Content uploaded by Guangfeng Zhao
Author content
All content in this area was uploaded by Guangfeng Zhao on Nov 23, 2018
Content may be subject to copyright.
Extremely Low Frequency Magnetic Fields
Inhibit Adipogenesis of Human Mesenchymal
Stem Cells
Leilei Du,
1
Hongye Fan,
1
Huishuang Miao,
1
Guangfeng Zhao,
2
and Yayi Hou
1
*
1
The State Key Laboratory of Pharmaceutical Biotechnology, Division of Immunology,
Medical Scho ol, Nanjing Universi ty, Nanjing, P.R. China
2
Department of Obstetrics and Gynecology, NanjingDrumTower Hospital,
NanjingUniversity Medical School, Nanjing, P.R. China
It was reported that obese (Ob/Ob) mice lose their weight and fat when treated with 0.5 T direct
current electromagnetic fields. We also observed that 7.5 Hz, 0.4 T rotation of extremely low
frequency magnetic fields (ELF-MF) has an inhibitory effect on obesity. Mesenchymal stem cells
(MSCs) are multi-potent cells capable of differentiating to different MSC lineages, including
adipose. We hypothesized that inhibitory effects of ELF-MF on obesity may be related to the
differentiation of MSCs to adipocytes. In the present study, we investigated the effects of 7.5 Hz,
0.4 T ELF-MF on differentiation of human umbilical cord MSCs. We found that ELF-MF inhibited
adipogenic differentiation (exposed 2 h/day for 15 days) of MSCs but had no effect on osteogenic
differentiation (exposed 2 h/day for 21 days). Moreover, ELF-MF inhibited adipocyte-specific
expression of peroxisome proliferator-activated receptor 2 (PPARg2). ELF-MF promoted c-Jun N-
terminal kinase (JNK)-dependent intracellular signaling in MSCs. Furthermore, activation of the
non-canonical Wnt pathway provoked the inhibition of PPARg2 expression resulting in suppression
of adipogenic differentiation. In addition, the effects of ELF-MF on growth and apoptosis of MSCs
were not observed. Our data indicated that ELF-MF of 7.5 Hz, 0.4 T inhibited the adipogenic
differentiation of MSCs via JNK-dependent Wnt signaling pathway, but had no effect on the growth
and function of MSCs, suggesting the inhibitory effect of ELF-MF on obesity may be attributed to
the inhibition of differentiation of MSCs into adipocytes. This study may provide a potential
approach for the treatment of obesity. Bioelectromagnetics. © 2014 Wiley Periodicals, Inc.
Key words: ELF-MF; adipogenic differentiation; MSCs; obesity; PPARg2
INTRODUCTION
Obesity is a major health concern worldwide
[Friedman, 2004] and is associated with the develop-
ment of a number of pathological disorders including
certain cancers, heart disease, stroke, and diabetes
[Cornier et al., 2008; Attie and Scherer, 2009; Pi-
Sunyer, 2009; Nichols, 2012]. Mesenchymal stem
cells (MSCs) are multi-potent cells capable of differen-
tiating in vitro and in vivo to different MSC lineages,
including adipose, bone and cartilage [Haynesworth
et al., 1992; Pittenger et al., 1999]. Recent studies
suggested that the inverse relationship between bone
and fat mass might be caused by enhanced differentia-
tion of MSC into either the osteoblastic or adipocytic
lineages [Takeda et al., 2003; Gimble et al., 2006].
Therefore, it is important to maintain the balance of
osteogenic differentiation and adipogenic differentia-
tion of MSCs to prevent obesity.
Electromagnetic fields have been studied with
great interest due to the possible effects they have on
human health. Pulsed electromagnetic fields (PEMF)
enhance osteogenic effects of bone morphogenetic
Grant sponsor: National Natural Science Foundation of China;
grant number: 31370899; grant sponsor: Ministry of Science and
Technology “Twelfth Five-Year”National Scientific and Techno-
logical Support for Major Projects (China); grant number:
2012BA/15B03.
*Correspondence to: Yayi Hou, Medical School, Nanjing Universi-
ty, Hankou Road 22, Nanjing 210093, P.R. China.
E-mail: yayihou@nju.edu.cn
Received for review 1 January 2014; Accepted 14 July 2014
DOI: 10.1002/bem.21873
Published online XX Month Year in Wiley Online Library
(wileyonlinelibrary.com).
Bioelectromagnetics
2014 Wiley Periodicals, Inc.
protein 2 (BMP-2) on MSCs cultured on calcium
phosphate substrates, suggesting that PEMF will
improve MSC response to BMP-2 in vivo in bones
[Schwartz et al., 2008]. It was reported that 15 Hz,
1 mT magnetic fields can directly regulate the rat bone
marrow MSCs, promoting their differentiation to
osteoblasts and inhibiting differentiation to adipocytes
[Yang et al., 2010]. A recent study found that
alternating electric current promoted the differentiation
of adult human MSCs toward the osteogenic pathway
[Creecy et al., 2013], and the high-frequency (200 Hz)
vibratory stimulation, when combined with a synthetic
fibrous scaffold, served as a potent modulator of MSC
functions [Tong et al., 2013].
Moreover, frequencies below 300 Hz are known
as extremely low frequency magnetic fields (ELF-
MF). Interestingly, ELF-MFs do not have enough
energy to break molecular bonds, for example, they
cause no direct damage to DNA. ELF-MF is also non-
invasive and non-ionizing and may have non-thermal
effects on cells and tissues. These properties have led
to studies of ELF-MF influence on the development of
various diseases. It has been found that ELF-MF might
be a way to stimulate and maintain chondrogenesis of
MSCs and provide a new step in regenerative medi-
cine regarding tissue [Mayer-Wagner et al., 2011]. We
previously found that ELF-MF of 7.5 Hz, 0.4 T can
inhibit tumor cell proliferation and disrupt the cell
cycle [Wang et al., 2011]. It was reported that when
obese (Ob/Ob) mice were treated with 0.5 T direct
current electromagnetic fields, the mice increased their
activity, lost weight and fat in a 6-day period
[Nichols, 2012]; electromagnetic fields also reduced
human abdominal obesity [Beilin et al., 2012]. We
hypothesized that inhibitory effect of ELF-MF on
obesity may be related to the differentiation of MSCs
to adipocytes.
Adipogenesis consists of two related steps: the
determination of MSCs into preadipocytes and the
differentiation of preadipocytes into mature fat cells
[Bowers and Lane, 2007]. Because the number of
preadipocytes and mature fat cells has been shown to
be different between lean and obese human adult
subjects [Tchoukalova et al., 2007], variations in the
determination process in early stages of adipose tissue
development might be important in the pathogenesis
of obesity. However, the regulation of adipogenesis
(adipocyte differentiation) is complex and this process
includes alteration of the sensitivity to hormones and
the expression of a number of genes in response to
various stimuli including lipid mediators.
Interestingly, several transcriptional factors and
intracellular signaling pathways have been demonstrated
to control the differentiation of MSCs into osteoblastic
or adipocyte cells, for example, peroxisome proliferator-
activated receptor (PPAR) g2 [Akune et al., 2004] and
canonical Wnt-b-catenin and non-canonical Wnt signal-
ing pathways [Taipaleenmaki et al., 2011]. PPARgis a
ligand-activated transcription factor [Mangelsdorf
and Evans, 1995; Kersten et al., 2000; Rosen and
Spiegelman, 2001]. It is believed that PPAR gand
CCAAT/enhancer-binding proteins (C/EBPs) are the
most important factors involved in the activation of
adipogenesis, and they induce the expression of a
number of adipogenic genes that participate in the
control of adipogenesis [Lefterova and Lazar, 2009;
Rosen et al., 2009]. PPARg2 overexpression in fibro-
blast cell lines can initiate adipogenesis [Tontonoz et al.,
1994] and PPARgdefect in ES cells and embryonic
fibroblastic cells from mice were unable to differentiate
into adipocytes [Barak et al., 1999; Kubota et al., 1999;
Rosen et al., 1999]. Canonical Wnt/b-catenin signaling
is a key regulator of bone formation and MSC differenti-
ation to either the osteogenic or chondrogenic lineage
[Church et al., 2002; Day et al., 2005; Hill et al., 2005;
Holmen et al., 2005]. In addition, non-canonical Wnt
signaling is also a regulator of cell differentiation [He
et al., 2008].
Therefore, in the present study, we attempted to
explore the effect of 7.5 Hz, 0.4 T rotation of ELF-MF
on the differentiation of human umbilical cord MSCs
(UC-MSCs) to adipocytes. Furthermore, we tried to
investigate whether ELF-MF affects the differentiation
of MSCs through regulating the expression of PPAR g
2 and Wnt signaling pathways.
MATERIALS AND METHODS
Culture of Human Umbilical Cords
MSCs ( UC -MSC)
Human umbilical cords were obtained from full-
term caesarian section births in a sterile manner at the
time of delivery at the Department of Gynecology and
Obstetrics, the Affiliated Drum Tower Hospital of
Nanjing University Medical School (Nanjing, China).
The hospital ethics committee approved the consent
forms and the protocol for evaluation of the tissue.
Umbilical arteries and veins were removed, and the
remaining tissue was transferred to a sterile container
in DMEM/F12 (Gibco, Carlsbad, CA) with antibiotics
(penicillin 100 mg/ml, streptomycin 10 mg/ml; Life
Sciences, Carlsbad, CA) and was diced into 1–2mm
3
fragments. The tissue was incubated in an enzyme
cocktail (hyaluronidase 5 U/ml, collagenase 125 U/ml,
and dispase 50 U/ml; Sigma, St. Louis, MO) for 45–
60 min with gentle agitation at 37 8C. The cells were
pelleted by low-speed centrifugation (250gfor 5 min),
2Duetal.
Bioelectromagnetics
suspended in fresh medium, and transferred to cell
culture flasks containing DMEM/F12 supplemented
with 20% fetal bovine serum (Gibco).
Cells were incubated with 5% CO
2
at saturating
humidity. When cells reached 70–80% confluence or
when numerous colonies were observed, the cells were
detached with 0.25% trypsin-EDTA (Sigma); the trypsin
was inactivated with fresh media. The culture medium
was replaced every 3 or 4 days. After the 2nd to 4th cell
passages, the adherent cells were symmetric, with
phenotypic surface antigens CD105
þ
,CD73
þ
,CD90
þ
,
HLA-ABC
þ
,CD29
þ
,CD44
þ
, CD106
,HLA-DR
,
CD19
,CD11b
,CD14
,CD34
,CD31
. The cells
of the 3rd passage were used in the experiments.
Flow Cytometry
The specific surface antigens of UC-MSCs in the
cultures, after passages 2–4, were characterized by
flow cytometry analysis. The following murine
monoclonal antibodies, purified or directly conjugated
with fluorescein isothiocyanate (FITC), phycoerythrin
(PE or R-PE), allophycocyanin (APC) were used in
fluorescence-activated cell sorting (FACS) analysis:
anti-CD105, anti-CD73, anti-CD90, anti-HLA-ABC,
anti-CD29, anti-CD44, anti-CD106, anti-HLA-DR, anti-
CD19, anti-CD11b, anti-CD14, anti-CD34, anti-CD31,
anti-CD45, and IgG/IgM isotype controls (all from BD
Biosciences, San Jose, CA). For fluorescence measure-
ments only, data from 10000 single cell events were
collected using a standard FACScalibur flow cytometer
(Becton Dickinson, San Jose, CA). Data were analyzed
using CELLQuest (Becton Dickinson) or FlowJo soft-
ware (Treestar, San Carlos, CA).
Experimental Magnetic Field
The construction of experimental magnetic
fields has been described previously [Wang
et al., 2011; Nie et al., 2013]. Two pairs of fan-
shaped NdFeB permanent magnets (N45; Innuovo,
Dongyang, China; Fig. 1A) were attached to a
circular iron plate and arranged to produce ELF-MF
(Fig. 1B). The black arrow indicated site is the place
where MSCs were exposed. The bottom two magnets
rotated at certain frequency driven by a step motor,
which was controlled using a functional signal
generator. The top two magnets rotated synchronous-
ly due to the strong magnetic interaction. Magnetic
flux density was measured at the target site using a
gauss meter (HT201; Hengtong, Shanghai, China).
ELF-MF at the target site is a series of alternate
pulses with a maximum flux density of 0.4 T (6%
variation). The frequency of ELF-MF could be
varied from 0 to 7.5 Hz, but all experiments were
conducted at 7.5 Hz. This instrument was fabricated
by the National Laboratory of Solid Micro-struc-
tures, Nanjing University (Nanjing, China). Control
cells were placed in a similar apparatus except that
there were two rotating iron plates instead of
magnets, thus lacking an ELF-MF. The entire
magnetic apparatus was located in a hood with
controlled humidity and temperature.
MSCs Osteogenesis and Adipogenesis
Differentiation
For differentiation experiments, the methods
were used as Bilkovski et al. [2010] described. MSCs
were transferred to six-well plates. Two days post-
confluence, adipogenesis was induced by adding
adipogenesis medium (Dulbecco’s modified Eagle’s
medium, 10% FBS, 1% penicillin/streptomycin, 1 mM
dexamethasone, 5 mg/ml insulin, 0.5 mM isobutylme-
thylxanthine, and 50 mM indomethacin). Osteogenesis
was induced at 80% confluency by adding osteogenesis
medium (Dulbecco’s modified Eagle’s medium,
10%FBS, 1% penicillin/streptomycin, 100 nM dexa-
methasone, 10 mM ascorbic acid, and 10 mM
b-glycero-phosphate). Before performing the experi-
ments, the two primary cell populations were cultured
for at least 3 weeks under standard conditions.
Alizarin Red S Stain Analysis
After 21 days of differentiating condition, media
was removed from the six-well plate and rinsed once
with PBS. Cells were fixed with 4% formaldehyde
solution for 30 min. After fixation, wells were rinsed
twice with distilled water and cells were stained with
2% Alizarin Red S solution (pH 4.2; Sigma) for 2–
3 min. Wells were rinsed three times with distilled
water, visualized under a light microscope and images
were captured for analysis.
Oil Red O Stain Analysis
After 21 days of differentiating condition, media
from six-well plate was removed and rinsed once with
PBS. Cells were fixed with 4% formaldehyde solution
for 30 min. After fixation, wells were rinsed twice with
distilled water and 1 ml of 60% isopropanol was added
for 30 min. Cells were then stained with Oil Red O
solution for 30 min. Wells were rinsed three times with
distilled water, visualized under a light microscope
and images were captured for analysis.
Reverse Transcription and Real-Time
PolymeraseChainReaction(PCR)
Total RNA was extracted from the cultured cells
using Trizol reagent (Invitrogen, Carlsbad, CA)
according to the manufacturer’s instructions. For
quantitative RT-PCR analysis of genes FABP4,
ELF-MF Inhibits Adipogenesis of Human MSCs 3
Bioelectromagnetics
PPARg2, LPL, ALP, Runnx2, OCN, Col1a1 and
GAPDH, 1 mg of total RNA was reverse transcribed to
cDNA with oligdT and Thermoscript (TaKaRa, Dalian,
China). Real-time PCR for these genes was performed
on a tepOne Sequence Detection System (Applied
Biosystems, Foster City, CA) using SYBR green dye
(Invitrogen). A 10 ml PCR reaction was used and
included 1 ml RT product, 5 ml2QuantiTect SYBR
green PCR Master Mix, and 0.5 ml forward and
reverse primers. The forward and reverse PCR oligo-
nucleotide primers were designed with the Primer
premier 5.0 software (Premier Biosoft, Palo Alto, CA),
and the primer sequences were blasted to exclude the
nonspecific sequences. The primer sequences are
shown in Table 1. The reactions were incubated in a
96-well plate at 95 8C for 10 min, followed by 40
cycles of 95 8C for 15 s, 60 8C for 30 s and 72 8C for
30 s. The housekeeping gene GAPDH was used as
endogenous control for RNA normalization. All
experiments were done in triplicate. The level of
expression was calculated based on the PCR cycle
number (C
t
) and the relative gene expression level was
determined using the DDC
t
method.
Western Blot Analysis
Whole-cell lysates for Western blotting were
extracted with lysis buffer containing 50 mM Tris
(pH 8), HEPES (pH 7.5), 150 mM NaCl, 1.5 mM
MgCl
2
, 1 mM EDTA, 0.1% Triton X-100, 0.25%
sodium deoxycholate and protease inhibitor (Roche,
Basel, Switzerland). Protein samples were resolved
by 10% SDS/PAGE, and gels were transferred to
polyvinylidene difluoride membranes (Roche). Mem-
branes were blocked using 5% bovine serum albumin
Fig. 1. Magnetic field exp osure system. A: The magnetic field exposure system instrument was
fabricated by the National Laboratory of Solid Micro-structures, Nanjing University (Nanjing,
China). Internal schematic diagram of the instrument.The black arrow indicated site where MSCs
were exposed. B: Two pairs of fan-shaped NdFeB permanent magnets were arranged to estab-
lish magnetic fields.ELF- MF at the target site is alternative pulses with a maximum flux density of
about 0.4 T.
4Duetal.
Bioelectromagnetics
(BSA) for 1–2h,at258C and subsequently incubated
overnight at 4 8C with diluted primary monoclonal
antibodies against PPARg2 (1:1000 dilution; Santa
Cruz, Dallas, TX), JNK (1:1000 dilution), p-JNK
(1:1000 dilution), b-catenin (1:1000 dilution; Santa
Cruz), P-CamKII (1:1000 dilution), CamKII (1:1000
dilution), and GAPDH (1:1000 dilution; Cell Signal-
ing Technology, Boston, MA). Signals were detected
TABLE 1. Primers Used for Real-Time Quantitative PCR Analysis
SANGER_NAME Forward primer (50–30) Reverse primer (50–30)
HUMAN-PPARg2 CTCCTATTGACCCAGAAAGCG CAAAGTTGGTGGGCCAGAAT
HUMAN-FABP4 GGAGTGGGCTTTGCCACCAGG GCACATGTACCAGGACACCCCC
HUMAN-LPL GTGGACTGGCTGTCACGGGC GCCAGCAGCATGGGCTCCAA
HUMAN-Runx2 GATGTCCGTAAGGTCTTGCCA TGCAGTCTCCATCACGAAATG
HUMAN-Col1a1 CTTGGTCTCGTCACAGATCA TGTTCAGCTTTGTGGACCTC
HUMAN-OCN CGGTGCAGAGTCCAGCAAAG TACAGGTAGCGCCTGGGTCTCT
HUMAN-ALP TACCCAGATGACTACAGCCAA TCGGTGGATCTCGTATTTCATGT
HUMAN-GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC
Fig. 2. Isolation and characterization of UC-MSCs derived from human umbilical cord tissue. A:
Morphology of MSCs isolate after 4, 6, and 8 days. B: Flow cy tometry characterization of human
MSC passage 3. Phenotypic surface antigens of MSCs (CD105, CD73, CD90, HLA-ABC, CD29,
CD44, HLA-DR, CD19,CD11b,CD14,CD34, CD45, CD106, and CD31) were detected using FACS.
ELF-MF Inhibits Adipogenesis of Human MSCs 5
Bioelectromagnetics
using the appropriate HRP-conjugated secondary
antibody (Cell Signaling Technology). The blots
were visualized using an enhanced Immobilon West-
ern chemiluminescent HRP substrate (Millipore,
Billerica, MA), according to the manufacturer’s
instructions, and the relative intensity of the specific
bands was quantified using the FluorChem FC2
system (Alpha Innotech, San Jose, CA).
Immunofluorescence
The effects of ELF-MF on expression of PPARg2
and cytoskeleton of MSCs could be detected by
immunofluorescence. Briefly, exponentially growing
cells were seeded onto a six-well plate (Costar,
Carlsbad, CA; 1 10
5
cells/well). The cells were
adherent overnight. Media was removed from six-well
plates and rinsed once with PBS. Cells were fixed with
4% formaldehyde solution for 30 min. After fixation,
wells were rinsed twice with PBS and 0.1% Triton-100
was added for 15 min; wells were then rinsed twice
with PBS and 3% BSA was added for 1 h; wells were
rinsed twice with PBST, after adding PPARg2Ab
(Santa Cruz) (1:2000) for PPARg2 protein detect or
mouse monoclonal vinculin Ab (Santa Cruz) (1:2000)
for cytoskeleton, 4 8C overnight. Wells were rinsed
fourth with PBST, adding again Alexa Fluor 594
donkey anti-mouse IgG (Abcam, Cambridge, England;
1:1000) was added for PPARg2 protein detect or Alexa
Fluor 594 donkey anti-mouse IgG (Abcam; 1:1000)
and Phalloidin-FITC (Santa Cruz; 1:1000) for 2 h.
Wells were rinsed four times with PBST, DAPI was
added for 10 min. Using a laser scanning confocal
microscope (Olympus FluoView FV10i, Osaka, Japan)
cells were observed and a photograph was taken.
Cell Proliferation, Cell Cycle, and Apoptosis
Assay
The effect of ELF-MF on cell viability was
determined using the Cell Counting Kit-8 (CCK-8)
assay (Dojindo, Kumamoto, Japan). Briefly, exponen-
Fig. 3. The effects of ELF-MF on osteogenic differentiation of MSCs. A: The cells were cultured
in osteogenesisinducingmedium andexposed to ELF-MF (ELF group) orsham exposure (CON).
The cellswithout adding osteogenesis mediumwerea s NC group.Osteoblast-specific mRNAex -
pression of ALP, COL1a1, OCN and Runx2 and were measured by the real-time PCR. The real-
time PCR results are expressed as means SEM. B:AlizarinRedSstainingwasperformedto
detect the osteogenic differentiationat day 21.
6Duetal.
Bioelectromagnetics
tially growing cells were seeded onto a 24-well plate
(Costar; 2 10
4
cells/well). Growing cells were exposed
to ELF of 7.5 Hz, 0.4 T with different exposure times.
Identical, non-energized exposure chambers were used
for sham exposure of control cells in the same room.
Twenty microliters of CCK-8 solution was added to
each well, and the cells were further incubated at 37 8C
for another 3.5 h. The absorbance values (A) at 450 nm
were measured on an ELx-800 Universal Microplate
Reader (BioTek, Winooski, VT). All data are expressed
as mean values from three independent studies. For the
apoptosis assay, the cells were harvested, stained with
propidium iodide and anti-Annexin-V antibody, and
then analyzed by a fluorescence-activated cell-sorting
(FACS) Calibur (BD Biosciences). For cell cycle
experiment, the treated cells were harvested, washed
once with PBS, and fixed in 70% ethanol overnight.
Staining of DNA content was performed with 50 mg/ml
propidium iodide and 1 mg/ml RNase A for 30 min.
Analysis was performed with Cell Quest Pro software.
Cell-cycle modeling was performed with Modfit 3.0
software (Verity Software House, Topsham, ME).
Statistical Analysis
All values were expressed as mean SEM. The
analyses were conducted with the SPSS 11.5 software
(SPSS, Chicago, IL). Statistical significance was
assessed by Student’st-test. For PCR analysis, statistical
analyses were conducted according to instructions for
the Gel-Pro Analyzer (Alpha Innotech). For all statistical
tests, P<0.05 was considered significant.
RESULTS
Morphology of Human Umbilical Cords MSCs
in Culture
The cultures of primary UC-MSCs underwent an
initial lag phase of about 4–8 days, adherent cells with
fibroblastic morphology could be observed as early as
24 h. The cells formed a monolayer of homogenous
Fig. 4. The effects of ELF-MF on adipogenic differentiation of Human umbilical cords MSCs. A:
The cells were cultured in adipogenesis inducing medium and exposed to (ELF group) or sham
exposure (CON).The cells without adding adipogenesis medium were as NC group. adipocyte-
specific mRNAexpression of PPARg2, FABP4, and LPL was measured by the real-time PCR.The
real-time PCR results are expressed as means SEM. P<0.05 versus CON.B:Oil RedOstain-
ingwas performed detect the adipogenic differentiationat day 21.
ELF-MF Inhibits Adipogenesis of Human MSCs 7
Bioelectromagnetics
bipolar spindle-like cells with a whirl pool like array
within 1 week (Fig. 2A). After 3 cell passages, the
adherent cells were symmetric with phenotypic surface
antigens. Results showed that UC-MSCs shared most
of their immunophenotype with bone marrow-derived
MSCs (BM-MSCs) as reported, including positivity
for CD29, CD44, CD90, CD105 (SH2), CD73 (SH3),
and HLA-ABC, negativity for CD19, CD11b, CD14,
CD34, and CD31 (endothelial cell marker) and HLA-
DR (Fig. 2B).
Effects of ELF-MF on Osteogenesis by Human
UC-MSCs
To test the effect of ELF-MF on osteogenic
differentiation of human UC-MSCs, osteoblast-spe-
cific mRNA expression of ALP, COL1a1, Runx2
and OCN was measured by the real-time PCR. The
adherent MSCs with plates (ELF group) were
exposed for 2 h/day for 15 days. Control treatments
(CON group) were placed in a similar apparatus but
without ELF-MF. The cells without added osteogen-
esis medium were the NC group. Real-time PCR
results showed that ELF-MF had no effects on the
expression of ALP, COL1a1, Runx2, and OCN
(Fig. 3A). Furthermore, we analyzed the osteogenic
differentiation of MSCs using Alizarin Red S Stain
analysis. After 21 days of ELF-MF exposure (2 h/
day), there was no change on osteogenic differentia-
tion compared with control samples (Fig. 3B).
ELF-MF Exposure Inhibits Adipocyte Master
Gene Expression of Human UC-MSCs
To test the effect of ELF-MF on adipogenic
differentiation of human UC-MSCs, adipocyte-specific
mRNA expression of PPARg2, FABP4, and LPL was
measured by the real-time PCR. The adherent MSCs
with plates (ELF group) were exposed for 2 h/day for
15 days. Control treatments (CON group) were placed
in a similar apparatus without the ELF-MF. The cells
without added adipogenesis medium were the NC
group. ELF-MF exposure for 15 days resulted in a
decrease in PPARg2 and FABP4 over the non-treated
control (P<0.01; Fig. 4A). To further confirm the effect
of ELF-MF on MSCs adipogenesis, cells were incubated
in adipogenic induction medium with ELF-MF (2 h/day)
or sham exposure for 21 days and then stained with Oil
Red O. In Figure 4B, we can see that the control has
more lipid droplets than the ELF-MF exposed group.
ELF-MF Downregulates the PPARg2
Expression of Human UC-MSCs
To further study whether expression of PPARg2
proteinwasdownregulatedbyELF-MF,protein
expression analysis was performed using Western
blot and immunofluorescence methods. MSCs were
cultured in adipogenic induction medium with ELF-
MF or sham exposure for 2 h/day for 21 days. Then
the cells were stained with PPARg2 for immunofluo-
rescence assay or the cells were lysed to PPARg2
protein level with immunoblot analysis. As shown in
Figure 5A, after treatment with ELF-MF for 21 days,
PPARg2 expression in MSCs was decreased. West-
ern blotting results also showed that the level of
PPARg2 protein was reduced after stimulation with
ELF-MF (Fig. 5B).
Effect of ELF-MF on Adipogenic Differentiation
of Human UC-MSCs Is Mediated via the
JNK-Dependent Noncanonical Wnt
Signaling Pathway
We next aimed to investigate how ELF-MF
affected MSCs adipogenic differentiation. We detected
several central signaling molecules (b-catenin, Cam-
KII, JNK, and p-JNK) in Wnt signaling pathway.
MSCs were cultured in adipogenic induction medium
with ELF-MF or sham exposure for 2 h/day for
Fig. 5. The effect of ELF-MF exposure on PPARg2 protein ex-
pression of human umbilical cords MSCs. A:MSCscellswere
cultured on coverslips in adipogenic induction medium. After
treatment with ELF-MF (ELF) or sham exposure (CON) for
21days, MSCs were fixed and immunostained with specific Abs
for rat PPARg2(60). B: MSCs cells treated with were ELF-MF
(ELF) or sham exposure (CON) for 21 days. Representative
Western blots PPARg2 and GAPDH in MSCs were shown and
the relative expression of PPARg2 to GAPDH was calculated.
The results are shown as mean SE from three representative
independent experiments. P<0.05, compared with CON.
8Duetal.
Bioelectromagnetics
21 days. Then the cells were lysed and the immunoblot
analysis was performed. ELF-MF had no effects on
the expression of b-catenin, CamKII, and p-CamKII.
However, the level of p-JNK was increased after ELF-
MF exposure (Fig. 6).
ELF-MF Has No Ef fect on Morphology, Cell
Cycle, Apoptosis, and Cell Proliferation of
Human UC-MSCs
Our studies have shown that ELF-MF was able to
inhibit adipogenic differentiation of MSCs. We further
examined the effects of ELF-MF on cytoskeleton, cell
viability, cell cycle and apoptosis of MSCs. F-actin and
vinculin are cell cytoskeleton proteins. After exposure
with ELF-MF of 7.5 Hz, 0.4 T for 1–4 days, 2 h/day,
ELF had no effects on the expression of F-actin and
vinculin in MSCs (Fig. 7A). In addition, the cell
viability was analyzed after treatment with ELF-MF
using CCK-8 assay kit. As shown in Figure 7B, ELF-
MF had no effects on MSCs cell viability. Then the cell
cycle was measured after treatment with ELF-MF. The
results showed that the cell cycle of ELF-MF treated
cells was similar to that of control cells (Fig. 7C).
Assessment of cell apoptosis of MSC showed that
treatment of ELF-MF of 7.5 Hz, 0.4 T for 1–4 days,
2 h/day had no effects on cell apoptosis (Fig. 7D).
DISCUSSION
Bassett [1982] used a pair of Helmholtz coils to
produce a magnetic field across a fracture site and
enhance osteogenesis. Since then, several experimental
studies have examined the influence of EMF on
osteoporosis. The effect appears to vary with the
waveform of magnetic field used [Bassett et al., 1981;
Brighton, 1984; Rubin et al., 1989; Skerry et al., 1991].
The effect was variable, but in some cases, osteoporo-
sis was prevented or even reversed. However, the exact
mechanism by which EMF stopped bone loss has not
been defined. In our study, we found that 7.5 Hz, 0.4 T
ELF-MF inhibit adipogenic differentiation of MSCs
while they have no affect on osteogenic differentiation.
Furthermore, we found that ELF-MF of 7.5 Hz, 0.4 T
may inhibit adipogenic differentiation of MSCs via
JNK-dependent Wnt signaling pathway.
ELF-MF inhibited adipocyte-specific expression
of PPARgand C/EBPs, but had no effects on the
expression of ALP, Runx2, OCN, and Col1a1. Several
transcriptional factors and intracellular signaling path-
ways have been demonstrated to control the differenti-
ation of MSCs into osteoblastic or adipocytic cells.
Generally, it is believed that PPAR gand C/EBPs are
the most important factors involved in the activation
Fig. 6. Effect of ELF-MF on Wnt signaling pathway. MSCs cells treated with were ELF-MF (ELF)
or sham exposure (CON) for 21days.Representative Western blots b-catenin,JNK, p -JNK,Cam -
KII, p-CamKII, and GAPDH in MSCs were shown and the relative expression of b-catenin to
GAPDH, p -JNK t o JNK and p- CamKIIto CamKIIwas calculated.The results are shownas mean
SE from three representativeindependent experiments. P<0.05, compared with CON.
ELF-MF Inhibits Adipogenesis of Human MSCs 9
Bioelectromagnetics
of adipogenesis [Noer et al., 2007; Hasegawa
et al., 2008; Lefterova and Lazar, 2009; Rosen et al.,
2009]. ALP, Runx2, OCN, and Col1a1 are osteogene-
sis markers of osteoblast differentiation [Glimcher
et al., 2007; Holleville et al., 2007]. Esposito et al.
[2013] reported that pulsed electromagnetic field
(PEMF) increased the division of MSCs and reduced
the time to obtain chondrocyte cell differentiation.
Ceccarelli et al. [2013] also found that PEMF
exposure promoted the cell proliferation of BM-MSCs
and increased ALK protein level and activity. Our
results demonstrated that ELF-MF inhibited adipo-
genesis of the stem cells but had no effect on
osteogenesis. This indicates that ELF-MF and PEMF
have different effects on MSCs differentiation. The
present findings that ELF-MF concomitantly corrected
osteoblastogenesis and adipogenesis suggests that
ELF-MF may act directly on the common precursor
cell to inhibit its commitment in the adipocyte lineage.
This may be one of the mechanisms by which ELF-
MF stops obesity.
ELF-MF was found to promote JNK-dependent
intracellular signaling in MSCs. Wnt pathway is
considered to be important in regulating mechanisms
for the proliferation, development, differentiation of
cells and organisms and can be divided into canonical
and noncanonical Wnt pathway. In the noncanonical
Wnt pathway, Wnt ligand such as Wnt5a regulates
target gene expression. JNK is a downstream effector
of Wnt5a that activates activator protein 1 (AP-1),
thereby regulating planar cell polarity (PCP) signaling
[Ling et al., 2009; Rao and Kühl, 2010]. Several recent
Fig. 7. Effects of ELF-MF on cytoskeleton, cell viability, cell cycle and apoptosis of MSCs.
A: MSCs cells were cultured on coverslips. After treatment with 7.5 Hz, 0.5 T ELF-MF (ELF) or
sham exposure (CON) for 21days, MSCs were fixed and immunostained with specific Abs forrat
F-actin (Green) and Vinculin (Red) or DAPI for nucleus (60). B: Cell viability analysis of MSCs
treated with ELF-MF using CCK- 8 a ssay kit. C: Representative data of flow cytometry analysis of
cell cycle. After 4 days of treatment, cells were analyzed and the percentage of cells in different
cell cycle interphases G0/G1, S, and G2 are indicated. D: Repre sentative data of flow cytometry
analysis ofapoptosis. D1,D2, D3,D 4 refers to cellswere treatedwith1- 4 days of ELF-MFexposure
(7.5 Hz, 0.4 T, 2 h/day). Data from onerepresentative experiment performedin triplicate.
10 Du et al.
Bioelectromagnetics
studies have shown that noncanonical Wnt signaling
has critical effects on the differentiation of MSCs,
which express a number of ligands, receptors and
pathway inhibitors [Etheridge et al., 2004]. In this
study, we found that ELF-MF activates JNK nonca-
nonical signaling in human MSCs. Interestingly it has
been shown that JNK signaling is essential in the
regulation of bone formation and inactivation of JNK
signaling impairs osteogenesis, although adipogenesis
is promoted [Tominaga et al., 2005].
There are some limitations to our study. First,
most studies show that in the adipogenic and osteo-
genic differentiation of MSCs there exists a reciprocal
relationship. This means that if adipogenic differentia-
tion was promoted, osteogenic differentiation will be
inhibited. In our study, ELF-MF inhibited adipogenic
differentiation, but had no effect on osteogenic differ-
entiation; a point to be further explored in the future.
Our study revealed that ELF-MF acted on MSCs to
inhibit differentiation to adipocytes. However, it is not
clear if this effect is direct or indirect.
In conclusion, the adipogenic differentiation of
MSCs could be inhibited by ELF-MF of 7.5 Hz, 0.4 T,
suggesting the inhibitory effect of ELF-MF on obesity
may be attributed to the inhibition of differentiation of
MSCs into adipocytes. Despite the limitations of our
study, our findings have several implications for the
biology and therapy of human diseases associated with
adipogenesis and will provide a possible approach for
the treatment of obesity.
REFERENCES
Akune T, Ohba S, Kamekura S, Yamaguchi M, Chung UI, Kubota
N, Terauchi Y, Harada Y, Azuma Y, Nakamura K, Kadowaki
T, Kawaguchi H. 2004. PPARgamma insufficiency enhan-
ces osteogenesis through osteoblast formation from bone
marrow progenitors. J Clin Invest 113:846–855.
Attie AD, Scherer PE. 2009. Adipocyte metabolism and obesity.
J Lipid Res 50:S395–399.
Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien
KR, Koder A, Evans RM. 1999. PPAR gis required for
placental, cardiac, and adipose tissue development. Mol
Cell 4:585–595.
Bassett CA. 1982. Claims for magnetotherapy. Can Med Assoc J
127:1079–1080.
Bassett CA, Mitchell SN, Gaston SR. 1981. Treatment of ununited
tibial diaphyseal fractures with pulsing electromagnetic
fields. J Bone Joint Surg Am 63:511–523.
Beilin G, Benech P, Courie R, Benichoux F. 2012. Electromagnetic
fields applied to the reduction of abdominal obesity.
J Cosmet Laser Ther 14:24–42.
Bilkovski R, Schulte DM, Oberhauser F, Gomolka M, Udelhoven
M, Hettich MM, Roth B, Heidenreich A, Gutschow C,
Krone W, Laudes M. 2010. Role of WNT-5a in the
determination of human mesenchymal stem cells into
preadipocytes. J Biol Chem 285:6170–6178.
Bilkovski R, Schulte DM, Oberhauser F, Gomolka M, Udelhoven
M, Hettich MM, Roth B, Heidenreich A, Gutschow C,
Krone W, Laudes M. 2010. Role of WNT-5a in the
determination of human mesenchymal stem cells into
preadipocytes. J Biol Chem 285:6170–6178.
Bowers RR, Lane MD. 2007. A role for bone morphogenetic
protein-4 in adipocyte development. Cell Cycle 6:385–
389.
Brighton CT. 1984. The semi-invasive method of treating non-
union with direct current. Orthop Clin North Am 15:33–45.
Ceccarelli G, Bloise N, Mantelli M, Gastaldi G, Fassina L, De
Angelis MGC, Ferrari D, Imbriani M, Visai L. 2013. A
comparative analysis of the in vitro effects of pulsed
electromagnetic field treatment on osteogenic differentiation
of two different mesenchymal cell lineages. Biores Open
Access 2:283–294.
Church V, Nohno T, Linker C, Marcelle C, Francis-West P. 2002.
Wnt regulation of chondrocyte differentiation. J Cell Sci
115:4809–4818.
Cornier MA, Dabelea D, Hernandez TL, Lindstrom RC, Steig AJ,
Stob NR, Van Pelt RE, Wang H, Eckel RH. 2008. The
metabolic syndrome. Endocr Rev 29:777–822.
Creecy CM, O’Neill CF, Arulanandam BP, Sylvia VL, Navara CS,
Bizios R. 2013. Mesenchymal stem cell osteodifferentiation
in response to alternating electric current. Tissue Eng Part A
19:467–474.
Day TF, Guo X, Garrett-Beal L, Yang Y. 2005. Wnt/beta-catenin
signaling in mesenchymal progenitors controls osteoblast
and chondrocyte differentiation during vertebrate skeleto-
genesis. Cell 8:739–750.
Esposito M, Lucariello A, Costanzo C, Fiumarella A, Giannini A,
Riccardi G, Riccion I. 2013. Differentiation of human
umbilical cord-derived mesenchymal stem cells, WJ-MSCs,
into chondrogenic cells in the presence of pulsed electro-
magnetic fields. In Vivo 27:495–500.
Etheridge SL, Spencer GJ, Heath DJ, Genever PG. 2004. Expres-
sion profiling and functional analysis of wnt signaling
mechanisms in mesenchymal stem cells. Stem Cells
22:849–860.
Friedman JM. 2004. Modern science versus the stigma of obesity.
Nat Med 10:563–569.
Gimble JM, Zvonic S, Floyd ZE, Kassem M, Nuttall ME. 2006.
Playing with bone and fat. J Cell Biochem 98:251–266.
Glimcher LH, Jones DC, Wein MN. 2007. Control of postnatal
bone mass by the zinc finger adapter protein Schnurri-3.
Ann NY Acad Sci 1116:174–181.
Hasegawa S, Yamasaki M, Inage T, Takahashi N, Fukui T. 2008.
Transcriptional regulation of ketone body-utilizing enzyme,
acetoacetyl-CoA synthetase, by C/EBPalpha during adipo-
cyte differentiation. Biochim Biophys Acta 1779:414–419.
Haynesworth SE, Goshima J, Goldberg VM, Caplan AI. 1992.
Characterization of cells with osteogenic potential from
human marrow. Bone 13:81–88.
He S, Pant D, Schiffmacher A, Meece A, Keefer CL. 2008.
Lymphoid enhancer factor 1-mediated Wnt signaling pro-
motes the initiation of trophoblast lineage differentiation in
mouse embryonic stem cells. Stem Cells 26:842–849.
Hill TP, Spater D, Taketo MM, Birchmeier W, Hartmann C. 2005.
Canonical Wnt/beta-catenin signaling prevents osteoblasts
from differentiating into chondrocytes. Dev Cell 8:727–738.
Holleville N, Matéos S, Bontoux M, Bollerot K, Monsoro-Burq
AH. 2007. Dlx5 drives Runx2 expression and osteogenic
differentiation in developing cranial suture mesenchyme.
Dev Biol. 304:860–874.
ELF-MF Inhibits Adipogenesis of Human MSCs 11
Bioelectromagnetics
Holmen SL, Zylstra CR, Mukherjee A, Sigler RE, Faugere MC,
Bouxsein ML, Deng L, Clemens TL, Williams BO. 2005.
Essential role of beta-catenin in postnatal bone acquisition.
J Biol Chem 280:21162–21168.
Kersten S, Desvergne B, Wahli W. 2000. Roles of PPARs in health
and disease. Nature 405:421–424.
Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T,
Komeda K, Satoh S, Nakano R, Ishii C, Sugiyama T, Eto K,
Tsubamoto Y, Okuno A, Murakami K, Sekihara H, Hase-
gawa G, Naito M, Toyoshima Y, Tanaka S, Shiota K,
Kitamura T, Fujita T, Ezaki O, Aizawa S, Kadowaki T.
1999. PPAR gmediates high-fat diet-induced adipocyte
hypertrophy and insulin resistance. Mol Cell 4:597–609.
Lefterova MI, Lazar MA. 2009. New developments in adipo-
genesis. Trends Endocrinol Metab 20:107–114.
Ling L, Nurcombe V, Cool SM. 2009. Wnt signaling controls the
fate of mesenchymal stem cells. Gene 433:1–7.
Mangelsdorf DJ, Evans RM. 1995. The RXR heterodimers and
orphan receptors. Cell 83:841–850.
Mayer-Wagner S, Passberger A, Sievers B, Aigner J, Summer B,
Schiergens TS, Jansson V, Müller PE. 2011. Effects of low
frequency electromagnetic fields on the chondrogenic
differentiation of human mesenchymal stem cells. Bioelec-
tromagnetics 32:283–290.
Nichols TW, Jr. 2012. Mitochondria of mice and men: Moderate
magnetic fields in obesity and fatty liver. Med Hypotheses
79:287–293.
Nie Y, Du L, Mou Y, Xu Z, Weng L, Du Y, Zhu Y, Hou Y, Wang T.
2013. Effect of low frequency magnetic fields on melanoma:
Tumor inhibition and immune modulation. BMC Cancer 13:582.
Noer A, Boquest AC, Collas P. 2007. Dynamics of adipogenic
promoter DNA methylation during clonal culture of human
adipose stem cells to senescence. BMC Cell Biol 8:18.
Pi-Sunyer X. 2009. The medical risks of obesity. Postgrad Med
121:21–33.
Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R,
Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak
DR. 1999. Multilineage potential of adult human mesenchy-
mal stem cells. Science 284:143–147.
Rao TP, Kühl M. 2010. An updated overview on Wnt signaling
pathways: A prelude for more. Circ Res 106:1798–1806.
Rosen E, Eguchi J, Xu Z. 2009. Transcriptional targets in
adipocyte biology. Expert Opin Ther Targets 13:975–986.
Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS,
Spiegelman BM, Mortensen RM. 1999. PPAR gis required
for the differentiation of adipose tissue in vivo and in vitro.
Mol Cell 4:611–617.
Rosen ED, Spiegelman BM. 2001. PPARg: A nuclear regulator of
metabolism, differentiation, and cell growth. J Biol Chem
12:37731–37734.
Rubin CT, McLeod KJ, Lanyon LE. 1989. Prevention of osteopo-
rosis by pulsed electromagnetic fields. J Bone Joint Surg
Am 71:411–417.
Schwartz Z, Simon BJ, Duran MA, Barabino G, Chaudhri R,
Boyan BD. 2008. Pulsed electromagnetic fields enhance
BMP-2 dependent osteoblastic differentiation of human
mesenchymal stem cells. J Orthop Res 26:1250–1255.
Skerry TM, Pead MJ, Lanyon LE. 1991. Modulation of bone loss
during disuse by pulsed electromagnetic fields. J Orthop
Res 9:600–608.
Taipaleenmaki H, Abdallah BM, AlDahmash A, Saamanen AM,
Kassem M. 2011. Wnt signalling mediates the cross-talk
between bone marrow derived pre-adipocytic and
pre-osteoblastic cell populations. Exp Cell Res 317:745–
756.
Takeda S, Elefteriou F, Karsenty G. 2003. Common endocrine
control of body weight, reproduction, and bone mass. Annu
Rev Nutr 23:403–411.
Tchoukalova Y, Koutsari C, Jensen M. 2007. Committed subcuta-
neous preadipocytes are reduced in human obesity. Diabeto-
logia 50:151–157.
Tominaga S, Yamaguchi T, Takahashi S, Hirose F, Osumi T. 2005.
Negative regulation of adipogenesis from human mesenchy-
mal stem cells by Jun N-terminal kinase. Biochem Biophys
Res Commun 326:499–504.
Tong Z, Duncan RL, Jia X. 2013. Modulating the behaviors of
mesenchymal stem cells via the combination of high-
frequency vibratory stimulations and fibrous scaffolds.
Tissue Eng Part A 19:1862–1878.
Tontonoz P, Hu E, Spiegelman BM. 1994. Stimulation of adipo-
genesis in fibroblasts by PPAR g2, a lipid-activated
transcription factor. Cell 79:1147–1156.
Wang T, Nie Y, Zhao S, Han Y, Du Y, Hou Y. 2011. Involvement
of midkine expression in the inhibitory effects of low-
frequency magnetic fields on cancer cells. Bioelectromag-
netics 32:443–452.
Yang Y, Tao C, Zhao D, Li F, Zhao W, Wu H. 2010. EMF acts on
rat bone marrow mesenchymal stem cells to promote
differentiation to osteoblasts and to inhibit differentiation to
adipocytes. Bioelectromagnetics 31:277–285.
12 Du et al.
Bioelectromagnetics
