No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Genetic Applications of an Inverse Polymerase Chain Reaction
Abstract
A method is presented for the rapid in vitro amplification of DNA sequences that flank a region of known sequence. The method uses the polymerase chain reaction (PCR), but it has the primers oriented in the reverse direction of the usual orientation. The template for the reverse primers is a restriction fragment that has been ligated upon itself to form a circle. This procedure of inverse PCR (IPCR) has many applications in molecular genetics, for example, the amplification and identification of sequences flanking transposable elements. In this paper we show the feasibility of IPCR by amplifying the sequences that flank an IS1 element in the genome of a natural isolate of Escherichia coli.
... Various methods, such as Southern blotting, digital PCR, and quantitative real-time PCR (qRT-PCR), prove effective for copy number analysis. PCR-based genome walking techniques, including inverse PCR (iPCR) (Ochman et al. 1988), adaptor-mediated PCR (Huang et al. 2007), and thermal asymmetric interlaced PCR (TAIL-PCR) (Liu et al. 1995), coupled with Sanger sequencing, offer insights into flanking sequences. However, Southern blotting, a primary method for estimating transgene copy number, poses challenges due to its expense, labor-intensive nature, and requirements for substantial DNA quantities from fresh or frozen material. ...
... Furthermore, its results can be complex to interpret, lacking discrimination between hemizygous and homozygous individuals. To address these limitations, this study introduces a protocol, termed semiuniversal method iPCR (SUN-iPCR), for rapid, cost-effective, and sensitive detection of individual transgenic events and their insertion sites (Ochman et al. 1988;Does et al. 1991;Dalby et al. 1995;Akiyama et al. 2000;Yu et al. 2012;Chen et al. 2013;Stefano et al. 2016). SUN-iPCR, requiring minimal DNA, can distinguish between possible events, estimate T-DNA copy numbers, and identify insertion sites. ...
... A limitation of iPCR lies in the selection of enzymes that generate fragments of suitable size and cut vector sequences at appropriate sites. However, once suitable restriction enzymes are identified, the iPCR technique proves to be simple and reliable (Ochman et al. 1988). In our study, HinP1I or HaeIII, both four-base cutter enzymes, were employed as restriction enzymes in the iPCR method. ...
Rice (Oryza sativa L.) is a vital staple food for a significant portion of the global population. Meeting the demand and enhancing productivity in the face of climate change and population growth necessitate innovative strategies, including molecular modification, genetic engineering, and genome editing. This study presents a simplified gene transformation protocol for the rice cultivar Hashemi using 4 to 7-day-old calluses. The method, based on mature rice seeds and gene transformation to a 4 to 7-day-old callus, achieves a maximum 40% efficiency, circumventing complications associated with using immature. Notably, a novel reporter gene, ChromoP (a codon-optimized chromoprotein), is introduced for the first time to facilitate the optimization of gene transformation. The transgenic calli containing ChromoP exhibit a distinctive pinkish-purple coloration, enabling easy visual identification. Furthermore, the study introduces a simple, fast, and cost-effective protocol, named semi-universal inverse PCR (SUN-iPCR), for detecting individual events and determining the insertion site of a transgene. In conclusion, this study successfully outlines a gene transformation protocol for rice, covering the process until the detection of an independent transformant. Furthermore, the reporter gene and SUN-iPCR methodology utilized in this study hold promising potential for optimizing gene transformation in various other plant species.
... With the proceeding of biotechnology, many PCR-based genome-walking methods have been devised. These PCR-based methods vary substantially in their experimental operations, but can be divided into three categories according to the involved rationales: (i) inverse PCR [8,9]; (ii) digestion-ligation-mediated PCR [10,11]; and (iii) randomly primed PCR [12,13]. ...
... The cyclized target product is subsequently amplified using two site-specific primers with an orientation of 5′-end-facing-5′-end (opposite to classic 3′-end-facing-3′-end). Due to the use of a site-specific primer pair, the amplification specificity of inverse PCR is high [8,9,14]. However, the length of the fragment captured by inverse PCR is unsatisfactory because a smaller fragment is always preferentially ligated and amplified [15]. ...
... To date, many genome-walking methods, related to DNA library screening, inverse PCR, digestion-ligation-mediated PCR, or randomly primed PCR, have been developed [8,11,13,22]. Among which, randomly primed PCR-based genome-walking methods, such as thermal asymmetric interlaced PCR [12], partially overlapping primer-based PCR [7], and stepwise partially overlapping primer-based PCR [15], have features of rapidity and simplicity. ...
Genome-walking has been frequently applied to molecular biology and related areas. Herein, a simple but reliable genome-walking technique, termed semi-site-specific primer PCR (3SP-PCR), is presented. The key to 3SP-PCR is the use of a semi-site-specific primer in secondary PCR that partially overlaps its corresponding primary site-specific primer. A 3SP-PCR set comprises two rounds of nested amplification reactions. In each round of reaction, any primer is allowed to partially anneal to the DNA template once only in the single relaxed-stringency cycle, creating a pool of single-stranded DNAs. The target single-stranded DNA can be converted into a double-stranded molecule directed by the site-specific primer, and thus can be exponentially amplified by the subsequent high-stringency cycles. The non-target one cannot be converted into a double-strand due to the lack of a perfect binding site to any primer, and thus fails to be amplified. We validated the 3SP-PCR method by using it to probe the unknown DNA regions of rice hygromycin genes and Levilactobacillus brevis CD0817 glutamic acid decarboxylase genes.
... İlk kez Ochman ve ark. tarafından 1988 yılında tanımlanan bu yöntemde [42], bilinen DNA dizisi primerleri kullanılarak hedef dışı yan bölgelerin amplifikasyonu gerçekleştirilir [43]. gerçekleştirilir [43]. ...
... tarafından 1988 yılında tanımlanan bu yöntemde [42], bilinen DNA dizisi primerleri kullanılarak hedef dışı yan bölgelerin amplifikasyonu gerçekleştirilir [43]. gerçekleştirilir [43]. Amplifikasyon ürünü olarak reaksiyon sonunda uçlarında kısa bilinen DNA uzantıları ve en ortada restriksiyon enzimi kesim bölgesi olan ve bilinmeyen dizileri içeren doğrusal moleküller elde edilir [44]. ...
... Başta genom düzenleme, insersiyon bölgelerinin belirlenmesi, metagenomdaki mobil genetik elementleri ve bunlarla ilişkili genleri tanımlama, transpozon yerleştirilmesi ve nokta mutasyonu analizi olmak üzere ilgili birçok alanda yürütülen bu analizlerde invers PCR önemli bir yardımcı teknik olarak görülmektedir [43,45,46]. [47]. ...
In this study, it is aimed to provide an up-to-date overview of different types and application areas of polymerase chain reaction (PCR) developed with technological advances. PCR has accelerated scientific studies with its use in medical research and molecular biology. PCR based methods are used in many fields such as diagnosis of infectious diseases, microorganism typing, gene expression analysis, epidemiology and taxonomy fields, oncological studies, DNA cloning, analysis of point mutations, insertion of transposon elements, polymorphism studies, population typing, phylogenetic analysis, drug level analysis, and autoantibody detection. Multiplex PCR is used for simultaneous amplification of multiple targets using multiple primer pairs, consensus PCR is used for amplification of common (conserved) gene regions of genetically related microorganisms, rep-PCR is used for amplification of repetitive fingerprint DNA sequences in microbial genomes, nested PCR is used to reduce non-specific primer binding and increase sensitivity, hot start PCR is used to reduce the presence of non-specific products and primer dimers, anchored PCR is used to enable amplification of unknown gene regions using non-specific anchor primers, ligation mediated and homopolymer PCR is used for amplification of a DNA segment with a single known primer binding site, touch-down and touch-up PCR is used to prevent mismatches by regulating annealing temperature, autosticky PCR is used for amplification of DNA fragments for gene cloning using abasic primers, methylation specific PCR is used to determine the methylation patterns of cytosine residues, inverse PCR is used for sequence analysis of unknown flanking DNA regions, asymmetric PCR is used to synthesize single-stranded DNA using primers of different concentrations, in-situ PCR is used to visualize intracellular amplification in tissue sections, RAPD is used for amplifying random DNA segments using random primers and for population analysis, immuno-PCR is used for detection of low concentration amplicons by combining ELISA and PCR methods, real-time PCR is used for quantitation and monitoring of amplification with real time fluorescent signals, digital PCR is used for absolute quantitative amplification, long-range PCR for amplification of long target DNA regions, and reverse transcription PCR is used to provide amplification by synthesizing cDNA from RNA with reverse transcriptase enzyme. PCR modifications have developed rapidly throughout history. Having knowledge about these modifications will be an eye-opener for new methods to be discovered with technological developments, will contribute to selection of appropriate methods, and will increase the sensitivity and specificity of the reactions.
... Several PCR-based genome-walking methods have been developed and validated for identifying unknown flanking DNA sequences. These PCR-based methods vary substantially in experimental processes but can be divided into four categories: 1) inverse PCR (Ochman et al., 1988;Uchiyama and Watanabe, 2006); 2) panhandle PCR; 3) ligationdependent PCR (Yan et al., 2003;Yik et al., 2021); and 4) randomly primed PCR Tan et al., 2005;Zhang et al., 2018). ...
... The digested fragments then undergo selfcircularization with the help of DNA ligase and the circularized DNA is amplified, like classical end-to-end PCR, by a sequence-specific primer (SSP) pair. The two primers are in the orientation of the 5′ end facing the 5′ end, opposite to the classical one of the 3′ end facing the 3′ end (Ochman et al., 1988;Triglia et al., 1988). Inverse PCR has high specificity owing to the use of an SSP pair. ...
... The secondary FPR-PCR is completely sequence-specific. In this regard, FPR-PCR has identical specificity as those of the inverse (Ochman et al., 1988;Triglia et al., 1988) or panhandle (Jones, 1995;Myrick and Gelbart, 2002;Wang et al., 2007) PCR methods. However, inverse PCR requires DNA digestion and ligation before amplification, while panhandle PCR requires the complicated step to form the panhandle-like DNA. ...
The limitations of the current genome-walking strategies include strong background and cumbersome experimental processes. Herein, we report a genome-walking method, fusion primer-driven racket PCR (FPR-PCR), for the reliable retrieval of unknown flanking DNA sequences. Four sequence-specific primers (SSP1, SSP2, SSP3, and SSP4) were sequentially selected from known DNA (5'→3′) to perform FPR-PCR. SSP3 is the fragment that mediates intra-strand annealing (FISA). The FISA fragment is attached to the 5′ end of SSP1, generating a fusion primer. FPR-PCR comprises two rounds of amplification reactions. The single-fusion primary FPR-PCR begins with the selective synthesis of the target first strand, then allows the primer to partially anneal to some place(s) on the unknown region of this strand, producing the target second strand. Afterward, a new first strand is synthesized using the second strand as the template. The 3′ end of this new first strand undergoes intra-strand annealing to the FISA site, followed by the formation of a racket-like DNA by a loop-back extension. This racket-like DNA is exponentially amplified in the secondary FPR-PCR performed using SSP2 and SSP4. We validated this FPR-PCR method by identifying the unknown flanks of Lactobacillus brevis CD0817 glutamic acid decarboxylase genes and the rice hygromycin gene.
... * Dongying Wang zjnbwdy@163.com 1 for genome walking applications largely differ in experimental conditions and can be categorized into three types as follows: (i) inverse PCR (Ochman et al. 1988;Uchiyama and Watanabe 2006); (ii) ligation-mediated PCR (Yan et al. 2003;Yik et al. 2021); and (iii) randomly primed PCR (Liu and Whittier 1995;Wang et al. 2022). Traditional inverse PCR first requires restriction treatment of genomic DNA, followed by self-cyclization of the digested molecules. ...
... To date, many genome walking techniques, such as inverse PCR, ligation-mediated PCR, and randomly primed PCR, have been devised (Ochman et al. 1988 (Li et al. 2015) are the classic representatives of randomly primed PCR. All the methods listed above have contributed to disciplines relevant to genomics, genetics, biotechnology, and so on. ...
Genome walking, a molecular technique for obtaining unknown flanking genomic sequences from a known genomic sequence, has been broadly applied to determine transgenic sites, mine new genetic resources, and fill in chromosomal gaps. This technique has advanced genomics, genetics, and related disciplines. Here, an efficient and reliable genome walking technique, called primer extension refractory PCR (PER-PCR), is presented. PER-PCR uses a set of primary, secondary, and tertiary walking primers. The middle 15 nt of the primary walking primer overlaps with the 3′ parts of the secondary and tertiary primers. The 5′ parts of the three primers are heterologous to each other. The short overlap allows the walking primer to anneal to its predecessor only in a relaxed-stringency PCR cycle, resulting in a series of single-stranded DNAs; however, the heterologous 5′ part prevents the creation of a perfect binding site for the walking primer. In the next stringent cycle, the target single strand can be extended into a double-stranded DNA molecule by the sequence-specific primer and thus can be exponentially amplified by the remaining stringent cycles. The nontarget single strand fails to be enriched due to the lack of a perfect binding site for any primer. PER-PCR was validated by extension into unknown flanking regions of the hyg gene in rice and the gadR gene in Levilactobacillus brevis CD0817. In summary, in this study, a new practical PER-PCR method was constructed as a potential alternative to existing genome walking methods.
... Many methods based on PCR have been developed to obtain T-DNA insertion sites [20][21][22]. Among these methods, thermal asymmetric interleaved PCR (TAIL-PCR) is a practical approach to locating T-DNA insertion sites in transgenic plants, such as transgenic Arabidopsis thaliana [23,24], Zea mays [25], Oryza sativa (O. ...
... Although many PCR-based methods have been successfully applied to locate T-DNA insertion sites in transgenic lines [20][21][22], it remains challenging to identify all insertion sites in multiple T-DNA-inserted lines using these methods, especially in complex genomes [29,30]. In this study, the T-DNA insertion sites were first investigated with FPNI-PCR, and only four T-DNA insertion positions in three chromosomes were identified. ...
The genome-wide long hairpin RNA interference (lhRNAi) library is an important resource for plant gene function research. Molecularly characterizing lhRNAi mutant lines is crucial for identifying candidate genes associated with corresponding phenotypes. In this study, a dwarf and sterile line named P198 was screened from the Brassica napus (B. napus) RNAi library. Three different methods confirmed that eight copies of T-DNA are present in the P198 genome. However, only four insertion positions were identified in three chromosomes using fusion primer and nested integrated polymerase chain reaction. Therefore, the T-DNA insertion sites and copy number were further investigated using Oxford Nanopore Technologies (ONT) sequencing, and it was found that at least seven copies of T-DNA were inserted into three insertion sites. Based on the obtained T-DNA insertion sites and hairpin RNA (hpRNA) cassette sequences, three candidate genes related to the P198 phenotype were identified. Furthermore, the potential differentially expressed genes and pathways involved in the dwarfism and sterility phenotype of P198 were investigated by RNA-seq. These results demonstrate the advantage of applying ONT sequencing to investigate the molecular characteristics of transgenic lines and expand our understanding of the complex molecular mechanism of dwarfism and male sterility in B. napus.
... Ampli cation starts from the core region and proceeds along the ring molecules to the unknown sequences on both sides. Sequences upstream and downstream the core region are obtained by cloning and sequencing the IPCR products [12]. Compared with other methods, IPCR is simple and can simultaneously obtain unknown sequences on both sides of the known sequence. ...
... A: Known sequence of the Ds transposon. Numbers 7,8,9,12, and 13 (italicized letters with deep background and bold) indicate HhaI, AccIII, SacII, NheI, and NdeI restriction enzymes, respectively. Skeleton letters 1, 3, 4, and 6 in the box indicate primers used for the HhaI restriction site; normal letters 2, 5, 10, and 11 with the underline represent primers used for the NdeI restriction site. ...
Inverse PCR (IPCR) is an accurate, simple, feasible, and ideal technique for obtaining unknown sequences. In this study, we used the model monocot Brachypodium distachyon (ecotype Bd21) to standardize the conditions and materials required for successfully performing the IPCR. Analysis of the amplified sequences led us to the following conclusions. First, the distance between the restriction endonuclease cleavage site and the unknown–known sequence boundary should be at least 400 bp. Second, a 6 bp restriction endonuclease such as Nde I produces condensed bands in a size gradient with good specificity, and therefore is a better choice than a 4 bp cutter such as Hha I. Third, a distance of approximately 200 bp between the second primer and the boundary sequence leads to a better amplification effect and effectively ensures the integrity of the unknown flanking sequence. The experimental conditions established in this study serve as a theoretical basis for the amplification of unknown genome sequences of Gramineae crops and other species.
... DNA junction fragments about the insertion sites of the introduced transgene(s) were captured using either inverse PCR (Ochman et al. 1988) or thermal asymmetric interlaced (TAIL) PCR (Liu et al. 1995) methods. Amplified DNA fragments were cloned into pCR2.1-TOPO ...
... Junction fragments about the foreign alleles introduced through Agrobacterium-mediated transformation were captured using either TAIL-PCR (Liu et al. 1995) or inverse PCR (Ochman et al. 1988) methodology. The integrity of the junctions, map positions, and gene models in which the T-DNA elements reside from the genotyped events are summarized in Table 2. ...
A reliable and simple Agrobacterium -mediated transformation system for the unicellular green algae model organism Chlamydomonas reinhardtii has been developed. The protocol has been successfully employed with both neomycin phosphotransferase II ( nptII ) and the phleomycin resistance ( bleI ) genes coupled with the selective agents paromomycin and zeocin, respectively. A set of binary vectors were assembled that carry the selectable marker cassettes under control either of the Rbcs2 alone or fused to the HSP270A leader sequence, PsaD, or ß-tubulin2 promoters. The corresponding T-DNA elements also harbored a cassette with a codon-optimized version of yellow fluorescence protein (YFP) under control of the Rbcs2 promoter in which the YFP open reading frame was interrupted with the first intron of Rbcs2 to prevent expression in Agrobacterium tumefaciens . The resultant binary vectors were introduced into A. tumefaciens strain C58C1/pMP90, and the derived transconjugants were used for transformation studies with the walled C. reinhardtii strain CC124. Estimated transformation frequencies ranged from 0.09 to 2.86 colonies per 10 ⁶ cells inoculated. Molecular characterizations on a subset of the transgenic lineages revealed that most of the transgenic events harbored single locus insertions. Moreover, sequencing of captured junction fragments about the T-DNA insertion site showed that minimal disruption of the C. reinhardtii genome occurred. However, the transgenic lineages often harbored truncated T-DNA regions within the non-selectable marker gene cassettes.
... The original, relatively inefficient, SDM methods based on primer extension with single-stranded DNA templates [8][9][10] have evolved over the years and have been supplanted by the plethora of versatile, highly efficient SDM methods available today. Indeed, currently, a large variety of specific, high-throughput, in vitro [11,12], and in vivo [13][14][15] techniques and manufactured kits The most commonly used in vitro SDM methods employ PCR and are based on either overlap extension PCR [12,16] or inverse PCR (iPCR) [17,18] as well as modifications and combinations of these. Overlap extension PCR is more appropriate for linear sequences and requires multiple rounds of PCR, whereas iPCR is designed for circular templates such as vector insert sequences and uses a simplified protocol necessitating only one PCR. ...
... Overlap extension PCR is more appropriate for linear sequences and requires multiple rounds of PCR, whereas iPCR is designed for circular templates such as vector insert sequences and uses a simplified protocol necessitating only one PCR. Inverse PCR was first reported in 1988 for the identification of flanking regions of a known DNA sequence [17,18]. Its designation, inverse, comes from the fact that the primers are oriented in the reverse direction, facing "outward," away from each other, in contrast to regular PCR where "in-facing" flanking primers are employed. ...
Inverse PCR is a powerful tool for the rapid introduction of desired mutations at desired positions in a circular double-stranded DNA sequence. In this technique, custom-designed mutant primers oriented in the inverse direction are used to amplify the entire circular template with incorporation of the required mutation(s). By careful primer design, it can be used to perform such diverse modifications as the introduction of point or multiple mutations, the insertion of new sequences, and even sequence deletions. Three primer formats are commonly used, nonoverlapping, partially overlapping, and fully overlapping primers, and here we describe the use of nonoverlapping primers for introduction of a point mutation. Use of such a primer setup in the PCR, with one of the primers containing the desired mismatch mutation, results in the amplification of a linear, double-stranded, mutated product. Methylated template DNA is removed from the non-methylated PCR product by DpnI digestion, and the PCR product is then phosphorylated by polynucleotide kinase treatment before being recircularized by ligation and transformed to E. coli. This relatively simple site-directed mutagenesis procedure is of major importance in biology and biotechnology where it is commonly employed for the study and engineering of DNA, RNA, and proteins.Key wordsSite-directed mutagenesisInverse PCRNonoverlapping primersProtein engineering
... Большинство генетических исследований представляют самостоятельные диагностические методики (медицинские услуги «А» класса). Методы генодиагностики наследственных заболеваний направлены на исследование кариотипа, идентификацию генов [4,[11][12][13][14][15][16][17] литературы позволил выявить ряд проблемных вопросов, связанных с молекулярно-генетической диагностикой, решение которых может повлиять на дальнейшее развитие этой отрасли. Так, в номенклатуру медицинских услуг включены некоторые молекулярно-генетические исследования без указания конкретных диагностических методов и их модификаций. ...
... Эффективное применение методов молекулярно-генетической диагностики предполагает дополнительную подготовку практических врачей. Недостаточно глубокие знания основ молекулярной генетики, геномики и транскриптомики затрудняют определение показаний к назначению генетических исследований и интерпретации их результатов [5,14,17]. Решением этой проблемы может служить организация курсов повышения квалификации по вопросам генодиагностики для практических специалистов. Это особенно актуально для врачей, обучавшихся в медицинских вузах по старым Государственным образовательным стандартам, когда молекулярногенетические исследования имели ограниченное применение. ...
The analysis of legal base of genetic researches in clinical practice is carried out. Modern standards of medical care are analyzed. The list of the diseases and pathological states demanding performance of genetic researches is made. The list of the medical services connected with genetic researches is also made. It is shown, that genetic researches make 10% of the nomenclature of medical services. From them about 60% medical services provide diagnosis of somatic pathology, the others are directed to identification of nucleinic acids of causative agents of infectious and parasitic diseases. Genetic researches are carried out mainly at a stage of specialized and primary medical care. Genetic researches are included in20% of standards of medical care. Genetic researches are conducted concerning 15 classes of diseases. More often genetic researches are conducted for diagnosis of the latent infections, enzimopatiya, hereditary diseases of a metabolism, and also cancer. There are some problems of cytogenetic and molecular genetic diagnostics in hospitals. Genetic researches are complex and expensive. Interpretation of the received results is difficult. It is necessary to develop standards of genetic researches. It is necessary to improve legal base of genetic researches.
... Later, PCR-based genome-walking methods were brought forward. Based on the involved rationales, these methods could be classified into inverse PCR [10,11], digestion and ligation-dependent PCR [12,13], and randomly primed PCR [14][15][16]. Prior to PCR amplification, the former two types require digestion of genomic DNA with a suitable endonuclease, followed by self-circularization of the digested product or ligation to a random DNA [10,12,13]. ...
... Based on the involved rationales, these methods could be classified into inverse PCR [10,11], digestion and ligation-dependent PCR [12,13], and randomly primed PCR [14][15][16]. Prior to PCR amplification, the former two types require digestion of genomic DNA with a suitable endonuclease, followed by self-circularization of the digested product or ligation to a random DNA [10,12,13]. Comparatively, randomly primed PCR is an easy-to-use method because it is free of any extra operation before PCR amplification [17,18]. ...
The efficacy of the available genome-walking methods is restricted by low specificity, high background, or composite operations. We herein conceived bridging PCR, an efficient genome-walking approach. Three primers with random sequences, inner walker primer (IWP), bridging primer (BP), and outer walker primer (OWP), are involved in bridging PCR. The BP is fabricated by splicing OWP to the 5′-end of IWP’s 5′-part. A bridging PCR set is constituted by three rounds of amplification reactions, sequentially performed by IWP, BP plus OWP, and OWP, respectively pairing with three nested sequence-specific primers (SSP). A non-target product arising from IWP alone undergoes end-lengthening mediated by BP. This modified non-target product is a preferentially formed hairpin between the lengthened ends, instead of binding with shorter OWP. Meanwhile, a non-target product, triggered by SSP alone or SSP plus IWP, is removed by nested SSP. As a result, only the target DNA is accumulated. The efficacy of bridging PCR was validated by walking the gadA/R genes of Levilactobacillus brevis CD0817 and the hyg gene of rice.
... Each strategy is developed for specific study purposes and has its own merits and demerits. The inverse PCR is developed to help efficiently determine the insertion site of a known sequence in a genome using a primer pair extending outward from the insertion sequence to the 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 flanked unknown sequence after restriction enzyme digestion and circularization after ligation (1). Although the success of inverse PCR is dependent on the high efficiency of template circularization, linearization of the circulated templates by cutting in the middle of the insertion sequence is found to improve the amplification efficiency of inverse PCR because a circular template would pose restraints for template denature and primer binding (12,13). ...
Molecular techniques that recover unknown sequences next to a known sequence region have been widely applied in various molecular studies, such as chromosome walking, identification of the insertion site of transposon mutagenesis, fusion gene partner, and chromosomal breakpoints, as well as targeted sequencing library preparation. Although various techniques have been introduced for efficiency enhancement, searching for relevant single molecular event present in a large-sized genome remains challenging. Here, the optimized ligation-mediated PCR method was developed and successfully identified chromosomal breakpoints far away from the exon of the new exon junction without the need for nested PCR. In addition to recovering unknown sequences next to a known sequence region, the high efficiency of the method could also improve the performance of targeted NGS sequencing.
... pCMVHMGB1 or pCMVHMGB2 expression plasmids were obtained by deleting DsRed-monomer-C1 from the plasmids encoding pDsRed-monomer-C1-HMGB1 or pDsRed-monomer-C1-HMGB2 by mutagenesis with the In-Fusion cloning method [36]. A divergent PCR was performed using two primers (Supplementary Table S4) that overlapped by 15 bp at their 5 ′ ends and did not include DsRed-monomer and Phusion™ High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA). ...
Human high-mobility group-B (HMGB) proteins regulate gene expression in prostate cancer (PCa), a leading cause of oncological death in men. Their role in aggressive PCa cancers, which do not respond to hormonal treatment, was analyzed. The effects of HMGB1 and HMGB2 silencing upon the expression of genes previously related to PCa were studied in the PCa cell line PC-3 (selected as a small cell neuroendocrine carcinoma, SCNC, PCa model not responding to hormonal treatment). A total of 72% of genes analyzed, using pre-designed primer panels, were affected. HMGB1 behaved mostly as a repressor, but HMGB2 as an activator. Changes in SERPINE1, CDK1, ZWINT, and FN1 expression were validated using qRT-PCR after HMGB1 silencing or overexpression in PC-3 and LNCaP (selected as an adenocarcinoma model of PCa responding to hormonal treatment) cell lines. Similarly, the regulatory role of HMGB2 upon SERPINE1, ZWINT, FN1, IGFPB3, and TYMS expression was validated, finding differences between cell lines. The correlation between the expression of HMGB1, HMGB2, and their targets was analyzed in PCa patient samples and also in PCa subgroups, classified as neuroendocrine positive or negative, in public databases. These results allow a better understanding of the role of HMGB proteins in PCa and contribute to find specific biomarkers for aggressive PCa.
... Inverse PCR (i-PCR) [32] was performed to recover genomic sequences flanking each inserted T-DNA. A total volume of 7 µL (100 ng of genomic DNA) was placed in a PCR tube, and 2.3 µL of 10 × Taq I enzyme buffer (Takara, Tokyo, Japan), 2.3 µL of bovine serum albumin, and 11.1 µL of SDW were added. ...
Phialemonium inflatum is a useful fungus known for its ability to mineralise lignin during primary metabolism and decompose polycyclic aromatic hydrocarbons (PAHs). However, no functional genetic analysis techniques have been developed yet for this fungus, specifically in terms of transformation. In this study, we applied an Agrobacterium tumefaciens-mediated transformation (ATMT) system to P. inflatum for a functional gene analysis. We generated 3689 transformants using the binary vector pSK1044, which carried either the hygromycin B phosphotransferase (hph) gene or the enhanced green fluorescent protein (eGFP) gene to label the transformants. A Southern blot analysis showed that the probability of a single copy of T-DNA insertion was approximately 50% when the co-cultivation of fungal spores and Agrobacterium tumefaciens cells was performed at 24–36 h, whereas at 48 h, it was approximately 35.5%. Therefore, when performing gene knockout using the ATMT system, the co-cultivation time was reduced to ≤36 h. The resulting transformants were mitotically stable, and a PCR analysis confirmed the genes’ integration into the transformant genome. Additionally, hph and eGFP gene expressions were confirmed via PCR amplification and fluorescence microscopy. This optimised transformation system will enable functional gene analyses to study genes of interest in P. inflatum.
... Transposons can also be used to inactivate genes, if they are integrated in genes or in important control regions [25]. In a genome wide effort, to inactivate genes and similarly having the possibility to generate defined deficiencies, more than 20,000 transposon insertions were generated [24] and their integration sites were mapped cytologically or molecularly using inverse PCR experiments [26]. As transposons P-elements and piggiBac transposons were used because they have different target site specificities. ...
... Transposons can also be used to inactivate genes, if they are integrated in genes or in important control regions [25]. In a genome wide effort, to inactivate genes and similarly having the possibility to generate defined deficiencies, more than 20,000 transposon insertions were generated [24] and their integration sites were mapped cytologically or molecularly using inverse PCR experiments [26]. As transposons P-elements and piggiBac transposons were used because they have different target site specificities. ...
The 57B region of Drosophila melanogaster includes a cluster of the three homeobox genes orthopedia (otp), Drosophila Retinal homeobox (DRx), and homeobrain (hbn). In an attempt to isolate mutants for these genes, we performed an EMS mutagenesis and isolated lethal mutants from the 57B region, among them mutants for otp, DRx, and hbn. With the help of two newly generated deletions from the 57B region, we mapped additional mutants to specific chromosomal intervals and identified several of these mutants from the 57B region molecularly. In addition, we generated mutants for CG15651 and RIC-3 by gene targeting and mutants for the genes CG9344, CG15649, CG15650, and ND-B14.7 using the CRISPR/Cas9 system. We determined the lethality period during development for most isolated mutants. In total, we analysed alleles from nine different genes from the 57B region of Drosophila, which could now be used to further explore the functions of the corresponding genes in the future.
... The genomic DNA of mutant strains was extracted via the CTAB method [71]. The location of the Tn5 transposon was determined using inverse PCR [72] and random primer PCR [73] techniques. PCR products were sent to biocompanies for DNA sequencing. ...
The research on plant endophytes has been drawing a lot of attention in recent years. Pantoea belongs to a group of endophytes with plant growth-promoting activity and has been widely used in agricultural fields. In our earlier studies, Pantoea eucalypti FBS135 was isolated from healthy-growing Pinus massoniana and was able to promote pine growth. P. eucalypti FBS135 can grow under extremely low nitrogen conditions. To understand the mechanism of the low-nitrogen tolerance of this bacterium, the transcriptome of FBS135 in the absence of nitrogen was examined in this study. We found that FBS135 actively regulates its gene expression in response to nitrogen deficiency. Nearly half of the number (4475) of genes in FBS135 were differentially expressed under this condition, mostly downregulated, while it significantly upregulated many transportation-associated genes and some nitrogen metabolism-related genes. In the downregulated genes, the ribosome pathway-related ones were significantly enriched. Meanwhile, we constructed a Tn5 transposon library of FBS135, from which four genes involved in low-nitrogen tolerance were screened out, including the gene for the host-specific protein J, RNA polymerase σ factor RpoS, phosphoribosamine-glycine ligase, and serine acetyltransferase. Functional analysis of the genes revealed their potential roles in the adaptation to nitrogen limitation. The results obtained in this work shed light on the mechanism of endophytes represented by P. eucalypti FBS135, at the overall transcriptional level, to an environmentally limited nitrogen supply and provided a basis for further investigation on this topic.
... To generate 1-293 CP190 derivatives with either 190-210 aa or 217-242 aa deletions, we used in-fusion cloning mutagenesis technology [101]. PCR-fusion involves two parallel PCR amplifications from pGBT9 CP190_1-293 template with: rev190 5 CTCGAATGGTGACGTTGTTCGGCTCATTGTG 3 , dir210 5 ACAATGAGCCGAACAAGTCACCATTCGAGC 3 primers for 190-210 aa deletion; and: rev217 5 TTCCTTAACCTCTTCTCGCAGCTGCTCGAAT 3 , dir242 5 TTCGAGCAGCTGCGAGAAGAGGTTAAGGAAT 3 primers for 217-242 aa deletion. ...
CP190 is a co-factor in many Drosophila architectural proteins, being involved in the formation of active promoters and insulators. CP190 contains the N-terminal BTB/POZ (Broad-Complex, Tramtrack and Bric a brac/POxvirus and Zinc finger) domain and adjacent conserved regions involved in protein interactions. Here, we examined the functional roles of these domains of CP190 in vivo. The best-characterized architectural proteins with insulator functions, Pita, Su(Hw), and dCTCF, interacted predominantly with the BTB domain of CP190. Due to the difficulty of mutating the BTB domain, we obtained a transgenic line expressing a chimeric CP190 with the BTB domain of the human protein Kaiso. Another group of architectural proteins, M1BP, Opbp, and ZIPIC, interacted with one or both of the highly conserved regions in the N-terminal part of CP190. Transgenic lines of D. melanogaster expressing CP190 mutants with a deletion of each of these domains were obtained. The results showed that these mutant proteins only partially compensated for the functions of CP190, weakly binding to selective chromatin sites. Further analysis confirmed the essential role of these domains in recruitment to regulatory regions associated with architectural proteins. We also found that the N-terminal of CP190 was sufficient for recruiting Z4 and Chromator proteins and successfully achieving chromatin opening. Taken together, our results and the results of previous studies showed that the N-terminal region of CP190 is a platform for simultaneous interaction with various DNA-binding architectural proteins and transcription complexes.
... Insertion junctions were determined with the inverse PCR approach (Ochman et al., 1988;Triglia et al., 1988) using dedicated primer pairs (Table S10). At first, inverse PCR was performed for the junction at the 3′ piggyBac terminal repeat with the I-3′ primer pair with several promoterspecific and several 3′-backbone-specific restriction enzymes, and if unsuccessful, also at the 5′ piggyBac terminal repeat with the I-5′ primer pair and several 5′-backbone-specific restriction enzymes. ...
For diploid model organisms, the actual transgenesis processes require subsequent periods of transgene management, which are challenging in emerging model organisms due to the lack of suitable methodology. We used the red flour beetle Tribolium castaneum, a stored-grain pest, to perform a comprehensive functional evaluation of our AClashOfStrings (ACOS) and the combined AGameOfClones/AClashOfStrings (AGOC/ACOS) vector concepts, which use four clearly distinguishable markers to provide full visual control over up to two independent transgenes. We achieved comprehensive statistical validation of our approach by systematically creating seventeen novel single and double homozygous sublines intended for fluorescence live imaging, including several sublines in which the microtubule cytoskeleton is labeled. During the mating procedures, we genotyped more than 20,000 individuals in less than 80 working hours, which corresponds to about 10 to 15 s per individual. We also confirm the functionality of our combined concept in two double transgene special cases, i.e. integration of both transgenes in close proximity on the same chromosome and integration of one transgene on the X allosome. Finally, we discuss our vector concepts regarding performance, genotyping accuracy, throughput, resource saving potential, fluorescent protein choice, modularity, adaptation to other diploid model organisms and expansion capability.
... The available PCR-based techniques can be clustered into two types: genome pretreatment-dependent PCR (Ochman et al., 1988;Uchiyama and Watanabe, 2006;Yu et al., 2020;Yik et al., 2021) and random priming-based PCR (Liu and Whittier, 1995;Wang et al., 2007;Sun et al., 2022). The pretreatment is mainly composed of the restriction cleavage of genome and the subsequent ligation operation. ...
The reported genome-walking methods still suffer from some deficiencies, such as cumbersome experimental steps, short target amplicon, or deep background. Here, a simple and practical fork PCR was proposed for genome-walking. The fork PCR employs a fork primer set of three random oligomers to implement walking task. In primary fork PCR, the low-stringency amplification cycle mediates the random binding of primary fork primer to some places on genome, producing a batch of single-stranded DNAs. In the subsequent high-stringency amplification, the target single-strand is processed into double-strand by the site-specific primer, but a non-target single-stranded DNA cannot be processed by any primer. As a result, only the target DNA can be exponentially amplified in the remaining high-stringency cycles. Secondary/tertiary nested fork PCR(s) further magnifies the amplification difference between the both DNAs by selectively enriching target DNA. The applicability of fork PCR was validated by walking several gene loci. The fork PCR could be a perspective substitution for the existing genome-walking schemes.
... It is a method used to amplify DNA over the entire length up to 25-30kb of genomic DNA segments with the help of high-fidelity DNA polymerase [16]. * Inverse PCR: Inverse PCR also called as inverted or inside-out PCR is a modification of the conventional PCR which is used to amplify DNA sequences outside of a known sequence or flanking the known DNA sequence [17,18]. * Quantitative PCR: It is a PCR-based technique which allows for the real time measurement of PCR product during amplification process, and which is compared with a standard DNA [19,20]. ...
molecular diagnosis of infectious disease and different techniques
... It is a method used to amplify DNA over the entire length up to 25-30kb of genomic DNA segments with the help of high-fidelity DNA polymerase [16]. * Inverse PCR: Inverse PCR also called as inverted or inside-out PCR is a modification of the conventional PCR which is used to amplify DNA sequences outside of a known sequence or flanking the known DNA sequence [17,18]. * Quantitative PCR: It is a PCR-based technique which allows for the real time measurement of PCR product during amplification process, and which is compared with a standard DNA [19,20]. ...
molecular diagnosis of infectious diseases, techniques
... Colonies were picked and grown in a liquid medium with kanamycin. Transposon insertions were sequenced using inverse PCR (24). Sequences were mapped to the M. smegmatis genome to identify insertion sites. ...
Mycobacteria can colonize environments where the availability of metal ions is limited. Biological or inorganic chelators play an important role in limiting metal availability, and we developed a model to examine Mycobacterium smegmatis survival in the presence of the chelator sodium citrate. We observed that instead of restricting M. smegmatis growth, concentrated sodium citrate killed M. smegmatis . RNAseq analysis during sodium citrate treatment revealed transcriptional signatures of metal starvation and hyperosmotic stress. Notably, metal starvation and hyperosmotic stress, individually, do not kill M. smegmatis under these conditions. A forward genetic transposon selection was conducted to examine why sodium citrate was lethal, and several sodium-citrate-tolerant mutants were isolated. Based on the identity of three tolerant mutants, mgtE , treZ , and fadD6, we propose a dual stress model of killing by sodium citrate, where sodium citrate chelate metals from the cell envelope and then osmotic stress in combination with a weakened cell envelope causes cell lysis. This sodium citrate tolerance screen identified mutants in several other genes with no known function, with most conserved in the pathogen M. tuberculosis . Therefore, this model will serve as a basis to define their functions, potentially in maintaining cell wall integrity, cation homeostasis, or osmotolerance.
IMPORTANCE
Bacteria require mechanisms to adapt to environments with differing metal availability. When Mycobacterium smegmatis is treated with high concentrations of the metal chelator sodium citrate, the bacteria are killed. To define the mechanisms underlying killing by sodium citrate, we conducted a genetic selection and observed tolerance to killing in mutants of the mgtE magnesium transporter. Further characterization studies support a model where killing by sodium citrate is driven by a weakened cell wall and osmotic stress, that in combination cause cell lysis.
... The gene encoding the wild-type HNL from Hevea brasiliensis in the pSE420 plasmid [41] was recloned into a pET21a(+) plasmid. HbHNL enzyme variants were constructed via inverse PCR [42] using non-overlapping mutagenic primers in a sequential manner (Supplementary Table 3). Briefly, mutagenic primers anneal to the plasmid template in a back-to-back, outward-facing orientation and are amplified using New England Biolabs (NEB) Q5 HiFi polymerase (M0491S) to produce a linear, double-stranded DNA product containing the desired mutation(s). ...
Hydroxynitrile lyase from rubber tree (HbHNL) shares 45% identical amino acid residues with the homologous esterase from tobacco, SABP2, but the two enzymes catalyze different reactions. The x-ray structures reveal a serine-histidine-aspartate catalytic triad in both enzymes along with several differing amino acid residues within the active site. Previous exchange of three amino acid residues in the active site of HbHNL with the corresponding amino acid residue in SABP2 (T11G-E79H-K236M) created variant HNL3, which showed low esterase activity toward p-nitrophenyl acetate. Further structure comparison reveals additional differences surrounding the active site. HbHNL contains an improperly positioned oxyanion hole residue and differing solvation of the catalytic aspartate. We hypothesized that correcting these structural differences would impart good esterase activity on the corresponding HbHNL variant. To predict the amino acid substitutions needed to correct the structure, we calculated shortest path maps for both HbHNL and SABP2, which reveal correlated movements of amino acids in the two enzymes. Replacing four amino acid residues (C81L-N104T-V106F-G176S) whose movements are connected to the movements of the catalytic residues yielded variant HNL7TV (stabilizing substitution H103V was also added), which showed an esterase catalytic efficiency comparable to that of SABP2. The x-ray structure of an intermediate variant, HNL6V, showed an altered solvation of the catalytic aspartate and a partially corrected oxyanion hole. This dramatic increase in catalytic efficiency demonstrates the ability of shortest path maps to predict which residues outside the active site contribute to catalytic activity.
... genes were synthesized and optimized for expression in E. coli (GeneScript). For crystallization, the C-terminal 21 residues of BpeB were deleted by using an inverse PCR method (54). Each primer is listed in SI Appendix , Table S7. ...
BpeB and BpeF are multidrug efflux transporters from Burkholderia pseudomallei that enable multidrug resistance. Here, we report the crystal structures of BpeB and BpeF at 2.94 Å and 3.0 Å resolution, respectively. BpeB was found as an asymmetric trimer, consistent with the widely-accepted functional rotation mechanism for this type of transporter. One of the monomers has a distinct structure that we interpret as an intermediate along this functional cycle. Additionally, a detergent molecule bound in a previously undescribed binding site provides insights into substrate translocation through the pathway. BpeF shares structural similarities with the crystal structure of OqxB from Klebsiella pneumoniae, where both are symmetric trimers composed of three "binding"-state monomers. The structures of BpeB and BpeF further our understanding of the functional mechanisms of transporters belonging to the HAE1-RND superfamily.
... Compared to conventional reporter mapping approaches (e.g. inverse-PCR 30 , Splinkerette PCR 31 , LAM-PCR 32 and tagmentation-assisted PCR 33 ), this method has two key advantages. First, it does not rely on biochemical steps that are biased and display suboptimal efficiency (e.g. ...
Prime editing is a powerful means of introducing precise changes to specific locations in mammalian genomes. However, the widely varying efficiency of prime editing across target sites of interest has limited its adoption in the context of both basic research and clinical settings. Here, we set out to exhaustively characterize the impact of the cis- chromatin environment on prime editing efficiency. Using a newly developed and highly sensitive method for mapping the genomic locations of a randomly integrated “sensor”, we identify specific epigenetic features that strongly correlate with the highly variable efficiency of prime editing across different genomic locations. Next, to assess the interaction of trans -acting factors with the cis -chromatin environment, we develop and apply a pooled genetic screening approach with which the impact of knocking down various DNA repair factors on prime editing efficiency can be stratified by cis -chromatin context. Finally, we demonstrate that we can dramatically modulate the efficiency of prime editing through epigenome editing, i.e. altering chromatin state in a locus-specific manner in order to increase or decrease the efficiency of prime editing at a target site. Looking forward, we envision that the insights and tools described here will broaden the range of both basic research and therapeutic contexts in which prime editing is useful.
... The amplified fragment was cloned into the pZErO-2 vector (Invitrogen) and analyzed using sequence analysis. The complete nucleotide sequence of the metallo-oxidase gene from C. heterostrophus (ChMco1) was obtained via inverse PCR (Ochman et al. 1988) and primer walking analysis. The gene sequence of ChMco1 was deposited in DDBJ/EMBL/Genbank under accession no. ...
A metallo-oxidase gene from a phytopathogenic filamentous fungus, Cochliobolus heterostrophus was cloned. Structural prediction of ChMco1 indicated that this protein lacks a transmembrane helix and is soluble, whereas other known fungal metallo-oxidases including Saccharomyces cerevisiae FET3 are localized to the cell membrane. The results of searches in fungal genomic databases and phylogenetic analysis of fungal metallo-oxidases revealed that ChMco1 and its allies are distinct homologues of Fet3 and unique to filamentous ascomycetous species including C. heterostrophus. We performed a functional analysis of ChMCO1 by generating null mutants for the ChMco1 gene. The ChMco1 null (ΔChMco1) mutants clearly had reduced melanization, although they showed normal growth and conidiation. Results also show that ΔChMco1 mutants lost laccase activity. These results suggest that ChMCO1 is a novel class of metallo-oxidase that is necessary for laccase activity and melanization.
... The inserted fragments were sequenced using primers M13-20 (5 0 -CGACGTTGTAAAACGACGGCC AGT-3 0 ) and M13-RVM (5 0 -GAGCGGATAACAATTT CACACAGG-3 0 ). The 5 0 -and 3 0 -flanking regions of the obtained sequence were amplified by inverse polymerase chain reaction (PCR) (Ochman et al. 1988) using a restriction enzyme EcoRI and the primer pair Sal1invF (5 0 -TT GTCCAAGAAGGACCGGTAGTCGAT-3 0 ) and Sal1invR (5 0 -TTCAACACGCACTGGTACAAGAAGAT-3 0 ), and an entire sequence of this gene was determined by primerwalking analysis. To map an intron within this gene, we also performed poly(A) ? ...
A melanin biosynthetic gene, Sal1, in the southern corn leaf blight fungus Cochliobolus heterostrophus, was identified by degenerate and inverse PCR. Structural analysis revealed that the open reading frame is 555 bp in length, interrupted by one intron. Melanin deficiency of the sal1 mutant strain, which accumulates the intermediate scytalone, was successfully complemented by introducing the gene fragment. These results suggest that Sal1 is a scytalone dehydratase gene of C. heterostrophus.
... In addition to loss-of-function experiments and epigenetic modulation, CRISPR-Cas can be used in combination with homology-directed repair (HDR) to perform scarless genome editing and insert new elements at specific genomic sites [43,70] [43,71] or with large ssODN derived by in vitro transcription and retrotranscription [72]. The decrease in the costs of gene synthesis and the establishment of ligation-independent cloning methods, such as Gibson assembly [73] and In-Fusion [74,75] cloning, have considerably simplified the generation of large and complex templates for HDR. Importantly, the PAM site or the sgRNA seed sequence in the HDR template should be mutated so as to prevent nuclease cleavage. ...
Gaining a mechanistic understanding of the molecular pathways underpinning cellular and organismal physiology invariably relies on perturbation of an experimental system to infer causality. This can be achieved either by genetic manipulation or by pharmacological treatment. Generally, the former approach is applicable to a wider range of targets, is more precise and can address more nuanced functional aspects. Despite such apparent advantages, genetic manipulation (i.e. knock-down, knock-out, mutation and tagging) in mammalian systems can be challenging due to problems with delivery, low rates of homologous recombination and epigenetic silencing. The advent of CRISPR-Cas9 in combination with the development of robust differentiation protocols that can efficiently generate a variety of different cell types in vitro has accelerated our ability to probe gene function in a more physiological setting. Often the main obstacle in this path of enquiry is to achieve the desired genetic modification. In this short review, we will focus on gene perturbation in mammalian cells and how editing and differentiation of pluripotent stem cells can complement more traditional approaches. Additionally, we introduce novel targeted protein degradation approaches as an alternative to DNA/RNA-based manipulation. Our aim is to provide a broad overview of recent approaches and in vitro systems to study mammalian cell biology. Due to space limitations, we limit ourselves to provide the inexperienced reader with a conceptual framework on how to use these tools, and for more in-depth information we will provide specific references throughout.
... Inverse PCR [44] was conducted as illustrated in (Additional file 1: Fig. S6a). Genomic DNA (1 µg) extracted from each of 10 18.5 dpc TG mouse embryos was digested with the MboI restriction enzyme. ...
Background
Epigenome-edited animal models enable direct demonstration of disease causing epigenetic mutations. Transgenic (TG) mice stably expressing epigenome-editing factors exhibit dramatic and stable changes in target epigenome modifications. Successful germline transmission of a transgene from founder mice to offspring will yield a sufficient number of epigenome-edited mice for phenotypic analysis; however, if the epigenetic mutation has a detrimental phenotypic effect, it can become difficult to obtain the next generation of animals. In this case, the phenotype of founder mice must be analyzed directly. Unfortunately, current TG mouse production efficiency (TG founders per pups born) is relatively low, and improvements would increase the versatility of this technology.
Results
In the current study, we describe an approach to generate epigenome-edited TG mice using a combination of both the dCas9–SunTag and piggyBac (PB) transposon systems. Using this system, we successfully generated mice with demethylation of the differential methylated region of the H19 gene ( H19 -DMR), as a model for Silver–Russell syndrome (SRS). SRS is a disorder leading to growth retardation, resulting from low insulin-like growth factor 2 ( IGF2 ) gene expression, often caused by epimutations at the H19-IGF2 locus. Under optimized conditions, the efficiency of TG mice production using the PB system was approximately threefold higher than that using the conventional method. TG mice generated by this system showed demethylation of the targeted DNA region and associated changes in gene expression. In addition, these mice exhibited some features of SRS, including intrauterine and postnatal growth retardation, due to demethylation of H19 -DMR.
Conclusions
The dCas9–SunTag and PB systems serve as a simple and reliable platform for conducting direct experiments using epigenome-edited founder mice.
... Conventional PCR allows sequences within known boundaries to be amplified. Several methods, including targeted gene-walking PCR (Parker et al., 1991), unpredictably primed PCR (Dominguez & Lopez-Larrea, 1994), and inverse PCR (Ochman et al., 1988;Triglia et al., 1988), have been developed to amplify DNA sequences that flank regions with known sequences. It is difficult to identify the gender of a reproductively inactive individual jojoba plant. ...
... Inverse PCR was carried out on genomic DNA essentially according to the method of Ochman et al. (1988) except that a second round of PCR was included giving a linear product containing DNA flanking the BPS gene. Nested primers were designed around the AaBPS sequence as follows: primer pair 1 (outer) comprised BPS5'_F1 and BPS5'_R1; primer pair 2 (inner) comprised BPS5'_F2 and BPS5'_R2. ...
The monoterpene camphor is produced in glandular secretory trichomes of the medicinal plant Artemisia annua , which also produces the antimalarial drug artemisinin. We have found that, depending on growth conditions, camphor can accumulate at levels ranging from 1- 10% leaf dry weight (LDW) in the Artemis F1 hybrid, which has been developed for commercial production of artemisinin at up to 1% LDW. We discovered that a camphor null (camphor-0) phenotype segregates in the progeny of self-pollinated Artemis material. Camphor-0 plants also show reduced levels of other less abundant monoterpenes and increased levels of the sesquiterpene precursor farnesyl pyrophosphate plus sesquiterpenes, including enzymatically derived artemisinin pathway intermediates but not artemisinin. One possible explanation for this is that high camphor concentrations in the glandular secretory trichomes play an important role in generating the hydrophobic conditions required for the non-enzymatic conversion of dihydroartemisinic acid tertiary hydroperoxide to artemisinin. We established that the camphor-0 phenotype associates with a genomic deletion that results in loss of a Bornyl diPhosphate Synthase ( AaBPS ) gene candidate. Functional characterization of the corresponding enzyme in vitro confirmed it can catalyze the first committed step in not only camphor biosynthesis but also in a number of other monoterpenes, accounting for over 60% of total volatiles in A. annua leaves. This in vitro analysis is consistent with loss of monoterpenes in camphor-0 plants. The AaBPS promoter drives high reporter gene expression in A. annua glandular secretory trichomes of juvenile leaves with expression shifting to non-glandular trichomes in mature leaves, which is consistent with AaBPS transcript abundance.
The review discusses a range of classical and modern methods used to determine the nucleotide sequence of unknown DNA regions flanking known ones. These methods are applied to decipher the regulatory regions of genes, identify integration sites of T-DNA or viruses, and so on, in cases where the use of whole-genome sequencing is not justified. To amplify a DNA segment, a binding site for a primer must be added to the end of the unknown sequence. This can be achieved either by ligating an adapter or by annealing a degenerate primer under gentle conditions, or by looping the DNA fragment so that the target region is surrounded by known sequences. The second important task is to eliminate the inevitable products of nonspecific binding of adapters or degenerate primers, which is often resolved through multiple rounds of nested PCR. Different methods vary significantly in terms of complexity, prevalence, and the availability of required reagents.
Enzymes that produce volatile metabolites can be coded into genetic circuits to report non-disruptively on microbial behaviors in hard-to-image soils. However, these enzyme reporters remain challenging to apply in gene transfer studies due to leaky off states that can lead to false positives. To overcome this problem, we designed a reporter that uses ribozyme-mediated gene-fragment complementation of a methyl halide transferase (MHT) to regulate the synthesis of methyl halides. We split the mht gene into two non-functional fragments and attached these to a pair of splicing ribozyme fragments. While the individual mht -ribozyme fragments did not produce methyl halides when transcribed alone in Escherichia coli , co-expression resulted in a spliced transcript that translated the MHT reporter. When cells containing one mht -ribozyme fragment transcribed from a mobile plasmid were mixed with cells that transcribed the second mht -ribozyme fragment, methyl halides were only detected following rare conjugation events. When conjugation was performed in soil, it led to a 16-fold increase in methyl halides in the soil headspace. These findings show how ribozyme-mediated gene-fragment complementation can achieve tight control of protein reporter production, a level of control that will be critical for monitoring the effects of soil conditions on gene transfer and the fidelity of biocontainment measures developed for environmental applications.
The genes encoding monomer- and dimer-type isocitrate dehydrogenase (EC 1.1.1.42) isozymes from a Gram-negative psychrotrophic bacterium, Psychrobacter okhotkensis, (PoIDH-M and PoIDH-D, respectively) were cloned and sequenced. The open reading frames of the genes encoding PoIDH-M and PoIDH-D were 2,217 and 1,257 bp in length and corresponded to polypeptides composed of 739 and 419 amino acids, respectively. Their deduced amino acid sequences showed high degrees of homology with those of the respective type IDHs from Colwellia maris (61 and 71% identity, respectively) and, particularly, the putative IDHs from other bacteria of genus Psychrobacter (more than 87% identity). The two genes existed facing each other with a spacer of 322 bases in the order of the PoIDH-M and PoIDH-D genes on the chromosomal DNA. The His-tagged PoIDH-M and PoIDH-D overproduced in Escherichia coli cells showed the highest activities at 30 and 50°C, respectively. Their residual activities after incubation for 10 min at 45°C were 0 and about 80%, respectively, and the latter IDH activity was lost completely by incubation at 50°C. From these results, PoIDH-M and PoIDH-D were concluded to be cold-adapted and mesophilic enzymes, respectively.
By western blot analysis with antibodies against monomeric and dimeric isocitrate dehydrogenases (IDHs), a Gram-positive psychrotrophic bacterium, strain G-4, was confirmed to possess only monomeric IDH. The gene encoding this enzyme (G-4IDH) was cloned and sequenced. The open reading frame of this gene was 2,220 bp in length, corresponding to a polypeptide composed of 739 amino acids. The transcriptional initiation site for the gene was guanine, located at 695 bases upstream of the translational start codon. The deduced amino acid sequence showed high identities with those of the monomeric IDHs from Gram-negative bacteria such as Colwellia maris and Azotobacter vinelandii (62% and 64% identity, respectively) and, particularly, the putative IDHs of Gram-positive bacteria, Arthrobacter alpinus and Paenarthrobacter aurescens (91% and 81% identity, respectively). The His-tagged G-4IDH was overproduced in the Escherichia coli cells and was purified and characterized. The G-4IDH showed the highest activity at 45°C, indicating that it is mesophilic. However, the residual activity after incubation for 10 min at 35°C was 37%, and G-4IDH was more thermolabile than a typical mesophilic IDH of A. vinelandii
The structural diversity and tunability of the capsid proteins (CPs) of various icosahedral and rod-shaped viruses have been well studied and exploited in the development of smart hybrid nanoparticles. However, the potential of CPs of the wide-spread flexuous filamentous plant viruses remains to be explored. Here, we show that we can control the shape, size, RNA encapsidation ability, symmetry, stability and surface functionalization of nanoparticles through structure-based design of CP from potato virus Y (PVY). We provide high-resolution insight into CP-based self-assemblies, ranging from large polymorphic or monomorphic filaments to smaller annular, cubic or spherical particles. Furthermore, we show that we can prevent CP self-assembly in bacteria by fusion with a cleavable protein, enabling controlled nanoparticle formation in vitro. Understanding the remarkable structural diversity of PVY CP not only provides possibilities for the production of biodegradable nanoparticles, but may also advance future studies of CP’s polymorphism in a biological context.
Non-alcoholic liver disease (NAFLD) is a condition caused by excessive fat accumulation in the liver and developed via multiple pathways. miR-27b has been suggested to play crucial roles in the development of NAFLD, assuming via targeting genes involved in lipid catabolism and anabolism. However, other pathways regulated by miR-27b are largely unknown. Here we show that lipid accumulation was induced in miR-27b–transfected human and mouse hepatic cells and that knockdowns of three miR-27b–target genes, β-1,4-galactosyltransferase 3 (B4GALT3), matrix AAA peptidase interacting protein 1 (MAIP1) and PH domain and leucine rich repeat protein phosphatase 2 (PHLPP2), induced lipid accumulation. We also show that B4GALT3 and MAIP1 were direct targets of miR-27b and overexpression of MAIP1 ameliorated miR-27b−induced lipid accumulation. In addition, we show that hepatic Maip1 expression declined in mice fed a high-fat diet, suggesting the involvement of decreased Maip1 expression in the condition of fatty liver. Overall, we identified MAIP1/miR-27b axis as a mediator of hepatic lipid accumulation, a potential therapeutic target for NAFLD.
Mincle (macrophage-inducible C-type lectin, CLEC4E) is a C-type lectin immune-stimulatory receptor for cord factor, trehalose dimycolate (TDM), which serves as a potent component of adjuvants. The recognition of glycolipids by Mincle, especially their lipid parts, is poorly understood. Here, we performed nuclear magnetic resonance analysis, revealing that titration of trehalose harboring a linear short acyl chain showed a chemical shift perturbation of hydrophobic residues next to the Ca-binding site. Notably, there were split signals for Tyr201 upon complex formation, indicating two binding modes for the acyl chain. In addition, most Mincle residues close to the Ca-binding site showed no observable signals, suggesting their mobility on an ∼ ms scale even after complex formation. Mutagenesis study supported two putative lipid-binding modes for branched acyl-chain TDM binding. These results provide novel insights into the plastic-binding modes of Mincle toward a wide range of glycol- and glycerol-lipids, important for rational adjuvant development.
Protein A affinity chromatography is widely used for the large-scale purification of antibodies because of its high yield, selectivity and compatibility with NaOH sanitation. A general platform to produce robust affinity capture ligands for proteins beyond antibodies would improve bioprocessing efficiency. We previously developed nanoCLAMPs, a class of antibody mimetic proteins useful as lab-scale affinity capture reagents. This work describes a protein engineering campaign to develop a more robust nanoCLAMP scaffold compatible with harsh bioprocessing conditions. The campaign generated an improved scaffold with dramatically improved resistance to heat, proteases and NaOH. To isolate additional nanoCLAMPs based on this scaffold, we constructed a randomized library of 1 X 1010 clones and isolated binders to several targets. We then performed an in-depth characterization of nanoCLAMPs recognizing yeast SUMO, a fusion partner used for the purification of recombinant proteins. These second-generation nanoCLAMPs typically had a Kd of < 80 nM, a Tm of > 70°C and a t1/2 in 0.1 mg/mL trypsin of > 20 h. Affinity chromatography resins bearing these next-generation nanoCLAMPs enabled single-step purifications of SUMO-fusions. Bound target proteins could be eluted at neutral or acidic pH. These affinity resins maintained binding capacity and selectivity over 20 purification cycles, each including 10 min of cleaning-in-place with 0.1 M NaOH, and remained functional after exposure to 100% DMF and autoclaving. The improved nanoCLAMP scaffold will enable the development of robust, high-performance affinity chromatography resins against a wide range of protein targets.
Clustered regularly interspaced short palindromic repeats (CRISPR) and polymerases are powerful enzymes and their diverse applications in genomics, proteomics, and transcriptomics have revolutionized the biotechnology industry today. CRISPR has been widely adopted for genomic editing applications and Polymerases can efficiently amplify genomic transcripts via polymerase chain reaction (PCR). Further investigations into these enzymes can reveal specific details about their mechanisms that greatly expand their use. Single-molecule techniques are an effective way to probe enzymatic mechanisms because they may resolve intermediary conformations and states with greater detail than ensemble or bulk biosensing techniques. This review discusses various techniques for sensing and manipulation of single biomolecules that can help facilitate and expedite these discoveries. Each platform is categorized as optical, mechanical, or electronic. The methods, operating principles, outputs, and utility of each technique are briefly introduced, followed by a discussion of their applications to monitor and control CRISPR and Polymerases at the single molecule level, and closing with a brief overview of their limitations and future prospects.
Here we describe a protocol for wristwatch PCR, an approach based on wristwatch-like structure formed between walking primers to obtain unknown flanks. We specify the criteria for designing wristwatch primers and gene-specific primers. We detail how to set wristwatch primer permutations to obtain personalized walking outcomes and improve walking efficiency. We describe experimental procedures for isolating a DNA of interest using three rounds of nested wristwatch PCR as well as the subsequent steps for DNA purification, cloning, and sequencing. For complete details on the use and execution of this protocol, please refer to Wang et al. (2022).1.
The glutathione S-transferases (GST) genes are a multigene family of enzymes involved in the metabolism of endogenous and xenobiotic compounds by catalysing the conjugation of the reduced form of glutathione to the substrate. The epsilon class of GST (GSTe), unique to arthropods, is known to be involved in the detoxification process of several classes of insecticides, and GSTe2 in particular is known to have DDT dehydrochlorinase activity. This communication reports a tandem duplication of a genomic region encoding GSTe2 and GSTe4 genes in a laboratory-colonized DDT-resistant Anopheles stephensi. We identified duplication breakpoints and the organization of gene duplication through Sanger sequencing performed on long-PCR products. Manual annotation of sequences revealed a tandemly-arrayed duplication of a 3.62 kb segment of GST epsilon gene clusters comprised of five genes: a partial GSTe1, GSTe2, GSTe2-pseudogene, GSTe4 and partial GSTe5, interconnected by a conserved 2.42 kb DNA insert segment major part of which is homologous to a genomic region located on a different chromosome. The tandemly duplicated array contained a total of two GSTe2 and three GSTe4 functional paralog genes. Read-depth coverage and split-read analysis of Illumina-based whole-genome sequence reads confirmed the presence of duplication in the corresponding region of the genome. The increased gene dose in mosquitoes as a result of the GSTe gene-duplication may be an adaptive process to increase levels of detoxifying enzymes to counter insecticide pressure.
3-Hydroxypropionic acid (3-HP) production from renewable feedstocks is of great interest in efforts to develop greener processes for obtaining this chemical platform. Here we report an engineered E. coli strain for 3-HP production through the β-alanine pathway. To obtain a new strain capable of producing 3-HP, the pathway was established by overexpressing the enzymes pyruvate aminotransferase, 3-hydroxyacid dehydrogenase, and L-aspartate-1-decarboxylase. Further increase of the 3-HP titer was achieved using evolutionary optimizations of a genome-scale metabolic model of E. coli containing the adopted pathway. From these optimizations, three non-intuitive targets for in vivo assessment were identified: L-alanine aminotransferase and alanine racemase overexpression, and L-valine transaminase knock-out. The implementation of these targets in the production strain resulted in a 40% increase in 3-HP titer. The strain was further engineered to overexpress phosphoenolpyruvate carboxylase, reaching 0.79 ± 0.02g/L of 3-HP when grown using glucose. Surprisingly, this strain produced 63% more of the desired product when grown using a mixture of glucose and xylose (1:1, C-mol), and gene expression analysis showed that the cellular adjustment to consume xylose had a positive impact on 3-HP accumulation. Fed-batch culture with xylose feeding led to a final titer of 29.1g/L. These results reinforce the value of computational methods in strain engineering, enabling the design of more efficient strategies to be assessed. Moreover, higher production of 3-HP under a sugar mixture condition points towards the development of bioprocesses based on renewable resources, such as hemicellulose hydrolysates.
A reference collection of 71 natural isolates of Escherichia coli (the ECOR collection) has been studied with respect to the distribution and abundance of transposable insertion sequences using DNA hybridization. The data include 1173 occurrences of six unrelated insertion sequences (IS1, IS2, IS3, IS4, IS5 and IS30). The number of insertion elements per strain, and the sizes of DNA restriction fragments containing them, is highly variable and can be used to discriminate even among closely related strains. The occurrence and abundance of pairs of unrelated insertion sequences are apparently statistically independent, but significant correlations result from stratifications in the reference collection. However, there is a highly significant positive association among the insertion sequences considered in the aggregate. Nine branching process models, which differ in assumptions regarding the regulation of transposition and the effect of copy number on fitness, have been evaluated with regard to their fit of the observed distributions. No single model fits all copy number distributions. The best models incorporate no regulation of transposition and a moderate to strong decrease in fitness with increasing copy number for IS1 and IS5, strong regulation of transposition and a negligible to weak decrease in fitness with increasing copy number for IS3, and less than strong regulation of transposition for IS2, IS4 and IS30.
PSM2, PSM1, and PSM15 are small plasmids derived from R100 by spontaneous deletions at either end of the insertion sequence IS1. These plasmids were used to identify regions neighboring IS1 as well as the IS1 DNA itself, by cleavage with EcoR1, HindIII, Hae III, Hpa II, Hha I, Hinf, and AIu I. The nucleotide sequencing results demonstrate that IS1 contains 768 bases. About 30 bases at the ends of IS1 were found to be repeated in an inverted order. The deletions occurring at the ends of IS1 were found to be due to illegitimate recombination. The hypothesis that RNA polymerase could play an important role in such recombination phenomena is discussed based on the nucleotide sequences surrounding the recombinational hot spots.
A thermostable DNA polymerase was used in an in vitro DNA amplification procedure, the polymerase chain reaction. The enzyme,
isolated from Thermus aquaticus, greatly simplifies the procedure and, by enabling the amplification reaction to be performed
at higher temperatures, significantly improves the specificity, yield, sensitivity, and length of products that can be amplified.
Single-copy genomic sequences were amplified by a factor of more than 10 million with very high specificity, and DNA segments
up to 2000 base pairs were readily amplified. In addition, the method was used to amplify and detect a target DNA molecule
present only once in a sample of 10(5) cells.
Two new methods were used to establish a rapid and highly sensitive prenatal diagnostic test for sickle cell anemia. The first involves the primer-mediated enzymatic amplification of specific beta-globin target sequences in genomic DNA, resulting in the exponential increase (220,000 times) of target DNA copies. In the second technique, the presence of the beta A and beta S alleles is determined by restriction endonuclease digestion of an end-labeled oligonucleotide probe hybridized in solution to the amplified beta-globin sequences. The beta-globin genotype can be determined in less than 1 day on samples containing significantly less than 1 microgram of genomic DNA.
This chapter discusses specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. A source of DNA including the desired sequence is denatured in the presence of a large molar excess of two oligonucleotides and the four deoxyribonucleoside triphosphates. Oligonucleotides were synthesized using an automated DNA synthesis machine using phosphoramidite chemistry. Mispriming can be usefully employed to make intentional in vitro mutations or to add sequence information to one or both ends of a given sequence. Amplifications of other human loci have resulted in varying degrees of specificity and efficiency. The polymerase chain reaction has thus found immediate use in developmental DNA diagnostic procedures and in molecular cloning from genomic DNA.
A method is described for directly cloning enzymatically amplified segments of genomic DNA into an M13 vector for sequence analysis. A 110-base pair fragment of the human beta-globin gene and a 242-base pair fragment of the human leukocyte antigen DQ alpha locus were amplified by the polymerase chain reaction method, a procedure based on repeated cycles of denaturation, primer annealing, and extension by DNA polymerase I. Oligonucleotide primers with restriction endonuclease sites added to their 5' ends were used to facilitate the cloning of the amplified DNA. The analysis of cloned products allowed the quantitative evaluation of the amplification method's specificity and fidelity. Given the low frequency of sequence errors observed, this approach promises to be a rapid method for obtaining reliable genomic sequences from nanogram amounts of DNA.
The principle of a DNA cloning procedure that directionally generates genomic DNA fragments 50-2000 kilobases away from an initial probe is presented. The method depends on partial digestion of high molecular weight genomic DNA and subsequent ligation at very low concentration to generate covalent DNA circles. A library of the junction fragments from these circles can then be constructed. Biological or physical selection of the junction pieces can be achieved by incorporating a marker DNA fragment into the covalent circles. A 45-kilobase cosmid fragment has been successfully used to test the procedure. At appropriately low ligation concentrations (0.8 micrograms/ml), approximately equal to 90% of the ligated DNA is present as monomeric circles. Larger DNA fragments will require reducing the DNA concentration as the inverse square root of the DNA length. A suppressor tRNA gene has been tested as the selectable marker gene. Ligation of the digested circles into an amber-mutated lambda phage and propagation in a sup- host allows only the phage that contain junction fragments to produce plaques. Potential applications of this approach, such as mapping of complex genetic loci or moving from a linked gene toward a gene of interest, are presented and discussed.
A set of 72 reference strains of Escherichia coli isolated from a variety of hosts and geographical locations has been established for use in studies of variation and genetic structure in natural populations. The strains, which have been characterized by multilocus enzyme electrophoresis, are representative of the range of genotypic variation in the species as a whole.
- C H Von
- G F Beroldingen
- H A Sensabaugh
- Erlich
HIGUCHI, R. G., C. H. VON BEROLDINGEN, G. F. SENSABAUGH and
H. A. ERLICH, 1988 DNA typing from single hairs. Nature
332 543-545.