jected to 2 h ODG treatment during which 10–15% of
cells lost viability, followed by a 16 h recovery period, at
the end of which the cell death reached 35–40%. The
RNF182 mRNA was significantly up regulated after the
OGD treatment (Fig. 4C) and the change in protein level
was verified by Western blot analysis (Fig. 4D). These NT2
neurons were insensitive to 20 μM β-amyloid peptide
alone, however, when the peptide was added to the cul-
ture medium during the OGD and re-oxygenation treat-
ment approximately 55–60% cells died of apoptosis (Fig.
4E, insert). The expression level of RNF182 was doubled
after this treatment (Fig. 4E). Taken together, our results
indicated that RNF182 was up regulated not only in neu-
ronal cells subjected to the cell death inducing injuries,
but also in AD brains where neurodegeneration had
become evident.
Overexpression of RNF182 triggers cell death and its
downregulation reduces cell death caused by OGD in N2a
cells
To better understand the role of RNF182 in neurodegen-
eration we examined the effects of gene overexpression in
N2a cell line. We cloned the coding region of RNF182
into a mammalian expression vector, pEGFP-N1, with a
stop codon inserted between the end of the RNF182 and
the beginning of EGFP. As a result, a faint green fluores-
cent signal was observed in the cells transfected with the
plasmid construct, but the RNF182 protein was free to
perform its routine function without the possible interfer-
ence of the EGFP. A significant increase in RNF182 mRNA
was observed 24 h after transfection (Fig. 5A). The overex-
pression of RNF182 by itself triggered cell death in N2a
cells as compared with mock transfection of empty vector
(Fig. 5B). The cell death was not caused by the transfection
Subcellular localization of RNF182Figure 3
Subcellular localization of RNF182. N2a cells were transiently transfected with pEGFP-RNF182 plasmid DNA. Cells were
fixed and stained with anti-RNF182 antibody. Cy3-conjugated anti-rabbit IgG was used to detect the specific immunostaining.
The nuclei were stained with DAPI and viewed with a Zeiss Axiovert 200 M × 63 fluorescence microscope. Arrows indicate
non-transfected cells. Asterisk represents a transfected cell.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 6 of 16
(page number not for citation purposes)
Upregulation of RNF182 in AD brains and in NT2 neurons treated the cell death-inducing stressesFigure 4
Upregulation of RNF182 in AD brains and in NT2 neurons treated the cell death-inducing stresses. A. Changes
in mRNA levels of RNF182 transcript in control and AD brains were determined by qRT-PCR. The cDNA samples were pre-
pared from pooled mRNA of 4 AD and 5 age-matched control subjects. The value of the control sample was set at 100%. The
percentage of the AD sample was calculated by 100x 2-ΔCt, where ΔCt is the cycle number difference between the AD sample
and the control sample. The experiments were performed in triplicate. Asterisk indicates a significant difference (ρ < 0.005; t-
test). B. Changes in mRNA levels of RNF182 transcript in individual control and AD brains were determined by qRT-PCR. The
cDNA samples were prepared from mRNA of 5 AD and 5 age-matched control subjects. The qRT-PCR results were calcu-
lated against the average result (control mean) of the control samples, set at 100%. Percentage of each sample was calculated
by 100x 2-ΔCt, where ΔCt is the cycle number difference between each sample and the control mean. The experiments were
performed in triplicate. C. Changes in mRNA levels of RNF182 transcript in NT2 neurons treated with OGD and OGD with
16 h recovery were determined by qRT-PCR. The samples were measured against the cDNA of untreated NT2 neurons as a
control, set at 100%. Percentage of each treated sample was calculated by 100x 2-ΔCt, where ΔCt is the cycle number differ-
ence between treated sample and the control sample. The experiments were performed in triplicate. Asterisks indicate a sig-
nificant difference (ρ < 0.05; ANOVA, followed by Bonferronic test). D. Changes in RNF182 protein levels in NT2 neurons
treated with OGD and OGD plus 16 h recovery were determined by Western blotting with anti-RNF182 antibody using 120
μg/lane of total cellular protein. The Western blotting of β-actin was shown as loading control. E. Changes in mRNA levels of
RNF182 transcript in NT2 neurons treated with OGD plus 20 μM β-amyloid peptide and OGD plus 20 μM β-amyloid peptide
with 16 h recovery were determined by qRT-PCR. The samples were measured against the cDNA of untreated NT2 neurons
as a control, set at 100%. Percentage of each treated sample was calculated by 100x 2-ΔCt, where ΔCt is the cycle number dif-
ference between treated sample and the control sample. The experiments were performed in triplicate. Asterisks indicate a
significant difference (ρ < 0.05; ANOVA, followed by Bonferronic test). Insert: Nuclear morphology of OGD plus Aβ treated
cells was examined under an Olympus B x 50 fluorescence microscope after fixing and staining the cells with DAPI.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 7 of 16
(page number not for citation purposes)
reagent as removing it did not alter the outcome (Fig. 5C).
The subsequent challenge with OGD caused additional
loss of cells in both control and the RNF182 transfected
cultures (5D). Next, we down regulated the endogenous
RNF182 in N2a cells using a mixture of four siRNAs tar-
geting mouse RNF182 gene. The RNF182 transcript was
knocked down 24 h after the siRNA transfection (Fig. 5E,
lane 1) and still remained low 48 h later (Fig. 5E, lane 3).
The transfected cells (after 24 h) were subjected to 7 h
OGD treatment and 16 h re-oxygenation in a normal cul-
ture chamber and examined for cell viability (Fig. 5F). The
results showed that the downregulation of the endog-
enous RNF182 significantly reduced the percentage of cell
death caused by OGD treatment.
RNF182 exhibits ubiquitin E3 ligase activity
Many proteins that contain RING finger domains exhibit
ubiquitin E3 ligase activity. Some of these RING finger
proteins catalyze substrate-independent, but E2-depend-
ent assembly of multi-ubiquitin chains in reaction mix-
tures containing ubiquitin, E1, E2 and the RING finger
protein itself [12-14]. E3, GST and bacterial proteins from
the cell lysate can all serve as potential substrates. With
this in mind, we performed an in vitro ubiquitination
assay to assess whether RNF182 has an E2-dependent E3
ligase activity. An ubiquitination pattern consisting of a
high molecular weight smear was obtained from the reac-
tions containing his-tag RNF182 (Fig. 6), whereas none
was detected in the absence of RNF182, indicating that
RNF182 can function as an E3 ubiquitin ligase. A reaction
mixture of E1, E2 and GST-SIAH-1 was used as a positive
control. Other controls included RNF182 alone, reactions
omitting E3 (RNF182 or GST-SiAH-1), E1, E2 or ubiqui-
tin, all gave negative results. We did not observe apparent
auto-ubiquitination of RNF182 by Western blotting of the
same blot probed with anti-RNF182 antibody (data not
shown), suggesting that the pattern observed in figure 6
was mostly from the ubiquitination of proteins from the
bacterial cell lysate. Adding proteins extracted from bacte-
rial clones expressing GST-ATP6V0C or GST alone gave a
similar intensity of smears (data not shown). These results
confirmed the hypothesis that RNF182 could function as
a substrate-independent, E2-dependent E3 ubiquitin
ligase.
The C-terminal domain of RNF182 interacts with ATPV0C
Since the primary structure of RNF182 contained a RING
finger domain and leucine repeats, which often partici-
pate in protein-protein interactions, we used yeast two-
hybrid screening to identify a potential RNF182 interact-
ing proteins in human brain. Yeast strain AH109 harbor-
ing the two-hybrid construct (pGBKT7-RNF182)
expressing full length human RNF182 was used to screen
a human brain cDNA library. Among 18 clones that dis-
played Ade/His prototype and β-galactosidase activity, 7
were found to represent a single unique gene encoding
human ATPase, H+ transporting, lysosomal 16 kDa, V0
subunit C (ATP6V0C). The interaction between these two
proteins was reproducibly reconstructed in the yeast two-
hybrid system and it passed all required tests (Fig. 7A).
Because the endogenous level of RNF182 was very low, in
order to establish the interaction of these two proteins in
vivo, we fused the RING finger domain, C-terminal
domain and full length coding region of RNF182 with
GST, which had previously been cloned into the mamma-
lian expression vector pcDNA3.1. The coding region of
ATP6V0C was sub-cloned into a pCMV-Tag1 vector carry-
ing a flag tag. To perform the in vivo binding assay,
HEK293 cells were transiently co-transfected with pCMV-
Tag1-ATP6V0C and pcDNA3-GST-RNF182 or deletion
constructs. The transfected cells were harvested and the
protein extracts were incubated with Glutathione-Sepha-
rose beads. The beads were precipitated by centrifugation,
and the samples were boiled and separated by SDS/PAGE.
The blot was first probed with anti-GST antibody to
ensure that RNF182 protein and the deletion fragments
were successfully precipitated by the procedure. We
indeed observed fusion proteins of expected sizes after the
Table 1: Description of brain samples used for qRT-PCR analysis of RNF182
Patient Sex Age Postmortem Pathology
Control 1 Male 89 9 hours Normal
Control 2 Male 64 8 hours Normal
Control 3 Male 63 8 hours Normal
Control 4 Male 80 9.5 hours Normal
Control 5 Male 95 11 hours Normal
AD 1 Female 84 8 hours Probable AD, according to CERAD
AD 2 Male 77 6 hours Senile dementia of AD type
AD 3 Female 81 7.25 hours Definite AD, possible multi-infarct dementia
AD 4 Male 74 6 hours Senile changes of AD type
AD 5 Male N/A 6 hour Moderate senile changes of AD type, dementia
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 8 of 16
(page number not for citation purposes)
Cellular levels of RNF182 modulate the rates of cell deathFigure 5
Cellular levels of RNF182 modulate the rates of cell death. N2a cells were transiently transfected with RNF182/
pcDNA3.1/myc-his plasmid or mouse RNF182 on-target plus smart pool siRNAs. Cells were collected for total RNA extrac-
tions 24–48 h after transfections. Trypan Blue exclusion assay was performed 24 h after transfection or 16 h after a 7 h OGD
treatment of the siRNA transfected samples. A. Over expression of RNF182 mRNA was assessed by RT-PCR. In: lane 1 – neg-
ative PCR control, lane 2 – mock transfection, lane 3-transfection with RNF182/pcDNA3.1/myc-his plasmid. B. Percentage of
cell death before and after transfection. Bars represent the percentage of cell death in the population (mean ± SEM from 3
independent experiments performed in duplicate). Asterisk indicates a significant difference (ρ < 0.005; t-test). C. Percentage
of cell death before and after transfection with transfection reagent removed 6 h after transfection. Bars represent the per-
centage of cell death in the population (mean ± SEM from 3 independent experiments performed in duplicate). Asterisk indi-
cates a significant difference (ρ < 0.005; t-test). D. Percentage of cell death of the control and 24 h transfected samples
subjected to a 7 h OGD treatment. Bars represent the percentage of cell death in the population (mean ± SEM from 3 inde-
pendent experiments performed in duplicate). Asterisk indicates a significant difference (ρ < 0.005; t-test). E. Assessment of
the siRNA silencing efficiency. RNA samples were collected 24 and 48 h after transfection with siRNAs. Down regulation of
RNF182 mRNA was analyzed by RT-PCR. In: lanes 1 and 3 – 24 and 48 h after transfection with RNF182 siRNAs, lanes 2 and
4 – 24 and 48 h after transfection with non-targeting pool negative control siRNAs, respectively. F. Percentage of cell death 24
h after siRNA transfection, with or with out OGD treatment. Bars represent the percentage of cell death in the population
(mean ± SEM from 3 independent experiments performed in duplicate). Asterisks indicate a significant difference (ρ < 0.005; t-
test). C24 – 24 h after transfection with non-targeting pool negative control siRNAs, siRNA24 – 24 h after transfection with
mouse RNF182 on-target plus smart pool siRNAs, c24-OGD – 24 h after transfection with non-targeting pool negative control
siRNAs plus OGD treatment, siRNA24-OGD – 24 h after transfection with on-target plus smart pool siRNAs plus OGD
treatment.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 9 of 16
(page number not for citation purposes)
Western analyses, including GST alone (Fig. 7B). The
same protein samples were subsequently probed with
anti-flag antibody for ATP6V0C. As shown in Fig. 7C,
ATP6V0C bound to full length RNF182 and the C-end
domain, but not to the RING finger domain or GST alone.
These results confirmed the interaction detected through
the yeast two-hybrid assay and also suggested that the
RING finger domain did not play a role in this interaction.
Next, we examined the sub-cellular localization of
RNF182 and ATP6V0C. A EGFP fused RNF182 and flag
tagged ATP6V0C were co-transfected into N2a cells. In
transfected cells, co-localization of these proteins was
detected in a punctuated pattern in the cytoplasmic and
perinuclear regions. This is in agreement with the physical
interaction detected in the yeast two-hybrid and co-pre-
cipitation assays.
RNF182 facilitates ATP6V0C degradation via the
ubiquitin-proteosome pathway
To establish the biological significance of the interaction
between RNF182 and ATP6V0C, pRNF182*EGFP and
pCMV-Tag1-ATP6V0C were co-transfected into N2a cells.
Cell death percentage was assessed 24 h after transfection
(Fig. 8A). Overexpression of ATP6V0C alone slightly
increased cell death rate as compared with mock transfec-
tion, but this increase was not statistically significant.
Overexpression of RNF182 alone significantly increased
the rate of cell death, similar to the results shown in Fig.
5. However, overexpression of both proteins simultane-
ously in these cells did not hinder nor facilitate the effects
of exogenous RNF182 on cell death. These results suggest
that it is unlikely that the binding of ATP6V0C to RNF182
inhibits its ability to kill cells, ruling out the possibility
that ATP6V0C serves as a RNF182 inhibitor during apop-
tosis. An alternative explanation would be that the E3
ligase activity of RNF182 facilitates ubiquitination and
degradation of ATP6V0C. To test this hypothesis, RNF182
was over expressed with ATP6V0C-flag by transient trans-
fection of N2a cells. Cell lysates were subjected to immu-
noblotting with anti-RNF182 or anti-flag antibodies.
Endogenous RNF182 was often detected as multiple
bands, including a major monomeric form with a molec-
ular mass of 27 kDa, and a dimeric form that ran at
approximately 54 kDa on SDS-PAGE and occasionally a
trimeric form slightly above 80 kDa. The dimeric and
trimeric aggregations were more pronounced when total
cellular proteins or purified recombinant RNF182 protein
had been freeze-dried or been passed through multiple
freeze-thaw cycles prior to gel separation. Freshly isolated
RNF182 protein appeared mainly as monomers. In cells
over expressing RNF182 alone, we detected slightly more
RNF182 protein (Fig. 8B, top panel, lane 2); however, this
increase was significantly less then that observed at the
mRNA level after transfection (Fig. 8B, 4th panel, lane 2).
This might be due to the proteosomal degradation of
exogenous RNF182 protein since it's overexpression is
detrimental to the cells. It is also interesting that in cells
over expressing ATP6V0C alone, we observed a dramatic
increase of endogenous RNF182 at the transcription level
(Fig. 8B, 4th panel, lane 4), which was almost as high as
that in the RNF182 transfected cells (Fig. 8B, 4th panel,
lanes 2 and 5). This exogenous ATP6V0C-stimulated
upregulation of endogenous RNF182 was also reflected at
the protein level (compare Fig 8B, top panel, lanes 3 and
4), resulting in a total RNF182 level nearly as high as that
of the transfected cells (Fig. 8B, top panel, lanes 2 and 5).
These results suggested that there is a positive feedback of
ATP6V0C on RNF182 and ATP6V0C may be an ubiquiti-
nation substrate of RNF182. This notion was further sup-
ported by co-transfection of N2a cells with RNF182 and
ATP6V0C, followed by the addition of a potent proteo-
some inhibitor, MG132, to block the proteosomal degra-
dation of the ubiquitinated proteins. The accumulation of
polyubiquitinated ATP6V0C was clearly evident in the
inhibitor treated cells as indicated by Western analysis.
The steady-state expression of ATP6V0C protein was
decreased in the presence of RNF182 as compared with
the ATP6V0C level in the absence of RNF182 (Fig. 8C top
panel). Furthermore, ATP6V0C expression recovered with
the addition of the proteosome inhibitor MG132, despite
the overexpression of RNF182, indicating that the
RNF182-induced degradation of ATP6V0C was blocked
by MG132. These results suggested that RNF182 pro-
moted the degradation of ATP6V0C by the proteosome
pathway. In a subsequent experiment, we stripped the
above blot and performed another Western analysis with
RNF182 exhibits ubiquitin E3 activityFigure 6
RNF182 exhibits ubiquitin E3 activity. His-tagged
recombinant RNF182 protein was incubated with or without
E1, E2 or ubiquitin, and ubiquitination patterns were
detected using an anti-ubiquitin antibody. The GST-SIAH-1
protein was used as a positive control.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 10 of 16
(page number not for citation purposes)
RNF182 physically interacts with ATP6V0CFigure 7
RNF182 physically interacts with ATP6V0C. A. Interaction between RNF182 and ATP6V0C in yeast two-hybrid system.
Empty or RNF182 containing pGBKT7 bait vector and empty or ATP6V0C containing pACT2 library vector were co-trans-
formed into yeast host cells AH109 and plated onto SD/-Trp -Leu -Ade -His +X-α-gal plate. In: a – a negative test of empty bait
vector and ATP6V0C; b – a positive test showing the interaction between RNF182 and ATP6V0C; c – a negative test of
RNF182 bait plus empty library vector. B. Total cellular proteins were extracted from HEK-293 cells co-transfected with flag-
tagged ATP6V0C and GST-tagged RNF182 constructs and precipitated with glutathione-sepharose beads as described in the
Materials and Methods. The precipitates were separated by 12% SDS-PAGE and transferred onto nitrocellulose membrane.
The presence of RNF182 fragments in the complex was revealed by Western blotting with anti-GST antibody. Lanes 1, 3, 5, 7
represent total cellular proteins extracted from cells co-transfected with ATP6V0C and GST-RNF182 RING finger domain,
GST-RNF182 C-end domain, GST-RNF182 full length, or GST alone, respectively. Lanes 2, 4, 6, 8 indicate GST fused protein
fragments precipitated by glutathione-sepharose beads from cells co-transfected with ATP6V0C and GST-RNF182 RING finger
domain, GST-RNF182 C-end domain, GST-RNF182 full length, or GST alone, respectively. C. The presence of ATP6V0C in
the co-precipitated protein complexes shown in B (lanes 2, 4 6, 8) was revealed by Western blotting using anti-flag antibody.
In: lane RINGΔ69–247 – GST-RNF182 RING finger domain, lane C-endΔ1–68 – GST-RNF182 C-end domain. D. Co-localiza-
tion of RNF182 and ATP6V0C. N2a cells were co-transfected with flag tagged ATP6V0C and EGFP tagged RNF182 for 24 h.
Cells were fixed and stained with anti-flag antibodies. Cy3-conjugated anti-rabbit IgG was used to detect the specific immunos-
taining. The nuclei were stained with DAPI and viewed with a Zeiss Axiovert 200 M × 40 fluorescence microscope. a. DAPI
stained nuclei. b. EGFP tagged RNF182. c. Flag tagged ATP6V0C. d. a, b and c overlay.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 11 of 16
(page number not for citation purposes)
RNF182 targets ATP6V0C for proteosome degradationFigure 8
RNF182 targets ATP6V0C for proteosome degradation. N2a cells were transiently transfected with empty pEGFP-N1
or pCMV-Tag1 vector alone, pRNF182*EGFP or pCMV-Tag1-ATP6V0C alone, or pRNF182*EGFP and pCMV-Tag1-ATP6V0C
simultaneously. Cells were collected for Trypan Blue exclusion assay as well as total RNA and protein extractions 24 h after
transfection or treated with 30 μM MG132 for 8 h prior to total RNA and protein extractions. A. Over-expression of
ATP6V0C in RNF182 transfected cells did not change the percentage of cell death caused by RNF182 over-expression. This
figure shows the percentage of cell death before and after transfection. Bars represent the percentage of cell death in the pop-
ulation (mean ± SEM from 3 independent experiments performed in duplicate). Asterisks indicate a significant difference (ρ <
0.05; ANOVA, followed by Bonferronic test). B. Western and semi-quantitative PCR analyses of ATP6V0C and RNF182 pro-
tein and mRNA levels before and after transfection. IB: indicates primary anti-body used for immmunoblotting. β-actin was
used as a loading control for both Western and PCR analyses. In: lane1 – transfection with empty pEGFP-N1 vector, lane 2 –
transfection with pRNF182*EGFP, lane 3 – transfection with empty pCMV-Tag1 vector, lane 4 – transfecton with pCMV-Tag1-
ATP6V0C, lane 5 – transfection with both pRNF182*EGFP and pCMV-Tag1-ATP6V0C. C. Western analysis of changes of
ATP6V0C and RNF182 levels before and after transfection followed by MG132 treatment. IB: indicates primary anti-body used
for immmunoblotting. Ubn: polyubiquitinated protein. Arrow indicates non-specific bands caused by anti-flag antibody. West-
ern blotting of β-actin was used as a loading control.
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 12 of 16
(page number not for citation purposes)
anti-RNF182 antibody. We observed a strong high molec-
ular weight smear of polyubiquitinated RNF182 on the
top of the gel in the RNF182 transfected samples treated
with MG132, suggesting that a majority of the exogenous
RNF182 protein was also degraded through the ubiquitin-
proteosome pathway (Fig 8C, middle panel). Therefore,
this might offer an explanation as to why we have only
detected a slight increase of the RNF182 protein, despite a
significant increase of RNF182 mRNA in the transfected
cells. MG132 did not cause apparent accumulation of
ubiquitinated endogenous RNF182 in the cells transfected
with ATP6V0C alone, despite of the fact that ATP6V0C
overexpression caused upregulation of endogenous
RNF182, suggesting that this physiological increase of
RNF182 might be required to degrade unwanted
ATP6V0C in the cells.
Discussion
We have isolated a novel brain-enriched protein, RNF182,
which was up regulated in AD brain tissues. Further study
of its activities in an NT2 cell model revealed that this
gene was barely detectable in undifferentiated NT2 cells,
but it clearly expressed in differentiated neurons and
astrocytes. Nevertheless, it was still a gene expressed at low
abundance as compared with other cellular constituents
(such as structural proteins). Consistent with the results
obtained from AD brains, treatments of NT2 neurons with
OGD or OGD plus β-amyloid peptide caused apparent
upregulation of RNF182. Furthermore, overexpression of
RNF182 in N2a cells by itself triggered cell death and it's
downregulation reduced cell death caused by OGD, sug-
gesting that this gene might have a specific function in
brain cells under stress conditions.
One of the structural characteristics of the RNF182 protein
is the RING finger domain located at the N-terminus,
resembling ubiquitin E3 ligases. Our in vitro ubiquitina-
tion assay showed that RNF182, indeed, exhibited sub-
strate-independent, E2-dependent ubiquitin ligase
activity, which placed this protein in the ubiquitin-prote-
osome pathway. The most common role of E3 ubiquitin
ligase in neurodegenerative diseases is to facilitate the deg-
radation of unwanted, toxic proteins, thus preventing
neuronal cell death caused by protein aggregation. For
example, synaphilin-1, one of the major components of
Lewy Bodies in Parkinson's disease, is a substrate for three
RING finger containing E3 ligases [15-17]. Parkin muta-
tions disrupting its E3 activity have been directly linked to
autosomal recessive juvenile Parkinsonism [18]. Simi-
larly, a tripartite motif protein, TRIM11, negatively regu-
lates Humanin, a neuroprotective peptide, against AD-
related insults, through ubiquitin-mediated protein-deg-
radation pathways [19]. A recent report demonstrates that
the upregulation of E3 ligase CHIP (carboxyl terminus of
Hsp70-interacting protein) collaborates with Hsp70 to
attenuate tau aggregation in AD brains [20]. Quantitative
analyses of CHIP in different regions of AD and transgenic
mouse brains show that CHIP level is inversely propor-
tional to sarkosyl-insoluble tau accumulation, suggesting
that the upregulation of CHIP may protect against the for-
mation of NFTs. Another cytosolic RING finger protein,
Dactylidin, is also found up regulated in highly vulnera-
ble regions of AD brains [21]. Although E3 activity of Dac-
tylidin has not yet been demonstrated, these authors
speculate that its upregulation in those regions might be
related to a putative E3 function. The evidence docu-
mented above all seems to indicate a protective function
of these proteins due to proteolysis of toxic proteins.
However, RNF182 was found to be up regulated during
neuronal cell apoptosis and its overexpression alone
killed cells, suggesting a role in promoting cell death. This
is in agreement with the recent findings that overexpres-
sion of a RING finger protein, SIAH-1, triggers apoptotic
cell death in various cell types [22]. These authors also
find that accumulation of SIAH-1 protein is promoted by
its interaction with a scaffold protein POSH upon receiv-
ing of apoptotic stimuli. SIAH-1, in turn, activates the JNK
pathway, thereby contributing to the death of neurons
and other cell types. The E3 ligase activity is essential for
SIAH-1-evoked cell death. Based on our RT-PCR and
Western blotting results, endogenous RNF182 was low at
both mRNA and protein levels and its upregulation dur-
ing apoptosis was reflected at both the transcription and
translation levels. It is not yet clear whether its contribu-
tion to cell death is accomplished through collaborations
with other proteins. This is still under investigation in our
laboratory. Thus far, we found additional brain proteins
interacting with RNF182 and their further characteriza-
tion might shed new light on the biological significance of
these interactions.
The interaction of RNF182 with ATP6V0C is intriguing
since ATP6V0C is a multi-functional protein that appears
to function at the intersection of a number of biological
processes. The vacuolar H+ -ATPase (V-ATPase) is a multi-
subunit enzyme present in intracellular membrane com-
partments such as endosomes, lysosomes, clathrin-coated
vesicles and the Golgi complex, where it plays a role in
their acidification and maintenance of endocytic and exo-
cytic pathways [23]. Its 16 kDa subunit (ATP6V0C) is a
membrane spanning protein that folds into four trans-
membrane helices and assembles into a hexamer, forming
the membrane proton channel of the enzyme [24]. In
addition to its role in V-ATPase, ATP6V0C functions inde-
pendently to form gap junction complexes and neuro-
transmitter release channels, playing an important role in
neurotransmitter release [25,26]. Based on homology
comparison with yeast V-ATPase, the 4th trans-membrane
domain of ATP6V0C should be located on the exterior of
the proton channel where it could easily interact with
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 13 of 16
(page number not for citation purposes)
adjacent protein trans-membrane domains [27]. Scanning
the primary structure of RNF182 revealed two typical
trans-membrane helices, which could make this E3 ligase
unique and placed it in close proximity with ATP6V0C in
the membrane, where other E3s might not have easy
access. Our results demonstrated that the physical interac-
tion of these two proteins led to the degradation of
ATP6V0C through the ubiquitin-proteosome pathway,
making the present findings a new illustration of a novel
RING finger protein that targets an essential component
of neurotransmitter release machinery. This is in agree-
ment with the report of Chin et al. [28], who demonstrate
that the RING finger protein, Staring, targets syntaxin 1 for
proteosomal degradation, implying an important role of
the ubiquitin-proteosome pathway in the degradation of
membrane proteins at the nerve terminals.
Conclusion
We have isolated a novel Ring finger E3 ubiquitin ligase,
RNF182, that is up regulated in AD brain and in neuronal
cells subjected to cell death-inducing stresses. It's overex-
pression in N2a cells by itself triggered cell death. It is
unlikely that this killing is directly related to its promo-
tion of ATP6V0C degradation, but it might be related to
the interactions of NRF182 with other key signaling pro-
teins that are currently investigated in our laboratory.
Since ATP6V0C is a key component of gap junctions and
neurotransmitter release channels, and RNF182 is up reg-
ulated in AD brains, it would be tempting to speculate
that RNF182-mediated ATP6V0C degradation contributes
to the pathophysiology of this disease. Further study of
the molecular mechanism controlling such degradation
of synaptic proteins will undoubtedly enhance our under-
standing of neurodegeneration in AD.
Methods
Cell culture and oxygen-glucose deprivation (OGD)
treatment
Human embryonal teratocarcinoma Atera2/D1 (NT2)
cells (Stratagene, La Jolla, CA), mouse Neuro-2a (N2a)
neuroblastoma cells (ATCC CCL-131) and human HEK
293 cells [29] were cultured in Dulbecco's modified
Eagle's medium (Invitrogen, Bethesda, MD) supple-
mented with 10% fetal calf serum (GCS, Wisent, Inc. St.
Bruno, PQ), and 40 μg/ml gentamicin sulfate (Sigma Cell
Culture, St. Louis, MO). NT2 cells were differentiated into
neurons and astrocytes with all trans-retinoic acid (RA,
Sigma, Oakville, ON) according to the method of Pleasure
and Lee [30] as described previously [31]. N2a cells were
differentiated into neurons by replacing culture medium
with DMEM containing 0.5% FBS and 20 μM RA for 3
days.
For OGD treatment, NT2 neurons in T75 flasks were
washed once with glucose-free DMEM, and incubated in
glucose-free DMEM with 10% FBS for 2 h in a Gas Pak 100
chamber (VWR, Montreal, OC, Canada) as described pre-
viously [11]. At the end of the OGD treatment, cells were
removed from the chamber and returned to the incubator
for 16 h. In a parallel experiment, 20 μM β-amyloid pep-
tide (25–35 Aβ amide, Bachem California, Inc) was added
to the culture medium during the OGD treatment and re-
oxygenation period. The same OGD treatment was per-
formed with N2a cells except the incubation in OGD con-
ditions was 7 h. Cell viability for both cell lines was
assessed by the Trypan Blue (Sigma, Oakville, ON) exclu-
sion assay. Labelled cells were counted using a hemocy-
tometer.
RNA extraction, RT-RCR and real time quantitative RT-
PCR (qRT-PCR)
RNA extraction, first strand cDNA synthesis, and qRT-PCR
analysis were performed as described previously [32].
RNA pools extracted from frontal cortex of postmortem
human brain samples described previously [33] were used
for subtractive hybridization and qRT-PCR. Additional
brain samples (Table 1) were obtained from the Human
Brain and Spinal Fluid Resource Center (VAMC, Los Ange-
les, CA), which is sponsored by NINDS/NIMN, National
Multiple Sclerosis Society, VA Greater Los Angeles Health-
care System, and Veterans Health Services and Research
Administration, Department of Veteran Affairs. To detect
the expression level of the RNF182 transcript in brain tis-
sue and NT2 neurons, equal amounts of cDNA (2 ng
each) were used with the primers: 360nhF 5' TGCCCGT-
GTGAGCTAGCA 3' and 360nhR 5' AGAACGGAGATATC-
CATGGTGAA 3' located in exon 2 of the gene. For semi-
quantitative RT-PCR, a 395 bp cDNA fragment within the
coding region of RNF182, and the entire coding region of
ATP6V0C (468 bp) were amplified from first-stranded
cDNA using the primers: 395F 5' TTGTGCCAAATGCCTC-
TACA 3' and 395R 5' ACGTGCAGTTCCACACAGTC 3',
vATPcF 5' ATGTCCGAGTCCAAGAGCGGC 3' and vATPcR
5' CTACTTTGTGGAGAGGATGAG 3', respectively. PCR
was performed as follows: 1 cycle at 94°C for 5 min, 30
cycles of 94°C for 45 sec, 60°C for 45 sec and 72°C for 45
sec. In the last cycle, the incubation was extended for 5
min at 72°C. The samples were separated on a 1% agarose
gel containing 0.5 μg/ml ethidium bromide and photo-
graphed.
Cloning of the FNR182 transcript
A 300 bp cDNA fragment, 360nh, was isolated by subtrac-
tive hybridization using the mRNA population from AD
brains as a "tester" and the first strand cDNA from control
brains as a "driver" [10]. To amplify the cDNA fragment
overlapping with both 360nh and the existing mRNA (acc
# AK090576), we used a forward RT-PCR primer 5'TGTT-
GTGGCCCTTAATCTGAGTGCTG 3' and a reverse primer
5' GATGTTGTTGTCATCGGGCAGGCTAC 3'. The PCR
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 14 of 16
(page number not for citation purposes)
conditions were as described above. The resulting PCR
product was cloned into pCR-Blunt II-TOPO vector (Inv-
itrogen, Burlington, ON), subsequently analyzed by DNA
sequencing and Genbank searches.
Plasmids and transient transfections
Human cDNA encoding the full length RNF182 protein
was cloned into the pBAD/HisA vector (Invitrogen, Burl-
ington, ON) for his-tag RNF182 protein production. To
clone the GST-RNF182 or GST-RNF82 RING finger
domain, or the GST-RNF182 C terminal domain into a
mammalian vector, we first inserted GST sequences into
the HindIII/XhoI site of pcDNA3.1 to form a pcDNA-GST
tag vector. The entire coding region of RNF182, the N ter-
minal 68 aa containing the RING finger domain and the
C terminal 179 aa were then cloned into the EcoRI and
XhoI site of the pcDNA3-GST tag vector, in frame with the
GST sequence. The coding region of the ATP6V0C cDNA
was cloned into the pCMV-Tag1 vector. These plasmids
were transfected into HEK 293 cells for the co-precipita-
tion assay.
Human cDNA encoding full length RNF182 protein was
cloned in the pEGFP-N1 vector (Clontech, Palo Alto, CA,
USA) with or without a stop codon added between the C-
terminus of RNF182 and the EGFP sequence and the
pcDNA3.1/myc-his vector (Invitrogen, Burlington, ON)
to produce pRNF182*EGFP, pRNF182-EGFP and
pcDNARNF182-myc-his constructs, respectively. For
RNF182-EGFP localization analysis, N2a cells were plated
on poly-lysine-coated cover slips in 6-well plates, at a den-
sity of 0.5 × 106 cells/well, 24 h before transfection. Cells
were transfected with 5 μg/well of pRNF182-EGFP plas-
mid DNA and 15 μl LipofectAmine 2000 reagent (Invitro-
gen, Burlington, ON) according to the manufacturer's
instructions. After 24 h, the cells were stained with anti-
RNF182 antibody (dilution1:500 v/v) followed by Cy3-
conjugated anti-rabbit IgG. The nuclei were counter-
stained with DAPI in PBS for 5 min and then mounted in
Vectashield mounting medium (Vector laboratories, Burl-
ingame CA, USA). The cells were viewed with a Zeiss Axio-
vert 200 M fluorescence microscope equipped with a Zeiss
AxioCam camera (Zeiss, Midland, ON). The images were
captured and analyzed using Zeiss Axiovision 3.1 soft-
ware. For overexpression analysis, N2a cells were plated in
6-well plates at a density of 0.5 × 106 cells/well, 24 h
before transfection. Cells were transfected with 5 μg
pcDNARNF182-myc-his plasmid or pRNF182*EGFP
plasmid and 15 μl lipofectAmine 2000 reagent, or co-
transfected with 2.5 μg each of the pcDNARNF182-myc-
his or pRNF182*EGFP and pCMV-Tag1-ATP6V0C plas-
mids plus 15 μl lipofectAmine 2000 reagent. Cells were
collected for Trypan Blue exclusion assay as well as total
RNA and protein extraction 24 h after transfection or
treated with 30 μM MG132 (Sigma, Oakville, ON) for 8 h
prior to total RNA and protein extraction. For siRNA
silencing, the on-target plus smart pool siRNAs were pur-
chased from Dharmacon (Dharmacon, Thermo Fisher
Scientific, Inc). N2a cells were plated in 12-well plates at a
density of 0.25 × 106cells/well, 24 h before transfection.
Cell were transfected with 100 μM mouse RNF182 on-tar-
get plus smart pool siRNAs using Dharmafect1 transfec-
tion reagent according the manufacturer's instructions.
Cells were subjected to 7 h OGD treatment 24–48 h after
transfection and collected for Trypan Blue exclusion assay
16 h after re-oxygenation. For co-precipitation analysis,
HEK 293 cells were plated in 10 cm plates at a density of
2 × 106 cells/plate, 24 h before transfection. Cells were co-
transfected with 7.5 μg of pcDNA3 plasmid DNA harbor-
ing a GST-fused full-length, RING finger or C-end RNF182
cDNA fragment and 7.5 μg of pCMV-Tag1-ATP6V0C plas-
mid DNA mixed with 45 μl LipofectAmine 2000 reagent.
Cells were collected for total protein extraction 48 h after
transfection.
Antibody production and purification
Custom polyclonal antibody (GenScprit, Piscataway, NJ)
was produced using synthetic peptide N'-ELLLTPKR-
LASLVSPSH (identical sequence between human and
rodent). The immune serum was purified by immunoaf-
finity purification using recombinant his-tag RNF182 pro-
tein. Briefly, purified his-tag RNF182 protein was
separated by SDS-PAGE and electro-blotted onto a nitro-
cellulose membrane. The Ponceau stained membrane
portion containing the RNF182 antigen was excised and
subjected to a Western blotting procedure using 2 mL
original crude serum. The bound antigen-specific anti-
body was eluted with 0.1 M Glycine-HCl buffer, pH 2.7.
The eluted antibody was neutralized by adding 1/10 vol-
ume of 1 M Tris, pH 8.5, concentrated using Amicon
Ultra-15 Centrifugal Filter Device (Millipore, Fisher Scien-
tific, Ottawa, ON).
Protein extraction, Western blotting and co-precipitation
Recombinant His-tag RNF182 protein was purified from
Top10 cells using a HiTrap nickel column (Pharmacia
Biotech, Baie d'Urfe', QC). The recombinant GST fusion
SIAH-1 protein was purified from Rosetta cells harboring
a pGEX4T-1/SIAH plasmid (a kind gift of Dr. M. Weiss-
man, NIH, USA) [14]. For total protein extraction from
cultured cells, cells were trypsinized and collected by cen-
trifugation. They were washed twice with PBS and lysed
with RIPA buffer containing 1X protease Inhibitor cocktail
(Roche Diagnostics, Indianapolis, IN). The lysate was vor-
texed and incubated on ice for 15 min, followed by soni-
cation for 30 sec. In some cases the total cellular protein
was freeze-dried and reconstituted in PBS in order to
achieve a higher concentration. Western blotting analyses
were performed as previously described [34]. The blots
were probed with the following primary antibodies: Rab-
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 15 of 16
(page number not for citation purposes)
bit polyclonal, affinity-purified anti-RNF182 (1:1000),
rabbit polyclonal anti-flag (1:1000, Rockland, Gilberts-
ville, PA), goat polyclonal anti-GST (1:1000, Amersham
Phamacia Biotech, Baie d'Urfe, QC), mouse monoclonal
anti-ubiquitin (1:1000), and mouse monoclonal anti-β-
actin (1:5000 v/v, both Sigma, Oakville, ON). The anti-
gens were detected using horseradish peroxidase-conju-
gated secondary antibodies: anti-mouse IgG (1:5000 v/v),
anti-rabbit IgG (1:5000 v/v, both from Jackson Immu-
noResearch Laboratories, Inc., West Grove, PA) or anti-
goat IgG (1:5000, Sigma, Oakville, ON). The antigen-anti-
body complexes were visualized by enhanced chemilumi-
nescence using an ECL Plus detection kit (Amersham
Phamacia Biotech, Baie d'Urfe, QC).
For the co-precipitation assay, flag-tagged ATP6V0C and
GST-tagged RNF182 constructs were transiently co-trans-
fected into HEK-293 cells and total cellular proteins were
extracted as described above. The extracts were incubated
with 200 μl of glutathione-sepharose beads for overnight
at 4°C. Beads were precipitated by centrifugation at
10,000 g for 1 min and washed four times with PBST (1%
Triton ×-100 in PBS), and samples were boiled in protein
loading buffer and separated by 12% SDS-PAGE. The
presence of RNF182 fragments and ATP6V0C in the com-
plex was revealed by Western blotting as described above.
Yeast two-hybrid screening
Human cDNA encoding the full length RNF182 protein
was cloned into the pGBKT7 vector (Clontch, Palo Alto,
CA, USA) to generate a chimaeric open reading frame
encoding the Gal4 DNA binding domain and RNF182
protein. This construct was introduced into Saccharomyces
cerevisiae strain AH109. A single colony containing cells
harboring the pGBKT7-RNF182 plasmid was then used to
provide host cells for screening a human brain cDNA
expression library constructed using the pACT2 vector
(Clontech, Palo Alto, CA, USA). The protein-protein inter-
action was first screened by plating the transformants
onto SD/-Trp-Leu-His-Ade selection plates. Positive
clones were then re-screened for the presence of β-galac-
tosidase activity to eliminate false interactions. Library
plasmids harboring RNF182 interacting proteins were res-
cued and re-introduced into the RNF182/pGBKT7-con-
taining host cells to further eliminate false interactions.
The identity of the cDNA encoding RNF182-interacting
protein was revealed by DNA sequencing and database
searches.
In vitro ubiquitination assay
Ubiquitination experiments were carried out according to
a previously published report [14] with modifications.
Thirty microliter, in vitro reactions were performed in
ubiquitination buffer (50 mM Tris-HCl, pH 7.4, 2.5 mM
MgCl2, 0.5 mM DTT, 2 mM ATP, 1 mM creatine phos-
phate) containing 0.5 units of creatine phosphokinase,
750 ng his-tag RNF182 or 1.3 μg GST-SIAH-1 (in the case
of positive control reactions), 55 ng E1 (Boston Biochem,
Cambridge, MA), 85 ng E2/Ubc5a (Boston Biochem,
Cambridge, MA), 10 μg ubiquitin (Sigma-Aldrich,
Oakville, ON), and 2 μL of bacterial lysate from Rosetta
cells transformed with pGEX-3X. The mixture was incu-
bated at 30°C for 90 min and the reaction was stopped by
adding 5X SDS-PAGE loading buffer. The reaction mixture
was resolved on 8% SDS-PAGE gel and analyzed by West-
ern blotting using mouse anti-ubiquitin monoclonal anti-
body (Sigma-Aldrich, Oakville, ON).
Competing interests
The author(s) declare that they have no competing inter-
ests.
Authors' contributions
QYL participated in the design of the study, analysis and
interpretation of the data and preparation of the manu-
script. JXL performed most experiments and helped to
analyze the data. MS dissected postmortem human con-
trol and AD brain tissues and participated in writing of the
manuscript. RL helped to analyze the data and contrib-
uted to writing of the manuscript. All authors read and
approved the final manuscript.
Acknowledgements
The authors would like to thank Ms Stephanie Crosbie and Ms Julie LeBlanc
for their technical assistance, and co-op students Amy Aylsworth, Sasha
High, Katie Morse and Jill Taylor for their contribution to this project. We
thank Dr. Hui Shen, Ms Caroline Sodja and Ms Maria Ribecco for providing
total RNA samples of NT2 cells, Dr. Mahmud Bani for his assistance on flu-
orescence microscopy, and Dr. John van der Meer for editing this manu-
script.
References
1. Reddy PH, McWeeney S: Mapping cellular transcriptosomes in
autopsied Alzheimer's disease subjects and relevant animal
models. Neurobiol Aging 2006, 27:1060-1077.
2. Upadhya SC, Hegde AN: Role of the ubiquitin proteasome sys-
tem in Alzheimer's disease. BMC Biochem 2007, 8(Suppl 1):S12.
3. Colangelo V, Schurr J, Ball MJ, Pelaez RP, Bazan NG, Lukiw WJ: Gene
expression profiling of 12633 genes in Alzheimer hippocam-
pal CA1: transcription and neurotrophic factor down-regula-
tion and up-regulation of apoptotic and pro-inflammatory
signaling. J Neurosci Res 2002, 70:462-473.
4. Ginsberg SD, Hemby SE, Lee VM, Eberwine JH, Trojanowski JQ:
Expression profile of transcripts in Alzheimer's disease tan-
gle-bearing CA1 neurons. Ann Neurol 2000, 48:77-87.
5. Loring JF, Wen X, Lee JM, Seilhamer J, Somogyi R: A gene expres-
sion profile of Alzheimer's disease. DNA Cell Biol 2001,
20:683-695.
6. Pasinetti GM: Use of cDNA microarray in the search for
molecular markers involved in the onset of Alzheimer's dis-
ease dementia. J Neurosci Res 2001, 65:471-476.
7. Ricciarelli R, d'Abramo C, Massone S, Marinari U, Pronzato M, Taba-
ton M: Microarray analysis in Alzheimer's disease and normal
aging. IUBMB Life 2004, 56:349-354.
8. Drmanac S, Stavropoulos NA, Labat I, Vonau J, Hauser B, Soares MB,
Drmanac R: Gene-representing cDNA clusters defined by
hybridization of 57,419 clones from infant brain libraries
with short oligonucleotide probes. Genomics 1996, 37:29-40.
Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp
BioMedcentral
Molecular Neurodegeneration 2008, 3:4 http://www.molecularneurodegeneration.com/content/3/1/4
Page 16 of 16
(page number not for citation purposes)
9. Milner RJ, Sutcliffe JG: Gene expression in rat brain. Nucleic Acids
Res 1983, 11:5497-5520.
10. Liu QY, Sooknanan RR, Malek LT, Ribecco-Lutkiewicz M, Lei JX, Shen
H, Lach B, Walker PR, Martin J, Sikorska M: Novel subtractive
transcription-based amplification of mRNA (STAR) method
and its application in search of rare and differentially
expressed genes in Alzheimers disease brains. BMC Genomics
2006, 7:286.
11. Fang H, Chartier J, Sodja C, Desbois A, Ribecco-Lutkiewicz M,
Walker PR, Sikorska M: Transcriptional activation of the human
brain-derived neurotrophic factor gene promoter III by
dopamine signaling in NT2/N neurons. J Biol Chem 2003,
278:26401-26409.
12. Boutell C, Sadis S, Everett RD: Herpes simplex virus type 1
immediate-early protein ICP0 and is isolated RING finger
domain act as ubiquitin E3 ligases in vitro. J Virol 2002,
76:841-850.
13. Lee SJ, Choi JY, Sung YM, Park H , Rhim H, Kang S : E3 ligase activity
of RING finger proteins that interact with Hip-2, a human
ubiquitin-conjugating enzyme. FEBS Lett 2001, 503:61-64.
14. Lorick KL, Jensen JP, Fang S, Ong AM, Hatakeyama S, Weissman AM:
RING fingers mediate ubiquitin-conjugating enzyme (E2)-
dependent ubiquitination. Proc Natl Acad Sci USA 1999,
96:11364-11369.
15. Ito T, Niwa J, Hishikawa N, Ishigaki S, Doyu M, Sobue G: Dorfin
localizes to Lewy bodies and ubiquitylates synphilin-1. J Biol
Chem 2003, 278:29106-29114.
16. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y,
Minoshima S, Yokochi M, Mizuno Y, Shimizu N: Mutations in the
parkin gene cause autosomal recessive juvenile parkinson-
ism. Nature 1998, 392:605-608.
17. Nagano Y, Yamashita H, Takahashi T, Kishida S, Nakamura T, Iseki E,
Hattori N, Mizuno Y, Kikuchi A, Matsumoto M: Siah-1 facilitates
ubiquitination and degradation of synphilin-1. J Biol Chem 2003,
278:51504-51514.
18. Takahashi R: [Neurodegeneration caused by ER stress? – the
pathogenetic mechanisms underlying AR-JP]. Nippon Yakuri-
gaku Zasshi 2004, 124:375-382.
19. Niikura T, Hashimoto Y, Tajima H, Ishizaka M, Yamagishi Y, Kawasumi
M, Nawa M, Terashita K, Aiso S, Nishimoto I: A tripartite motif
protein TRIM11 binds and destabilizes Humanin, a neuro-
protective peptide against Alzheimer's disease-relevant
insults. Eur J Neurosci 2003, 17:1150-1158.
20. Sahara N, Murayama M, Mizoroki T, Urushitani M, Imai Y, Takahashi
R, Murata S, Tanaka K, Takashima A: In vivo evidence of CHIP up-
regulation attenuating tau aggregation. J Neurochem 2005,
94:1254-1263.
21. von Rotz RC, Kins S, Hipfel R, von der KH, Nitsch RM: The novel
cytosolic RING finger protein dactylidin is up-regulated in
brains of patients with Alzheimer's disease. Eur J Neurosci 2005,
21:1289-1298.
22. Xu Z, Sproul A, Wang W, Kukekov N, Greene LA: Siah1 interacts
with the scaffold protein POSH to promote JNK activation
and apoptosis. J Biol Chem 2006, 281:303-312.
23. Forgac M: Structure and properties of the vacuolar (H+)-
ATPases. J Biol Chem 1999, 274:12951-12954.
24. Hanada H, Hasebe M, Moriyama Y, Maeda M, Futai M: Molecular
cloning of cDNA encoding the 16 KDa subunit of vacuolar
H(+)-ATPase from mouse cerebellum. Biochem Biophys Res
Commun 1991, 176:1062-1067.
25. Finbow ME, Harrison M, Jones P: Ductin–a proton pump compo-
nent, a gap junction channel and a neurotransmitter release
channel. Bioessays 1995, 17:247-255.
26. Morel N: Neurotransmitter release: the dark side of the vac-
uolar-H+ATPase. Biol Cell 2003, 95:453-457.
27. Lee I, Skinner MA, Guo HB, Sujan A, Pierce M: Expression of the
vacuolar H+-ATPase 16-kDa subunit results in the Triton ×-
100-insoluble aggregation of beta1 integrin and reduction of
its cell surface expression. J Biol Chem 2004, 279:53007-53014.
28. Chin LS, Vavalle JP, Li L: Staring, a novel E3 ubiquitin-protein
ligase that targets syntaxin 1 for degradation. J Biol Chem 2002,
277:35071-35079.
29. Graham FL, Smiley J, Russell WC, Nairn R: Characteristics of a
human cell line transformed by DNA from human adenovi-
rus type 5. J Gen Virol 1977, 36:59-74.
30. Pleasure SJ, Lee VM: NTera 2 cells: a human cell line which dis-
plays characteristics expected of a human committed neuro-
nal progenitor cell. J Neurosci Res 1993, 35:585-602.
31. Sodja C, Fang H, Dasgupta T, Ribecco M, Walker PR, Sikorska M:
Identification of functional dopamine receptors in human
teratocarcinoma NT2 cells. Brain Res Mol Brain Res 2002,
99:83-91.
32. Shen H, Sikorska M, Leblanc J, Walker PR, Liu QY: Oxidative stress
regulated expression of ubiquitin Carboxyl-terminal Hydro-
lase-L1: role in cell survival. Apoptosis 2006, 11:1049-1059.
33. Walker PR, Smith B, Liu QY, Famili AF, Valdes JJ, Liu Z, Lach B: Data
mining of gene expression changes in Alzheimer brain. Artif
Intell Med 2004, 31:137-154.
34. Liu QY, Pandey S, Singh RK, Lin W, Ribecco M, Borowy-Borowski H,
Smith B, Leblanc J, Walker PR, Sikorska M: DNaseY: a rat DNaseI-
like gene coding for a constitutively expressed chromatin-
bound endonuclease. Biochemistry 1998, 37:10134-10143.
