Cytokeratin 20-negative Merkel cell carcinoma is infrequently associated with the Merkel cell polyomavirus

Abstract

Merkel cell carcinoma is a rare, highly aggressive cutaneous neuroendocrine carcinoma most commonly seen in sun-damaged skin. Histologically, the tumor consists of primitive round cells with fine chromatin and numerous mitoses. Immunohistochemical stains demonstrate expression of neuroendocrine markers. In addition, cytokeratin 20 (CK20) is expressed in ∼95% of cases. In 2008, Merkel cell carcinoma was shown to be associated with a virus now known as Merkel cell polyomavirus in ∼80% of cases. Prognostic and mechanistic differences between Merkel cell polyomavirus-positive and Merkel cell polyomavirus-negative Merkel cell carcinoma may exist. There has been the suggestion that CK20-negative Merkel cell carcinomas less frequently harbor Merkel cell polyomavirus, but a systematic investigation for Merkel cell polyomavirus incidence in CK20-negative Merkel cell carcinoma has not been done. To test the hypothesis that Merkel cell polyomavirus is less frequently associated with CK20-negative Merkel cell carcinoma, we investigated 13 CK20-negative Merkel cell carcinomas from the files of the Cleveland Clinic and the University of Michigan for the virus. The presence or absence of Merkel cell polyomavirus was determined by quantitative PCR performed for Large T and small T antigens, with sequencing of PCR products to confirm the presence of Merkel cell polyomavirus. Ten of these (77%) were negative for Merkel cell polyomavirus and three (23%) were positive for Merkel cell polyomavirus. Merkel cell polyomavirus is less common in CK20-negative Merkel cell carcinoma. Larger series and clinical follow-up may help to determine whether CK20-negative Merkel cell carcinoma is mechanistically and prognostically unique.Modern Pathology advance online publication, 14 November 2014; doi:10.1038/modpathol.2014.148.

Full text

Cytokeratin 20-negative Merkel cell carcinoma
is infrequently associated with the Merkel cell
polyomavirus
Andrew G Miner1,2, Rajiv M Patel3,4, Deborah A Wilson2, Gary W Procop2, Eugen C Minca2,
Douglas R Fullen3,4, Paul W Harms3,4 and Steven D Billings2
1Department of Dermatology, The Cleveland Clinic, Cleveland, OH, USA; 2Department of Pathology,
The Cleveland Clinic, Cleveland, OH, USA; 3Department of Pathology, University of Michigan, Ann Arbor,
MI, USA and 4Department of Dermatology, University of Michigan, Ann Arbor, MI, USA
Merkel cell carcinoma is a rare, highly aggressive cutaneous neuroendocrine carcinoma most commonly seen
in sun-damaged skin. Histologically, the tumor consists of primitive round cells with fine chromatin and
numerous mitoses. Immunohistochemical stains demonstrate expression of neuroendocrine markers. In
addition, cytokeratin 20 (CK20) is expressed in B95% of cases. In 2008, Merkel cell carcinoma was shown to be
associated with a virus now known as Merkel cell polyomavirus in B80% of cases. Prognostic and mechanistic
differences between Merkel cell polyomavirus-positive and Merkel cell polyomavirus-negative Merkel cell
carcinoma may exist. There has been the suggestion that CK20-negative Merkel cell carcinomas less frequently
harbor Merkel cell polyomavirus, but a systematic investigation for Merkel cell polyomavirus incidence in CK20-
negative Merkel cell carcinoma has not been done. To test the hypothesis that Merkel cell polyomavirus is less
frequently associated with CK20-negative Merkel cell carcinoma, we investigated 13 CK20-negative Merkel cell
carcinomas from the files of the Cleveland Clinic and the University of Michigan for the virus. The presence or
absence of Merkel cell polyomavirus was determined by quantitative PCR performed for Large T and small T
antigens, with sequencing of PCR products to confirm the presence of Merkel cell polyomavirus. Ten of these
(77%) were negative for Merkel cell polyomavirus and three (23%) were positive for Merkel cell polyomavirus.
Merkel cell polyomavirus is less common in CK20-negative Merkel cell carcinoma. Larger series and clinical
follow-up may help to determine whether CK20-negative Merkel cell carcinoma is mechanistically and
prognostically unique.
Modern Pathology advance online publication, 14 November 2014; doi:10.1038/modpathol.2014.148
In 1875 Friedrich Merkel described the Tastzellen,
or ‘touch cells,’ that now bear his name.1Nearly 100
years later, in 1972, Cyril Toker described trabecular
carcinoma, named after its characteristic growth
pattern, and favored a sweat gland origin for this
tumor.2Later ultrastructural studies demonstrated
dense core neurosecretory granules within the cells
of ‘trabecular carcinoma,’ and subsequently the
Merkel cell became a favored candidate for this
malignancy’s cell of origin.3Recent evidence
suggests that the cell of origin for Merkel cell
carcinoma may be a Merkel cell precursor stem cell.4
Merkel cell carcinoma is among the most lethal
cutaneous carcinomas, with significant mortality
rate.5Therefore, accurate distinction of Merkel cell
carcinoma from histologically similar tumors is
critical for prompt and appropriate management.
Merkel cell carcinoma may display histologic overlap
with basaloid or small cell cutaneous malignancies
including basal cell carcinoma, adnexal carcinoma,
lymphoma, and small-cell melanoma, although in
most cases morphologic distinction is possible
between Merkel cell carcinoma and these entities.6
However, Merkel cell carcinoma cannot be morpho-
logically distinguished from cutaneous metastases
of small cell carcinoma. Therefore, immuno-
histochemistry is critical for definitive diagnosis.
Characteristically, Merkel cell carcinoma is positive
for cytokeratins and neuroendocrine markers like
synaptophysin, chromogranin, neurofilament, and
neuron-specific enolase.6,7 Cytokeratin 20 has
Correspondence: Dr SD Billings, 9500 Euclid Avenue L25,
Cleveland, OH 44195, USA.
E-mail: billins@ccf.org
Received 8 July 2014; revised 2 September 2014; accepted 3
September 2014; published online 14 November 2014
Modern Pathology (2014), 1– 7
&2014 USCAP, Inc. All rights reserved 0893-3952/14 $32.00 1
www.modernpathology.org

become a standard marker for Merkel cell carcinoma
and is positive in B95% of cases, frequently with a
classic paranuclear dot-like pattern of staining.7–9
Cytokeratin 20 expression is absent in most
other small round cell malignancies including
metastatic small cell lung carcinoma, as well as
less-aggressive cutaneous malignancies such as
basal cell carcinoma.6–8
Lack of cytokeratin 20 expression has been
described in B5% of Merkel cell carcinoma.6,10–12
Diagnosis of cytokeratin 20-negative Merkel cell
carcinoma typically involves immunohistochemical
studies for cytokeratins other than cytokeratin 20
(including AE1/3, Cam5.2, or CK7) and neuro-
endocrine markers. The important differential
diagnosis in this context is metastatic small cell
lung carcinoma. Thyroid transcription factor-1 is a
useful marker for small cell lung carcinoma;
although it may be negative in 10–15% of cases
and has been reported to be expressed in excep-
tional cases of Merkel cell carcinoma.7,8,13,14
Neurofilament protein expression is frequently
observed in Merkel cell carcinoma but not in small
cell lung carcinoma.7,15 Although it has been
speculated that cytokeratin 20 negativity may be
the result of de-differentiation,16 it is unclear
whether the absence of cytokeratin 20 expression
is an isolated finding in Merkel cell carcinoma,
or whether these tumors are characterized by
distinct molecular changes and prognostic differ-
ences relative to cytokeratin 20-positive Merkel cell
carcinoma.
A breakthrough in understanding of the molecular
pathogenesis of Merkel cell carcinoma came in 2008,
when Merkel cell polyomavirus was shown to be
present in a high percentage of Merkel cell carcino-
mas.17 Merkel cell polyomavirus may promote
tumorigenesis via oncogenic actions of viral small
T antigen and large T antigen, which are generated
from a single gene via alternative splicing.5Merkel
cell polyomavirus associated with Merkel cell
carcinoma displays tumor-specific mutations or
deletions in large T antigen which render the virus
replication deficient, a common characteristic of
oncogenic viruses.5,18 Although numerous assays
for Merkel cell polyomavirus detection have been
reported, PCR targeting small T antigen and/or the 5’
region of large T antigen is commonly used and
highly sensitive.19–21
Although present in the majority of Merkel cell
carcinoma, Merkel cell polyomavirus has not been
commonly observed in other malignancies. In
particular, the presence of Merkel cell polyomavirus
is highly specific for Merkel cell carcinoma relative
to small cell lung carcinoma,12,22–24 and hence might
be considered as a diagnostic marker in challenging
cases including cytokeratin 20-negative Merkel
cell carcinoma. However, studies examining the
association between cytokeratin 20 negativity and
the presence of Merkel cell polyomavirus in Merkel
cell carcinoma have been limited to case reports or
incidental findings within larger case series. To our
knowledge, there have been seven total reported
cases in the literature of cytokeratin 20-negative
cutaneous Merkel cell carcinoma assessed for
Merkel cell polyomavirus status; of these, five were
negative for Merkel cell polyomavirus.12,13,25,26 We
hypothesized that Merkel cell polyomavirus is less
frequently associated with cytokeratin 20-negative
Merkel cell carcinomas.
Better understanding of the incidence of Merkel cell
polyomavirus in cytokeratin 20-negative Merkel cell
carcinoma has implications for the diagnostic utility
of Merkel cell polyomavirus in this setting and may
yield clues regarding the molecular pathogenesis of
this subset of Merkel cell carcinomas. Therefore, we
examined the incidence of Merkel cell polyomavirus
by PCR in a cohort of 13 cytokeratin 20-negative
Merkel cell carcinoma tumors.
Materials and methods
Case Selection
All studies were conducted with prior approval by the
Institutional Review Board. The archives of the
Cleveland Clinic and the University of Michigan were
searched for cytokeratin 20-negative Merkel cell
carcinomas. For inclusion in the study, the tumors
had to have typical histologic features of Merkel cell
carcinoma and compatible immunohistochemical
profiles including positivity for cytokeratins coupled
with positivity for at least one neuroendocrine marker.
The medical charts were reviewed, or for cases
received in consultation, contributors or treating
physicians were contacted to establish that the tumors
were clinically consistent with Merkel cell carcinoma
and that there was no evidence of a neuroendocrine
carcinoma for a different site.
Immunohistochemistry
All of the immunohistochemical stains were reviewed.
Most were performed at the time of initial diagnosis
either by the referring institutions or at the Cleveland
Clinic or the University of Michigan. A limited number
of stains were performed at the Cleveland Clinic for the
purposes of this study including cytokeratin 7 (DAKO,
Carpinteria, CA, USA; clone OV-TL 12/30, dilution
1:40), neuron-specific enolase (DAKO; clone BBS/
NC/VI-H14, dilution 1:50), chromogranin A (DAKO;
clone DAK-A3, dilution 1:100), and synaptophysin
(BioGenex, Fremont, CA, USA; clone Snp88, pre-
diluted) using the Ventana BenchMark XT or Bench-
Mark Ultra autostainer (Ventana Medical Systems,
Tucson, AZ, USA).
DNA Extraction and PCR
Five 4 mm tissue sections per specimen were
deparaffinized and DNA was extracted using the
CK20-negative Merkel cell carcinoma
2AG Miner et al
Modern Pathology (2014), 1– 7

commercial microbead system (NucliSENS-easy-
Mag, BioMı
´rieux, Durham, NC, USA), following
the manufacturer’s instructions, as previously
described.23 DNA quantification was performed
and diluted if necessary to achieve DNA concen-
trations between 3 and 50 ng/ml. Qualitative PCR
was performed for Merkel cell polyomavirus using
previously reported primers sets including two (LT1
and MCVPS1) targeting the large T antigen and a
third (LT3) predominantly targeting the small T
antigen unique region (Table 1).19 Quantitative PCR
for b-globin was used as the positive control to
confirm the presence of amplifiable DNA. Negative
controls included purified, distilled water and a
sample of aortic valve tissue from a patient
unaffected by Merkel cell carcinoma.
Quantitative PCR with LT1 and LT3 primer sets
was performed using SybrGreen fluorescence (Life
Technologies, Carlsbad, CA, USA). Threshold cycles
were calculated for all samples. All samples were
subsequently submitted for Sanger sequencing to
confirm the presence of Merkel cell polyomavirus.
MCVPS1 quantitative PCR was performed using a
TaqMansprobe (Life Technologies) for its high
sensitivity and specificity.27 The TaqMansprobe
used was designed to specifically identify
nucleotides 1104–1123 (50-30sequence GGACCCGA-
TATACCTCCCGAAC) within the sequence ampli-
fied by the MCVPS1 primer set. All 14 samples were
evaluated with the MCVPS1 primer set in conjunc-
tion with the MCVPS1 TaqMansprobe.
Studies evaluating the melting temperature of
double-stranded PCR products were consistent with
expected melting temperatures of LT1 and LT3
double primer sets and support the results of PCR
and sequencing.
Results
Thirteen cases of Merkel cell carcinoma, occurring
in 7 men and 6 women ranging in age from 56 to 93
years (mean 72), were identified out of B380 cases
in the combined archives. The tumors arose on the
head and neck (n¼7), upper extremities (n¼3), lower
extremities (n¼2), and in an unspecified location
(n¼1). None of the patients had evidence of a
neuroendocrine carcinoma from another potential
primary. Patients treated at the authors’ institutions
all had appropriate clinical evaluations, including
radiologic staging studies. For all cases seen in
consultation with the exception of one, we were able
to obtain additional clinical information. None of
the consultation cases had evidence of a neuroendo-
crine carcinoma elsewhere. These patients had
detailed clinical and radiologic evaluations. For
the case in which additional information was unable
to be obtained, the patient was a 93-year-old man
with a lesion on the nose (see below).
Histologically, the tumors showed characteristic
features of Merkel cell carcinoma, including trabe-
cular or nodular proliferations of primitive round
cells with high nuclear-to-cytoplasmic ratios, fre-
quent mitoses, and a stippled (‘salt and pepper’)
chromatin pattern. Nuclear molding was present at
least focally in six of the cases (Figure 1). There were
no morphologic findings to suggest basal cell
carcinoma or adnexal carcinoma with aberrant
neuroendocrine marker expression.
All our cases were positive for at least one
cytokeratin (Figure 2; Table 2); however, the
most common pattern was diffuse cytoplasmic or
Table 1 Primers used for MCPyV detection (LT1, LT3, MCVPS1) and control (b-globin)
Primer
NT
location Forward sequence Reverse sequence Probe
Amplicon
size (bp) Reference
LT1 1514–1953 TACAAGCACTCCACCAAAGC TCCAATTACAGCTGGCCTCT N/A 440 19
LT3 571–879 TTGTCTCGCCAGCATTGTAG ATATAGGGGCCTCGTCAACC N/A 308 19
MCVPS1 1071–1179 TCAGCGTCCCAGGCTTCAGA TGGTGGTCTCCTCTCTGCTACTG GGACCCGATAT
ACCTCCCGAAC
109 19
b-Globin ACACAACTGTGTTCACTAGC CAACTTCATCCACGTTCACC N/A 110
Abbreviations: bp, base pair; NT, nucleotide.
Figure 1 Histologic features of the cases. All of the cases of
cytokeratin 20-negative Merkel cell carcinoma had typical
histologic findings of Merkel cell carcinoma. The tumors were
composed of cells with high nuclear-to-cytoplasmic ratios with a
neuroendocrine chromatin pattern. Prominent nuclear molding
was seen in six cases.
Modern Pathology (2014), 1– 7
CK20-negative Merkel cell carcinoma
AG Miner et al 3

membranous and not the usual paranuclear dot-like
pattern. All had immunoreactivity for at least one
neuroendocrine marker (Figure 2; Table 2). Synap-
tophysin was the most commonly positive neuroen-
docrine marker (6/8), while chromogranin was less
sensitive (4/9). None of the cases tested were
positive for thyroid transcription factor-1 (13/13).
Dot-like immunoreactivity for neurofilament protein
was seen in two of three consultation cases.
The one case in which there was no detailed
clinical information had typical histologic features
of Merkel cell carcinoma but also had a squamous
cell carcinoma component that included overlying
squamous cell carcinoma in situ. This case also
exhibited dot-like immunoreactivity for neurofila-
ment protein.
The specimens were analyzed by PCR for
MCVPS1, LT1, LT3, and b-globin. Ten cases (77%)
were negative for Merkel cell polyomavirus. Three
(23%) were positive for Merkel cell polyomavirus
(Figure 3). Of these, two were positive for all three
primer sets tested, including MCVPS1 and LT1
(targeting large T antigen) and LT3 (predominantly
targeting small T antigen). The remaining case was
positive for MCVPS1 and LT3 (Table 3). PCR
products for LT1 and LT3 were further analyzed by
Sanger sequencing, which demonstrated 498%
similarity to the Merkel cell polyomavirus genome
(NC_010277.1) for all PCR amplicons (Figure 4).
Case 4 displayed a C1923T mutation resulting in a
premature stop codon in large T antigen, consistent
with a tumor-specific truncating mutation.
Discussion
Merkel cell carcinoma is a primary cutaneous
neuroendocrine carcinoma that typically occurs in
older, fair-skinned patients. Merkel cell carcinoma is
aggressive with metastatic rates of 36–55% and
overall 5-year mortality between 31 and 64%.28–30
The diagnosis of Merkel cell carcinoma is confirmed
Figure 2 Summary of immunohistochemical stains. All specimens were negative for cytokeratin 20 (a); cytokeratin 7 was positive in a
cytoplasmic, membranous pattern in two of our samples (b); all cases were positive for neuroendocrine markers such as neuron-specific
enolase (c); other keratin immunohistochemical stains such as Cam5.2 usually had a diffuse cytoplasmic or membranous staining similar
to stains for cytokeratin 7 rather than a perinuclear dot-like pattern (d).
Modern Pathology (2014), 1– 7
CK20-negative Merkel cell carcinoma
4AG Miner et al

with immunohistochemical stains for distinction
from other small cell malignancies, including meta-
static small cell lung carcinoma.6–8 Particularly
useful is cytokeratin 20, which is positive in
B95% of Merkel cell carcinomas but negative in
most small cell lung carcinomas.6–8
Increased insight into the pathogenesis of Merkel
cell carcinoma was gained in 2008 with the
discovery that Merkel cell polyomavirus was geno-
mically integrated in a significant subset of Merkel
cell carcinoma.17 Merkel cell polyomavirus appears
to be a common constituent of normal microfauna
on the skin of healthy individuals.5,31 However,
evidence suggests that Merkel cell polyomavirus
detected in Merkel cell carcinoma has an oncogenic
role, rather than incidental detection of background
infection by wild-type virus. Merkel cell polyo-
mavirus in Merkel cell carcinoma displays clonal
integration, high viral copy number, and tumor-
specific mutations of large T antigen resulting in
incapacity to replicate.5,17,18,32 Furthermore, in vitro
studies support a role for Merkel cell polyomavirus
T antigens, especially small T antigen, in trans-
formation and cell survival.5
Most studies have reported that a significant
minority of Merkel cell carcinoma lack detectable
Merkel cell polyomavirus,5raising the question of
how Merkel cell polyomavirus-negative tumors
might differ from Merkel cell polyomavirus-posi-
tive tumors. Reports have been mixed regarding
immunohistochemical and clinical differences
between Merkel cell polyomavirus-positive and
Merkel cell polyomavirus-negative tumors.31
Merkel cell carcinoma with squamous elements or
coexisting squamous cell carcinoma is often Merkel
cell polyomavirus negative.12,23,25,33–36 Recent
findings indicate that Merkel cell polyomavirus-
negative tumors may be associated with RB1
inactivating mutations37 and (in a subset) PIK3CA
activating mutations.38 Hence, although additional
study is needed to clarify differences between
Merkel cell polyomavirus-positive and Merkel cell
polyomavirus-negative tumors, current data suggest
that molecular differences exist that may have
implications for immune-based or targeted therapy.
It is unclear what role Merkel cell polyomavirus
plays in the rare subset of Merkel cell carcinoma that
are cytokeratin 20 negative. We undertook a study to
examine series of cytokeratin 20-negative Merkel
cell carcinoma to further explore the prevalence of
Figure 3 PCR melting curve analysis for Merkel cell polyomavirus. PCR melting curve for Merkel cell polyomavirus LT3: 1—
Amplification of the Merkel cell polyomavirus cell line in the positive control cell line. 2, 3, and 4 demonstrate the amplification of the
MCV in patients 4, 10, and 13, respectively. All of the other specimens were negative for Merkel cell polyomavirus.
Table 3 MCPyV positivity as detected by LT1 and LT3 (PCR,
sequencing) and MCVPS1 (Taqmansprobe-based PCR)
Case MCVPS1 LT1 LT3
1
2
3
4þþþ
5
6
7
8
9
10 þþþ
11 
12 
13 þþ
MKL-1 þþþ
Table 2. Summary of immunohistochemical stains
Stain Positive/Total
Cytokeratins
Cytokeratin 20 0/13
Cytokeratin-7 2/12
AE1/AE3 11/11
Cam 5.2 2/4
Any cytokeratin 13/13
Neuroendocrine markers
NSE 2/3
Synaptophysin 7/9
Chromogranin 4/10
CD56 3/4
Neurofilament 2/3
Any neuroendocrine marker 13/13
Other
TTF-1 0/12
Abbreviations: CK20, cytokeratin 20; CK7, cytokeratin 7; NSE,
neuron-specific enolase; TTF-1, thyroid transcription factor 1.
Modern Pathology (2014), 1– 7
CK20-negative Merkel cell carcinoma
AG Miner et al 5

Merkel cell polyomavirus in this subset of Merkel
cell carcinoma. Our PCR results suggest that Merkel
cell polyomavirus is uncommon in cytokeratin 20-
negative Merkel cell carcinoma, as 10/13 (77%) were
negative for the virus. This finding agrees with the
few previous reports of cytokeratin 20-negative
Merkel cell carcinoma evaluated for Merkel cell
polyomavirus, the majority of which were Merkel
cell polyomavirus negative.12,13,25,26
These results have diagnostic implications. Lack
of cytokeratin 20 expression may make definitive
diagnosis of Merkel cell carcinoma challenging, and
additional markers may be desirable in this context.
Detection of Merkel cell polyomavirus either by
immunohistochemistry or by molecular means has
been proposed as a diagnostic test for Merkel cell
carcinoma, which may aid in distinction from
other carcinomas, including metastatic small cell
carcinoma.12,22–24 Our results suggest that Merkel
cell polyomavirus detection is insufficiently
sensitive to be useful in the diagnosis of cyto-
keratin 20-negative Merkel cell carcinoma. Other
markers such as thyroid transcription factor-1
and neurofilament may be more useful in this
context.7,15,26
In summary, our data suggest that cytokeratin 20-
negative Merkel cell carcinoma is more likely to lack
detectable Merkel cell polyomavirus. Further inves-
tigations will address whether Merkel cell poly-
omavirus-negative/cytokeratin 20-negative Merkel
cell carcinoma displays genetic changes similar to
other Merkel cell polyomavirus-negative Merkel cell
carcinoma such as RB1 mutations, or whether these
tumors possess a unique spectrum of mutations and
hence represent a distinct molecular subclass of
Merkel cell carcinoma.
Conclusions
We have shown through three primer sets that
cytokeratin 20-negative Merkel cell carcinoma is
associated with a low incidence of Merkel cell
polyomavirus positivity. Further study of cytoker-
atin 20-negative, Merkel cell polyomavirus-negative
Merkel cell carcinoma may prove helpful in eluci-
dating genetic changes and prognosis of this subset
of Merkel cell carcinoma.
Disclosure/conflict of interest
The authors declare no conflict of interest.
References
1 Merkel F. Tastzellen and Tastkoerperchen bei den
Hausthieren und beim Menschen. Arch Mikrosc Anat
1875;11:636–652.
2 Toker C. Trabecular carcinoma of the skin. Arch
Dermatol 1972;105:107–110.
3 Tang CK, Toker C. Trabecular carcinoma of the skin: an
ultrastructural study. Cancer 1978;42:2311–2321.
4 Tilling T, Moll I. Which are the cells of origin in Merkel
cell carcinoma? J Skin Cancer 2012;2012:680410.
5 Spurgeon ME, Lambert PF. Merkel cell polyomavirus: a
newly discovered human virus with oncogenic poten-
tial. Virology 2013;435:118–130.
6 Pulitzer MP, Amin BD, Busam KJ. Merkel cell carcino-
ma: review. Adv Anat Pathol 2009;16:135–144.
7 Bobos M, Hytiroglou P, Kostopoulos I, et al. Immuno-
histochemical distinction between Merkel cell carci-
noma and small cell carcinoma of the lung. Am J
Dermatopathol 2006;28:99–104.
8 Hanly AJ, Elgart GW, Jorda M, et al. Analysis of thyroid
transcription factor-1 and cytokeratin 20 separates
Merkel cell carcinoma from small cell carcinoma of
lung. J Cutan Pathol 2000;27:118–120.
9 Moll R, Lowe A, Laufer J, et al. Cytokeratin 20 in
human carcinomas. A new histodiagnostic marker
detected by monoclonal antibodies. Am J Pathol
1992;140:427–447.
10 Calder KB, Coplowitz S, Schlauder S, et al. A case
series and immunophenotypic analysis of CK20-/
CK7 þprimary neuroendocrine carcinoma of the skin.
J Cutan Pathol 2007;34:918–923.
11 Beer TW. Merkel cell carcinomas with CK20 negative
and CK7 positive immunostaining. J Cutan Pathol
2009;36:385–386; author reply 387.
12 Busam KJ, Jungbluth AA, Rekthman N, et al. Merkel
cell polyomavirus expression in Merkel cell carcino-
mas and its absence in combined tumors and pulmon-
ary neuroendocrine carcinomas. Am J Surg Pathol
2009;33:1378–1385.
13 Koba S, Inoue T, Okawa T, et al. Merkel cell carcinoma
with cytokeratin 20-negative and thyroid transcription
factor-1-positive immunostaining admixed with squa-
mous cell carcinoma. J Dermatol Sci 2011;64:77–79.
14 Reddi DM, Puri PK. Expression of focal TTF-1
expression in a case of CK7/CK20-positive Merkel cell
carcinoma. J Cutan Pathol 2013;40:431–433.
Figure 4 Example of Sanger sequencing for a Merkel cell polyomavirus-positive case. For the Merkel cell polyomavirus-positive cases,
Sanger sequencing demonstrated 498% similarity to the Merkel cell polyomavirus genome (NC_010277.1) for all PCR amplicons.
Modern Pathology (2014), 1– 7
CK20-negative Merkel cell carcinoma
6AG Miner et al

15 McCalmont TH. Paranuclear dots of neurofilament
reliably identify Merkel cell carcinoma. J Cutan Pathol
2010;37:821–823.
16 Pilloni L, Manieli C, Senes G, et al. Merkel cell
carcinoma with an unusual immunohistochemical
profile. Eur J Histochem 2009;53:275–278.
17 Feng H, Shuda M, Chang Y, et al. Clonal integration of
a polyomavirus in human Merkel cell carcinoma.
Science 2008;319:1096–1100.
18 Shuda M, Feng H, Kwun HJ, et al. T antigen mutations
are a human tumor-specific signature for Merkel cell
polyomavirus. Proc Natl Acad Sci USA 2008;105:
16272–16277.
19 Duncavage EJ, Zehnbauer BA, Pfeifer JD. Prevalence of
Merkel cell polyomavirus in Merkel cell carcinoma.
Mod Pathol 2009;22:516–521.
20 Rodig SJ, Cheng J, Wardzala J, et al. Improved
detection suggests all Merkel cell carcinomas harbor
Merkel polyomavirus. J Clin Invest 2012;122:
4645–4653.
21 Shuda M, Kwun HJ, Feng H, et al. Human Merkel cell
polyomavirus small T antigen is an oncoprotein
targeting the 4E-BP1 translation regulator. J Clin Invest
2011;121:3623–3634.
22 Jung HS, Choi YL, Choi JS, et al. Detection of Merkel
cell polyomavirus in Merkel cell carcinomas and small
cell carcinomas by PCR and immunohistochemistry.
Histol Histopathol 2011;26:1231–1241.
23 Ly TY, Walsh NM, Pasternak S. The spectrum of
Merkel cell polyomavirus expression in Merkel cell
carcinoma, in a variety of cutaneous neoplasms, and in
neuroendocrine carcinomas from different anatomical
sites. Hum Pathol 2012;43:557–566.
24 Paik JY, Hall G, Clarkson A, et al. Immunohistochem-
istry for Merkel cell polyomavirus is highly specific
but not sensitive for the diagnosis of Merkel cell
carcinoma in the Australian population. Hum Pathol
2011;42:1385–1390.
25 Ishida M, Okabe H. Merkel cell carcinoma con-
current with Bowen’s disease: two cases, one with an
unusual immunophenotype. J Cutan Pathol 2013;40:
839–843.
26 Andres C, Belloni B, Jaeger T, et al. Immunohisto-
chemical features of Merkel cell carcinoma in correla-
tion with presence of Merkel cell polyomavirus DNA.
Acta Derm Venereol 2011;91:722–723.
27 Satterfield BC, Bartosiewicz M, West JA, et al. Sur-
passing specificity limits of nucleic acid probes via
cooperativity. J Mol Diagn 2010;12:359–367.
28 Erovic I, Erovic BM. Merkel cell carcinoma: the past,
the present, and the future. J Skin Cancer 2013;2013:
929364.
29 Hughes MP, Hardee ME, Cornelius LA, et al. Merkel
cell carcinoma: epidemiology, target, and therapy. Curr
Dermatol Rep 2014;3:46–53.
30 Medina-Franco H, Urist MM, Fiveash J, et al. Multi-
modality treatment of Merkel cell carcinoma: case
series and literature review of 1024 cases. Ann Surg
Oncol 2001;8:204–208.
31 Coursaget P, Samimi M, Nicol JT, et al. Human Merkel
cell polyomavirus: virological background and clinical
implications. APMIS 2013;121:755–769.
32 Laude HC, Jonchere B, Maubec E, et al. Distinct Merkel
cell polyomavirus molecular features in tumour and
non tumour specimens from patients with Merkel cell
carcinoma. PLoS Pathog 2010;6:e1001076.
33 Iwasaki T, Matsushita M, Kuwamoto S, et al. Useful-
ness of significant morphologic characteristics in
distinguishing between Merkel cell polyomavirus-
positive and Merkel cell polyomavirus-negative Mer-
kel cell carcinomas. Hum Pathol 2013;44:1912–1917.
34 Martin B, Poblet E, Rios JJ, et al. Merkel cell carcinoma
with divergent differentiation: histopathological and
immunohistochemical study of 15 cases with PCR
analysis for Merkel cell polyomavirus. Histopathology
2013;62:711–722.
35 Mitteldorf C, Mertz KD, Fernandez-Figueras MT, et al.
Detection of Merkel cell polyomavirus and human
papillomaviruses in Merkel cell carcinoma combined
with squamous cell carcinoma in immunocompetent
European patients. Am J Dermatopathol 2012;34:
506–510.
36 Kuwamoto S, Higaki H, Kanai K, et al. Association of
Merkel cell polyomavirus infection with morphologic
differences in Merkel cell carcinoma. Hum Pathol
2011;42:632–640.
37 Cimino PJ, Robirds DH, Tripp SR, et al. Retinoblastoma
gene mutations detected by whole exome sequencing of
Merkel cell carcinoma. Mod Pathol 2014;27:1073–1087.
38 Nardi V, Song Y, Santamaria-Barria JA, et al. Activation
of PI3K signaling in Merkel cell carcinoma. Clin
Cancer Res 2012;18:1227–1236.
Modern Pathology (2014), 1– 7
CK20-negative Merkel cell carcinoma
AG Miner et al 7