The Treg-Specific Demethylated Region Stabilizes Foxp3 Expression Independently of NF-κB Signaling

Abstract

Regulatory T cells (Tregs) obtain immunosuppressive capacity by the upregulation of forkhead box protein 3 (Foxp3), and persistent expression of this transcription factor is required to maintain their immune regulatory function and ensure immune homeostasis. Stable Foxp3 expression is achieved through epigenetic modification of the Treg-specific demethylated region (TSDR), an evolutionarily conserved non-coding element within the Foxp3 gene locus. Here, we present molecular data suggesting that TSDR enhancer activity is restricted to T cells and cannot be induced in other immune cells such as macrophages or B cells. Since NF-κB signaling has been reported to be instrumental to induce Foxp3 expression during Treg development, we analyzed how NF-κB factors are involved in the molecular regulation of the TSDR. Unexpectedly, we neither observed transcriptional activity of a previously postulated NF-κB binding site within the TSDR nor did the entire TSDR show any transcriptional responsiveness to NF-κB activation at all. Finally, the NF-κB subunit c-Rel revealed to be dispensable for epigenetic imprinting of sustained Foxp3 expression by TSDR demethylation. In conclusion, we show that NF-κB signaling is not substantially involved in TSDR-mediated stabilization of Foxp3 expression in Tregs.

Full text

The Treg-Specific Demethylated Region Stabilizes
Foxp3
Expression Independently of NF-kB Signaling
Lisa Schreiber
1
, Beate Pietzsch
1
, Stefan Floess
1
, Carla Farah
1
, Lothar Ja
¨nsch
2
, Ingo Schmitz
3,4
,
Jochen Huehn
1
*
1Department Experimental Immunology, Helmholtz Centre for Infection Research, Braunschweig, Germany, 2Research Group Cellular Proteomics, Helmholtz Centre for
Infection Research, Braunschweig, Germany, 3Research Group Systems-oriented Immunology and Inflammation Research, Helmholtz Centre for Infection Research,
Braunschweig, Germany, 4Institute of Molecular and Clinical Immunology, Otto-von-Guericke-University, Magdeburg, Germany
Abstract
Regulatory T cells (Tregs) obtain immunosuppressive capacity by the upregulation of forkhead box protein 3 (Foxp3), and
persistent expression of this transcription factor is required to maintain their immune regulatory function and ensure
immune homeostasis. Stable Foxp3 expression is achieved through epigenetic modification of the Treg-specific
demethylated region (TSDR), an evolutionarily conserved non-coding element within the Foxp3 gene locus. Here, we
present molecular data suggesting that TSDR enhancer activity is restricted to T cells and cannot be induced in other
immune cells such as macrophages or B cells. Since NF-kB signaling has been reported to be instrumental to induce Foxp3
expression during Treg development, we analyzed how NF-kB factors are involved in the molecular regulation of the TSDR.
Unexpectedly, we neither observed transcriptional activity of a previously postulated NF-kB binding site within the TSDR
nor did the entire TSDR show any transcriptional responsiveness to NF-kB activation at all. Finally, the NF-kB subunit c-Rel
revealed to be dispensable for epigenetic imprinting of sustained Foxp3 expression by TSDR demethylation. In conclusion,
we show that NF-kB signaling is not substantially involved in TSDR-mediated stabilization of Foxp3 expression in Tregs.
Citation: Schreiber L, Pietzsch B, Floess S, Farah C, Ja
¨nsch L, et al. (2014) The Treg-Specific Demethylated Region Stabilizes Foxp3 Expression Independently of NF-
kB Signaling. PLoS ONE 9(2): e88318. doi:10.1371/journal.pone.0088318
Editor: Antonio A. Freitas, Institut Pasteur, France
Received August 21, 2013; Accepted January 7, 2014; Published February 5, 2014
Copyright: ß2014 Schreiber et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the German Research Foundation (SFB738 and SFB854). The funders had no role in study design, data collection and
analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: Jochen.Huehn@helmholtz-hzi.de
Introduction
Regulatory T cells (Tregs) are cellular mediators of immuno-
logical tolerance as they possess the capacity to suppress various
types of immune responses against self and non-self antigens [1].
The transcription factor forkhead box protein 3 (Foxp3) is specifically
expressed in Tregs and is essential for the development of their
immunosuppressive properties [2,3]. After induction during Treg
development, continued expression of Foxp3 is imperative for the
maintenance of the cells’ suppressive phenotype [4]. Foxp3
+
Tregs
bear a curative potential and are considered for various
therapeutic applications [5], however, instability of Foxp3 expres-
sion and concomitant acquirement of proinflammatory properties
are major obstacles. Stable Foxp3 expression is accompanied by
epigenetic modulation of the Treg-specific demethylated region
(TSDR), a CpG-rich, non-coding sequence within the first intron
of the Foxp3 gene locus [6]. The TSDR is demethylated only in
Tregs stably expressing Foxp3 but is fully methylated in CD4
+
conventional T cells (Tconv) and in in vitro generated Tregs only
transiently expressing Foxp3 [7–9]. Moreover, transcriptional
enhancer activity of the TSDR in an in vitro reporter assay is
essentially determined by its methylation status [10]. It is
completely inactive in its methylated state, but as soon as the
TSDR is demethylated transcription factors such as Ets-1 and
Creb can bind to the TSDR [8,10,11] and switch on its
transcriptional activity, most likely in cooperation with other
transcription factors that have been demonstrated to occupy the
TSDR, e.g. Stat-5 and Runx1/3 [12]. Despite the critical role of
the TSDR for stabilization of Foxp3 expression, the molecular
players participating in its transcriptional regulation are only
incompletely understood. Elucidating the underlying molecular
mechanisms may open up new approaches to modulate stability of
Foxp3 expression, which is of outmost importance for the
therapeutic application of Tregs in clinical settings.
Recently, NF-kB transcription factors, which are important,
inducible regulators of innate and adaptive immunity [13], have
been shown to be involved in Treg development [14]. In
mammals, the NF-kB protein family consists of five members:
p65 (RelA), c-Rel, RelB, p50 and p52, all of which share a
structural motif known as Rel homology domain that is critical for
homo- or hetero-dimerization and DNA binding. Without an
appropriate stimulus, NF-kB proteins are trapped in the cytoplasm
by inhibitors of NF-kB(IkB) proteins, which shield the nuclear
localization sequence of NF-kB, thereby preventing their translo-
cation into the nucleus. Similarly, p100 and p105, which are the
unprocessed precursor proteins of p52 and p50, respectively,
function as IkB (reviewed in [15]). In T cells, ligation of the T cell
receptor (TCR) complex induces the canonical NF-kB signaling
pathway, which integrates the activation of the IkB kinase (IKK)
complex [16]. The two catalytic subunits IKKaand IKKb,in
cooperation with the scaffold protein IKKc, can mediate IkB
phosphorylation, which is followed by ubiquitination and degra-
PLOS ONE | www.plosone.org 1 February 2014 | Volume 9 | Issue 2 | e88318

dation of IkB, thus releasing NF-kB proteins and permitting
nuclear localization of transcriptionally active p65/p50 and p50/
c-Rel heterodimers [15]. IKKb-mediated IkBadegradation is
regarded as the central step in canonical NF-kB activation in T
cells [15]. In contrast, IKKaactivity is crucial for the activation of
the non-canonical NF-kB pathway, which targets activation of
p52/RelB heterodimers [17].
Many of the TCR/NF-kB signaling mediators contribute to
normal Treg development, namely IKKb, protein kinase C-hand
components of the CBM (Carma-1/Bcl-10/Malt-1; Card [cas-
pase-recruitment domain]-Maguk [membrane-associated guany-
late kinase] protein-1, B cell lymphoma-10, mucosa-associated
lymphoid tissue lymphoma translocation gene-1) complex, which
functions upstream of IKKbactivation, as well as IkBa, the NF-
kB subunit c-Rel [18–27] and the atypical IkB protein IkB
NS
[28].
Importantly, it was shown that NF-kB can directly target Foxp3
gene expression [25,28–31], and c-Rel binding to the Foxp3
promoter as well as to the recently described pioneer element [30]
is crucial for initiating Foxp3 expression during Treg development
[32]. However, the contribution of NF-kB to the transcriptional
regulation of the TSDR is discussed more controversially [32]. c-
Rel binding to the TSDR could be detected in primary Tconv
[25], and we have recently reported a potential NF-kB binding site
within the TSDR that is critical for full TSDR enhancer activity
and that is identical to the NF-kB binding site postulated by Long
et al. [10,25]. In contrast, Ruan et al. detected binding of c-Rel and
p65 exclusively to the Foxp3 promoter in TCR-stimulated T cells,
whereas no binding to the TSDR could be observed in the same
cells [29]. Therefore, the contribution of NF-kB to the transcrip-
tional regulation of the TSDR remains obscure and it is not clear
whether NF-kB is required for the stabilization of Foxp3
expression.
In the present study, we could demonstrate that the transcrip-
tional enhancer activity of the TSDR is entirely dependent on T
cell-specific signals and is not inducible in other immune cells.
Moreover, blocking NF-kB signaling pathways did not signifi-
cantly influence TSDR enhancer activity, indicating that the
TSDR functions in an NF-kB-independent manner. Finally, stable
Foxp3 expression and epigenetic modifications of the TSDR were
observed in c-Rel-deficient Tregs. In summary, these data suggest
that NF-kB factors are largely dispensable for TSDR-mediated
stabilization of Foxp3 expression and epigenetic remodeling of the
Foxp3 locus.
Results
TSDR Enhancer Activity Requires T cell-specific Signals
Compelling evidence suggests that the TSDR acts as a
transcriptional stabilizer of Foxp3 expression in Tregs [6]. In
combination with a promoter, the TSDR possesses transcriptional
enhancer activity in luciferase reporter assays, which have
therefore been a common approach to analyze its transcriptional
regulation [7,10,25,30]. In the present literature, TSDR enhancer
activity has been demonstrated in T cell lines as well as in primary
T cells, and this was dependent on the activation of several
transcription factors that have usually been triggered by the
application of phorbol-12-myristate-13-acetate (PMA) and iono-
mycin (PMA/iono) mimicking the TCR stimulus (reviewed in
[12]). However, it is not known whether the TSDR can be
activated in non-T cells. In order to determine whether other cell
types can deliver the molecular requirements to stimulate TSDR
activity, we assessed TSDR enhancer activity in the B lymphoma
cell line A20 and the macrophage cell line RAW 264.7 and
performed luciferase reporter assays using plasmids encoding
luciferase under the control of the TSDR and a promoter.
Initially, we tested TSDR enhancer activity in combination with
the endogenous Foxp3 promoter. Although the TSDR-Foxp3
promoter construct was sufficient to drive luciferase expression
in the T lymphoma cell line RLM-11 [10], weak (A20) or no
(RAW 264.7) luciferase activity was observed in A20 and RAW
264.7 cells upon stimulation with PMA/iono (data not shown). We
therefore repeated luciferase assays using plasmids integrating the
SV40 promoter in combination with the TSDR and measured
transcriptional activity in RLM-11 cells, A20 cells and RAW 264.7
cells (Fig. 1). The SV40 promoter was transcriptionally active in all
cells and gave rise to increased luciferase activities as compared to
empty vector controls upon PMA/iono stimulation (A20 and
RLM-11) or interferon-c(IFN-c)/lipopolysaccharide (LPS) stim-
ulation (RAW 264.7). As expected, the TSDR was able to
augment this activity in RLM-11 cells. In contrast, A20 and RAW
264.7 cells displayed no enhanced luciferase activity in the
presence of the TSDR (Fig. 1). However, A20 and RAW 264.7
cells showed increased luciferase activity when reporter vectors
containing an SV40 enhancer were used. Viewed as a whole, these
data implicate that the TSDR depends on T cell-specific signals
and cannot be activated in other immune cell types.
A Postulated NF-kB Binding Site within the TSDR is not
Responsive to NF-kB Activation in T cells
Comprehensive research has provided evidence that intrinsic
NF-kB signaling is crucial for the development of thymus-derived
Tregs [14]. Several analyses indicate that NF-kB directly
participates in the transcriptional regulation of Foxp3 expression
[14,32]. In this study, investigations focused on the role of NF-kB
signaling in the regulation of TSDR enhancer activity.
First, we aimed to confirm the activation of NF-kB transcription
factors in RLM-11 cells, which we intended to use for subsequent
luciferase experiments. To this end, RLM-11 cells were stimulated
with PMA/iono for increasing time periods and subcellular
localization of NF-kB was analyzed by Western blotting.
Expression of NF-kB proteins p105 and c-Rel increased in the
cytoplasm upon stimulation and the activated subunits p50, p65
and c-Rel translocated to the nucleus (Fig. 2a and S1). Similar
results have been obtained in a time course of NF-kB activation in
primary murine CD4
+
T lymphocytes [28], indicating similar
kinetics of NF-kB activation in RLM-11 cells and primary T cells.
Next, transcriptional activity of NF-kB was tested by means of a
luciferase assay using the NF-kB-responsive element (NF-kB-RE),
a sequence of five repetitive NF-kB binding sites, which drives
luciferase expression upon NF-kB activation with the help of a
minimal promoter element (TATA box). Upon transfection of
RLM-11 cells, PMA/iono stimulation potently induced activation
of the NF-kB-RE (Fig. 2b). Thus, in accordance with NF-kB
nuclear translocation, NF-kB is transcriptionally active in RLM-11
cells.
A putative binding site for NF-kB within the TSDR (Fig. 2c)
had been described previously to be critically required for the
transcriptional enhancer activity of the TSDR [10,25]. However, a
final proof that NF-kB binds to this critical site in order to promote
TSDR enhancer activity is lacking so far. In order to test whether
this sequence comprises NF-kB-mediated transcriptional activity,
five repetitive sequences of this putative NF-kB binding site
(tandem) were introduced into a luciferase construct containing the
human elongation factor 1 (EF) promoter and luciferase assays were
performed in RLM-11 cells (Fig. 2d). Despite strongly enhanced
EF promoter activity when combined with the full TSDR,
repetitive sequences of the putative NF-kB binding site alone
were not sufficient to enhance EF promoter activity, suggesting
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 2 February 2014 | Volume 9 | Issue 2 | e88318

that this sequence does not function as a transcriptional responder
of NF-kB activation.
Activation of NF-kB Signaling Mediators is Largely
Dispensable for TSDR Enhancer Activity
NF-kB binding to the TSDR has been observed by chromatin
immunoprecipitations [25] and thus, it was still possible that NF-
kB signaling was important to obtain full TSDR transcriptional
activity mediated by yet unidentified NF-kB binding sites. To
address the general impact of NF-kB signaling on the TSDR,
functional involvement of IkB kinases (IKK) was analyzed. To this
end, TSDR enhancer activity was measured in a luciferase assay in
RLM-11 cells in which kinase dead (KD) mutants of IKKaor
IKKbwere overexpressed (Fig. 3a). Wild-type (WT) IKKs served
as controls and functionality of the IKK-KD mutants was proven
with luciferase constructs carrying the NF-kB-RE. Whereas
overexpression of IKKa-KD or IKKb-KD drastically reduced
transcriptional activity of the NF-kB-RE, no comparable effect
was observed for the TSDR albeit overexpression of IKKb-KD
moderately reduced TSDR enhancer activity to about 80%
(Fig. 3a). Furthermore, combined overexpression of IKKa-KD
and IKKb-KD had no synergistic capacity to further minimize
TSDR enhancer activity (Fig. 3a). In a complementary approach,
constitutively active IKKb(IKKb-CA) [33] was tested for its
ability to enhance TSDR activity. To this end, luciferase activity of
the TSDR was tested in RLM-11 cells that had been co-
transfected with IKK-CA or an empty vector as control (Fig. 3b).
Functionality of IKK-CA was verified in a luciferase assay using
the NF-kB-RE, giving rise to a more than 600-fold increase of
luciferase activity upon overexpression of IKKb-CA. However,
only moderate induction of TSDR enhancer activity was observed
upon IKK-CA overexpression.
Kinase activity of IKKbis required to phosphorylate IkBato
target it for degradation. However, it has been shown that IKK
additionally phosphorylates other proteins [15]. As IKKb
moderately influenced TSDR activity, the role of canonical NF-
kB signaling in the regulation of TSDR activity was further
investigated. For this purpose, luciferase assays were performed in
RLM-11 cells overexpressing a phosphorylation- and degradation-
resistant mutant form of IkBa, the degradation of which is usually
regarded to be a central step during canonical NF-kB signaling.
This mutant containing serine-to-alanine changes at amino acid
residues 32 and 36 is commonly referred to as NF-kB super-
repressor [34]. Luciferase activities of the TSDR-Foxp3 promoter
construct and the NF-kB-RE were measured in the presence or
absence of the super-repressor (Fig. 4). Overexpression of the
super-repressor drastically reduced activity of the NF-kB-RE
down to levels that were similar to those of unstimulated cells
(Fig. 4). In contrast, transcriptional enhancer activity of the TSDR
was unaffected upon overexpression of the super-repressor at
various time points after stimulation, indicating that degradation
of IkBawas not required to stimulate full TSDR enhancer activity
(Fig. 4 and S2). In summary, our results propose that activation of
canonical as well as non-canonical NF-kB signaling is dispensable
for TSDR enhancer activity.
c-Rel is not Required for TSDR Demethylation and Stable
Foxp3 Expression
The NF-kB subunit c-Rel was described to be the most critical
factor of all NF-kB proteins during the thymic development of
Tregs [21,26,35]. c-Rel has been shown to bind to the TSDR in
Tconv [25], however, whether c-Rel plays a functional role in the
TSDR-mediated stabilization of Foxp3 expression has not been
addressed yet. Ample evidence has accumulated suggesting that
DNA demethylation at the TSDR is indispensable for the
maintenance of Foxp3 expression [6]. Furthermore, c-Rel has
been described to encompass chromatin-remodeling properties
[36], and it was therefore conceivable that c-Rel was involved in
TSDR demethylation. To address this question, Tregs and Tconv
were isolated from c-Rel
2/2
mice and WT controls. Cells were
analyzed for their DNA methylation status at the TSDR (Fig. 5a).
As expected, Tconv from both WT as well as c-Rel
2/2
mice were
completely methylated at each of the nine CpG motifs analyzed.
Importantly, Tregs from c-Rel
2/2
and WT mice revealed
comparable levels of TSDR demethylation, demonstrating that
c-Rel was dispensable for establishing this epigenetic mark. Finally,
c-Rel
2/2
Tregs were analyzed for their capability to maintain
Foxp3 expression upon activation and proliferation. Thereto, c-
Rel
2/2
or WT Tregs were isolated to high purity, cultured for six
days using CD3/CD28 stimulation in the presence of IL-2 and
Figure 1. B cells and macrophages fail to induce transcriptional enhancer activity of the TSDR. Dual luciferase assays were performed
after transfecting reporter plasmids carrying the indicated inserts or an empty pGL3 vector (EV) into RLM-11 cells (T cell line), A20 cells (B cell line) or
RAW 264.7 cells (macrophage cell line). Three hrs (RLM-11, A20) or 20 hrs (RAW 264.7) after transfection, cells were stimulated for 16 hrs with PMA/
iono (RLM-11, A20) or for 14 hrs with LPS/IFN-c(RAW 264.7), followed by measurement of luciferase activities (mean6SD, n = 3). Data are
representative of two to four independent experiments.
doi:10.1371/journal.pone.0088318.g001
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 3 February 2014 | Volume 9 | Issue 2 | e88318

analyzed for stability of Foxp3 expression at the end of the culture.
A comparably high frequency of WT and c-Rel
2/2
Tregs
maintained Foxp3 expression, indicating that c-Rel was not
required for the stabilization of Foxp3 expression (Fig. 5b).
In summary, we could show that the canonical NF-kB signaling
pathway is largely dispensable for the control of TSDR enhancer
activity and that the transcription factor c-Rel is not involved in
TSDR-mediated stabilization of Foxp3 expression.
Discussion
Stable Foxp3 expression is indispensable for the maintenance of
the established transcriptional program and suppressive capacity
of Tregs. In Tregs, Foxp3 expression is epigenetically imprinted
and occurs via demethylation of a highly conserved CpG-rich
region within the Foxp3 locus, designated TSDR [9,37,38]. Since
the demethylated TSDR presents an epigenetic mark, which is
unique to Tregs, it can clearly distinguish these cells from other
cell types [39]. On a functional level, the TSDR stabilizes Foxp3
expression and thereby determines Treg lineage stability [6,40].
Figure 2. The postulated NF-kB binding site of the TSDR is not transcriptionally responsive to activated NF-kB. (A) RLM-11 cells were
stimulated with PMA/iono for indicated time periods and applied to subcellular fractionation. Nuclear and cytoplasmic extracts were analyzed by
Western blotting using the indicated antibodies. p44/42 and lamin B served as loading and purity controls for cytoplasmic and nuclear fractions,
respectively. (B) A luciferase reporter plasmid integrating the NF-kB-RE was transfected into RLM-11 cells and dual luciferase assays were performed
in triplicates as described in Figure 1. Mean luciferase activity is shown as fold increase to unstimulated control. Results are representative of four
independent experiments. (C) A schematic view on the first part of the Foxp3 gene locus is depicted. White boxes indicate untranslated exons, the
first translated exon is indicated in black. Evolutionary conserved non-coding sequences (CNS) are indicated in grey. The distended region of the
TSDR includes the previously described NF-kB binding site (black frame), which is flanked by the seventh CpG motif (underlined) of the TSDR. (D)A
tandem of five repetitive sequences of the putative NF-kB binding site was inserted into the pCpGL luciferase reporter plasmid upstream of the EF
promoter (tandem-EFPro). Dual luciferase assays were performed as described in (B) using pCpGL-TSDR-EFPro as a positive control. Data represent
one out of two independent experiments.
doi:10.1371/journal.pone.0088318.g002
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 4 February 2014 | Volume 9 | Issue 2 | e88318

However, the molecular mechanisms that control TSDR activity
are only incompletely understood. Here, we could show that the
transcriptional enhancer activity of the TSDR is entirely
dependent on T cell-specific signals and can neither be induced
in B cells nor macrophages. Furthermore, NF-kB signaling
pathways did not significantly influence TSDR activity, suggesting
that NF-kB factors are largely dispensable for TSDR-mediated
stabilization of Foxp3 expression.
Various studies have demonstrated that the TSDR accommo-
dates transcriptional enhancer activity in human and murine
primary and immortalized T cells and, importantly, that
methylation of the TSDR completely abrogates this transcriptional
activity [7,8,30,41]. On the contrary, forced demethylation of the
TSDR by the application of the demethylating drug 5-azacytidine
could artificially induce stable Foxp3 expression in Tconv [7].
Interestingly, this is also true for some non-CD4
+
T cells: Foxp3
expression was observed in primary CD8
+
T cells lacking DNA
methyltransferase-1 [42], and both, natural killer cells and CD8
+
T cells exhibited Foxp3 gene expression when activated and
cultured in the presence of 5-azacytidine [8,43].
These non-CD4
+
T cells share essential signaling molecules with
CD4
+
T cells, including the f-chain and the IL-2 receptor b-chain
CD122 as well as the downstream transcription factors Creb and
Stat-5 [44,45], which were shown to bind to and transactivate the
TSDR [8,46]. Thus, it is tempting to speculate that these signaling
pathways are key control elements of the Foxp3 locus in Tregs and
that solely the methylation status of the TSDR prevents Foxp3
expression in CD8
+
T cells and natural killer cells.
However, the methylation status of the TSDR was not the only
determinant controlling Foxp3 gene activity. We could provide
evidence that the transcriptional activity of the TSDR also
depends on cell-type-specific signaling pathways. Whereas the
TSDR can be activated in T cell lines such as RLM-11 (this study)
or EL-4 [30], TSDR activity could not be detected in B cell or
macrophage cell lines upon stimulation with PMA/iono or LPS/
IFN-c. Hence, even though the TSDR was fully demethylated in
the luciferase reporter assays in the present study, PMA/iono is
only capable of stimulating TSDR activity in T cells, but not in B
cells or macrophages, indicating that mere triggering of calcium
influx (ionomycin) and protein kinase C activity (PMA) is not
Figure 3. Kinase activity of IKKaand IKKbis largely dispensable for TSDR enhancer activity. (A) Luciferase plasmids encoding NF-kB-RE
or TSDR-FoxPro were co-transfected with plasmids encoding kinase dead (KD) or wild-type (WT) forms of IkB kinase aand b(IKKaand IKKb) into RLM-
11 cells. Cells were cultured for one day allowing efficient protein expression before cells were stimulated overnight with PMA/iono and dual
luciferase assays were performed. Luciferase activities are given as percent of luciferase activity of WT samples and standard deviations were
calculated from three replicates. (B) Dual luciferase assays as described in (A) were performed co-transfecting the indicated luciferase constructs with
a plasmid encoding the constitutively active form of IKKb(IKK-CA) or empty vector as control (mean6SD, n = 3). One representative out of three
independent experiments is shown.
doi:10.1371/journal.pone.0088318.g003
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 5 February 2014 | Volume 9 | Issue 2 | e88318

sufficient to activate the TSDR. Rather, B cells and macrophages
seem to lack expression of essential signaling mediators or
transcription factors that are required to promote full TSDR
activity. Hence, the dependency on T-cell-specific signaling
pathways may ensure that (stable) Foxp3 expression is permitted
only in T cells.
In recent years numerous studies have focused on the
identification of transcription factors that are involved in the
regulation of Foxp3 gene expression [12]. Among them the NF-kB
family of transcription factors has been shown to be crucial for
Treg development. The NF-kB signaling pathway is considered to
transduce signals emanating from the TCR in order to induce
Foxp3 expression during thymic Treg development [14,32] and
direct binding of NF-kB to the Foxp3 gene locus has frequently
been reported [25,28,29,47]. The aim of this study was to test the
influence of the NF-kB signaling pathway on the enhancer activity
of the TSDR and thus on the maintenance of Foxp3 expression. In
agreement with previous publications [15,28], we observed
efficient nuclear localization of canonical NF-kB subunits upon
T cell stimulation. However, the previously postulated NF-kB
binding site within the TSDR [10] was not transcriptionally
responsive to cell stimulation and NF-kB activation, implying that
NF-kB did not regulate this site. Hence, it remains unclear which
factor binds to and regulates this critical site.
Nonetheless, it was still conceivable that NF-kB was able to bind
to other sites within the TSDR. We therefore assessed the overall
influence of NF-kB signaling on TSDR enhancer activity.
Canonical NF-kB signaling is regarded to be strictly dependent
on IKKb-mediated degradation of IkBa[15]. In this study, by
using mutated versions of these key proteins, we could demon-
strate that complete abrogation of NF-kB signaling did not
considerably impair TSDR enhancer activity. Even though the
lack of IKKbkinase activity slightly weakened TSDR enhancer
activity, the super-repressor did not show any such effect
suggesting that IKKbdid not act via the classical NF-kB pathway.
Instead, cross-reactivity of IKKbto other signaling pathways [48]
might have influenced TSDR enhancer activity. In a similar
experiment, Long et al. showed that upon overexpression of the
super-repressor in Jurkat cells (a human T cell line) TSDR
enhancer activity is significantly reduced [25]. However, in their
experiment the super-repressor also represses activity of the
transcriptionally active Foxp3 promoter. The Foxp3 promoter
construct used in our study does not have transcriptional activity
on its own [10]. For this reason, we believe that in the study by
Long et al. the observed reduction of the TSDR enhancer activity
might be mediated by a compromised activity of the Foxp3
promoter, whereas in our system we primarily examine effects on
the TSDR. This interpretation is in line with the findings that c-
Rel binds to the Foxp3 promoter but not to the TSDR in TGFb-
induced and ex vivo isolated Tregs [29]. In conclusion, the data
presented in this study argue that the classical NF-kB signaling
pathway is not involved in the control of TSDR enhancer activity
but may regulate other regulatory elements of the Foxp3 gene
locus, such as the Foxp3 promoter or the pioneer element [30].
The NF-kB subunit c-Rel has been shown to have the most
drastic impact on Treg development of all NF-kB family members.
c-Rel
2/2
Tregs (the few that do develop in c-Rel
2/2
mice) express
normal levels of Foxp3 (this study and [24,35]) and exhibit normal
Treg transcriptional signature and suppressive capacity [35],
indicating that an essential function of c-Rel emerges in developing
Tregs, but not in mature Tregs. In accordance with this notion, we
here show that c-Rel
2/2
Tregs displayed stable Foxp3 expression
and a demethylated TSDR. Interestingly, c-Rel has the capacity to
induce chromatin remodeling as it has been shown for the Il2 locus
and as it has been proposed for the Foxp3 pioneer element [30,36].
However, our data suggest that in developing Tregs c-Rel is not
involved in TSDR demethylation. So far it is not known whether
c-Rel or any other NF-kB subunit possess the ability to
differentiate between methylated and unmethylated DNA, but as
c-Rel has been detected to occupy the TSDR in Jurkat cells [25]
harboring a fully methylated TSDR (unpublished data), binding of
c-Rel to the TSDR most likely does not require DNA demeth-
ylation.
Viewed as a whole, the data presented in this study suggest that
TSDR enhancer activity and its epigenetic fixation are controlled
in a T cell-specific, but NF-kB-independent manner. The
biological function of NF-kB binding to the TSDR as well as
the identification of signaling pathways that ensure TSDR-
mediated stability of Foxp3 expression remain to be identified.
Materials and Methods
Mice
c-Rel-deficient mice (c-Rel
2/2
) [49], which were kindly
provided by Alexander Visekruna (Institute for Medical Microbi-
ology, Philipps University Marburg), and C57Bl/6 mice were bred
in the animal facility of the Helmholtz Centre for Infection
Research (Braunschweig). All mice were housed and handled
under specific pathogen-free conditions in accordance with good
animal practice as defined by FELASA and the national animal
welfare body GV-SOLAS under supervision of the institutional
animal welfare officer. Non-manipulated mice were euthanized by
CO
2
asphyxiation, and isolation of murine cells has been
performed in compliance with the German animal protection
law (TierSchG BGBI S. 1206; 18.05.2006). Number of animals
used was notified to the Lower Saxony State Office for Consumer
Protection and Food Safety according to the German laboratory
animal reporting act (VersTierMeldV BGBl S. 2156; 04.11.1999).
Figure 4. Degradation of IkBais not required for TSDR
enhancer activity. Luciferase plasmids integrating either the NF-kB-
RE or TSDR-FoxPro were co-transfected with either an empty vector or
with a vector encoding the super-repressor, a non-degradable form of
IkBa, into RLM-11 cells. Dual luciferase assays were performed as
described in Figure 1 and unstimulated cells served as controls.
Luciferase activities are shown as percent of empty vector controls and
standard deviations of performed triplicates are shown. One represen-
tative experiment out of at least two independent experiments is
depicted.
doi:10.1371/journal.pone.0088318.g004
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 6 February 2014 | Volume 9 | Issue 2 | e88318

Cell Lines
The murine CD4
+
T cell lymphoma cell line RLM-11 [50] was
kindly provided by Marc Ehlers (Institute for Systemic Inflamma-
tion Research, Lu¨beck, Germany). RLM-11 cells were cultured in
RPMI 1640 L-Glutamine medium (Invitrogen) supplemented with
10% FCS (Sigma-Aldrich), 50 U/ml penicillin, 50 U/ml strepto-
mycin, 25 mM HEPES, 1 mM sodium pyruvate and 50 mM b-
mercaptoethanol (all Biochrom). For stimulation, cells were treated
with 10 ng/ml PMA and 500 ng/ml ionomycin (both Sigma-
Aldrich). A20 cells [51] were kindly provided by Ingo Schmitz
(HZI, Braunschweig, Germany) and cultured in RPMI 1640 L-
Glutamine supplemented with 10% FCS, 50 U/ml penicillin,
50 U/ml streptomycin and 50 mM b-mercaptoethanol. RAW
264.7 cells [52], which were generously provided by Maximiliano
Gutierrez (HZI, Braunschweig, Germany), were cultured in
Dulbecco’s modified Eagle high glucose medium (Invitrogen)
supplemented with 10% FCS and 2 mM L-Glutamine (Invitro-
gen). All cells were maintained at 37uC in a 5% CO
2
atmosphere.
Primary Cell Sorting and Cell Culture
Single cell suspensions obtained from isolated lymph nodes and
spleens were subjected to surface staining using the according
antibodies (CD4: clone RM4-5, BioLegend; CD62L: clone MEL-
14, eBiosciences; CD25: clone PC61.5, BioLegend; CD8: clone
53-6.7, eBiosciences). Cell sorting was carried out on the BD
FACS Aria II (BD Biosciences) and purity of isolated cell subsets
was generally .97%. For activation and expansion, cells were
placed in cell culture dishes (Nunc) which had been coated with
1mg/ml anti-CD3 (clone 145-2C11, eBiosciences) and 1 mg/ml
anti-CD28 (clone 37.51, eBiosciences) in PBS over night at 4uC.
Cells were seeded in supplemented RPMI 1640 L-Glutamine
medium containing 10 ng/ml (Tconv) or 50 ng/ml (Tregs) IL-2
(R&D Systems).
Plasmids
pGL3 basic, pGL3-Promoter Vector (here referred to as SV40-
Pro) and pGL3-Control Vector (here referred to as SV40Pro-
SV40Enh) were purchased from Promega. The pNF-kB-Luc (here
Figure 5. c-Rel
2/2
Tregs show a stable phenotype. (A) CD4
+
CD25
hi
Tregs and CD4
+
CD25
2
Tconv were isolated from wild-type (WT) or c-Rel
2/2
mice. Genomic DNA was isolated and subjected to bisulfite sequencing in order to determine the methylation status of CpG dinucleotides within the
TSDR. (B) CD4
+
CD8
2
CD62L
hi
CD25
hi
Tregs from spleen and lymph nodes of c-Rel
2/2
or WT mice were sorted and an aliquot was analyzed for Foxp3
expression by flow cytometry (top panel). Cells were cultured in the presence of IL-2 and stimulated by plate-bound a-CD3/CD28 for six days
followed by flow cytometric analysis of Foxp3 expression. Cells depicted were pregated to viable CD4
+
T cells. Results represent one out of two
independent experiments.
doi:10.1371/journal.pone.0088318.g005
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 7 February 2014 | Volume 9 | Issue 2 | e88318

referred to as NF-kB responsive element; Agilent Technologies)
was used to asses NF-kB activity. pGL3-TSDR-SV40 [9] and
pGL3-TSDR-FoxPro, pGL3-FoxPro, pCpGL-EFPro and
pCpGL-TSDR-EFPro [10] have been generated previously.
pCpGL-tandem-EFPro was created by the introduction of five
repetitive CTGGGCCTATCCGGCT sequence elements into
pCpGL-EFPro upstream of the EF promoter (predicted NF-kB
binding site underlined). Expression vectors for IKKa-KD and
IKKb-KD (both carrying D145N mutations) as well as IKK-CA
(also named IKK-EE) were described before [33,53]. The
expression vector for the dominant negative IkBa(super-repressor)
was reported before [34] and was generously provided by Dr.
Maximiliano Gutierrez (HZI, Braunschweig, Germany).
Luciferase Assay
All luciferase assays were performed as ‘‘dual luciferase assays’’
(Promega). 1610
6
RLM-11 cells were transfected with 1 mgof
pGL3 firefly luciferase reporter vector incorporating the gene
elements of interest and 0.2 mg of renilla luciferase vector pRL-
TK, the latter one serving as internal control. Transfections were
carried out in 100 ml transfection solution from the Cell Line
Nucleofector Kit V in the Nucleofector 2b Device (Lonza) using
program A-023. Cells were cultured in 1 ml supplemented RPMI
1640 L-Glutamine medium. After a resting period of 3 hrs, fresh
medium was added to the cultures and cells were stimulated with
10 ng/ml PMA and 500 ng/ml ionomycin. For co-expression of
recombinant proteins, plasmids encoding these proteins were co-
transfected together with the luciferase plasmids. Transfection was
carried out as described above. For each co-expressed recombi-
nant protein, 1 mg expression vector was used. A20 cells were
transfected the same way, with the difference that 2 mg of the
desired firefly luciferase plasmid were transfected using program
L-13. Transfection of RAW 264.7 cells was carried out with 2610
6
cells and 2 mg of pGL3 firefly luciferase reporter vector using
nucleofector program D-032. Cells were cultured in 1.5 ml
supplemented DMEM in a 12-well plate and stimulated the next
day with 40 ng/ml IFN-cand 100 ng/ml LPS (Sigma-Aldrich).
Luciferase activities were measured 2–20 hrs later (RLM-11), 16–
20 hrs later (A20) or 14 hrs later (RAW 264.7) using the Glomax
instrument (Promega). For this, 50 ml of each firefly and renilla
substrate were injected into 40–60 ml out of 100 ml cell lysate.
Luciferase signals of firefly were normalized to the renilla
luciferase signals and standard deviation of performed triplicates
were calculated.
Western Blot
In order to prepare cytoplasmic and nuclear extracts, cells were
fractionized using the NE-PER Nuclear and Cytoplasmic Extrac-
tion Reagents supplemented with Halt Protease Inhibitors and
Halt Phosphatase Inhibitors (Thermo Scientific). Proteins from
extracts were separated by SDS-PAGE (Bio-Rad) and subsequent-
ly transferred to polyvinylidene fluorid membrane (GE Health-
care). Proteins of interest were detected using antibodies against
p105/p50 (Epitomics), p100/p52 (R&D Systems), p65 and c-Rel
as well as lamin B (Santa Cruz Biotechnology) and p44/p42 (Cell
Signaling) in combination with horseradish peroxidase-conjugated
secondary antibodies (Southern Biotechnolgy). Subsequently,
chemiluminescence reactions were performed (ECL136II-system,
Thermo Scientific). Exposed films were scanned and digitized
images were analyzed using the software ImageJ 1.47 [54]. Here,
protein signals were indexed by measuring their relative mean grey
value per area.
Flow Cytometric Analyses
Intracellular Foxp3 staining was carried out using the murine
Foxp3 staining kit (eBiosciences). In order to exclude dead cells,
cells were subjected to the live/dead fixable blue dead cell stain kit
(Invitrogen). Flow cytometric measurements were accomplished
on LSRII (BD Biosciences).
Methylation Analysis by Pyrosequencing
Genomic DNA from cells of interest was obtained using the
NucleoSpin Tissue kit (Macherey-Nagel). Genomic DNA was
subjected to bisulfite conversion using the EZ DNA Methylation
Kit (Zymo Research). The murine TSDR was amplified by PCR
containing 100 ng of bisulfite-converted genomic DNA, HotStar
Taq PCR buffer (Qiagen), 1 U HotStar Taq DNA polymerase,
2.5 mM MgCl2 and 0.38 mM each of TSDR-for
(AAGGGGGTTTTAATATTTATGAGG) and TSDR-rev
(CCTAAACTTAACCAAATTTTTCTACCA) primer in a final
volume of 25 ml (Cycle: 95uC for 15 min; 45695uC for 30 sec,
57uC for 1 min, 72uC for 1 min; 72uC for 7 min). The PCR
product was analyzed by gel electrophoresis. The pyrosequencing
procedure was performed on a Pyromark Q96 ID (Qiagen)
according to the manufacturer’s protocol, including 40 ml of the
PCR product, Pyromark Gold Q96 reagents (Qiagen), Pyromark
buffers (Qiagen), Streptavidin Sepharose (GE Healthcare) and the
sequencing primers TSDR1 (AACCAAATTTTTCTAC-
CATTA), TSDR2 (AAAACAAATAATCTACCCC) or TSDR3
(AATAAACCCAAATAAAATAATATAAAT). The methylation
rate was determined by the Pyromark Q96 software. A rate was
excluded if the quality criteria (Pyromark Q96 standard settings)
failed for that CpG motif. The methylation rate was translated into
a color code as previously described [9].
Supporting Information
Figure S1 Activation of NF-kB family members in
stimulated RLM-11 cells. Films generated by western blotting
described in Figure 2A were digitized by scanning, and specific
antibody-mediated signals were analyzed by ImageJ. Normaliza-
tion of the measured mean grey values per area for the cytoplasmic
and nuclear proteins was achieved by using the p44/42 and
laminB signals, respectively. The resulting relative values were
plotted against the indicated time points after stimulation.
(EPS)
Figure S2 Degradation of IkBais not required for TSDR
enhancer activity during the early phase of stimulation.
Luciferase plasmids integrating either the NF kB RE or TSDR-
FoxPro were co-transfected with either an empty vector (EV) or
with a vector encoding the super-repressor (SR), a non-degradable
form of IkBa, into RLM 11 cells. Cells were harvested 2, 4, 6, 8,
and 10 hours after stimulation with PMA/iono. Dual luciferase
assays were performed and luciferase activities are shown as
percent of the 6 hour empty vector control. Standard deviations of
performed triplicates are shown. One representative out of three
independent experiments is depicted.
(EPS)
Acknowledgments
We thank Drs. Marc Schuster and Aras Toker for technical advice, fruitful
discussions and critically reading the manuscript. We are grateful to
Sieglinde Keilholz-Gast for technical assistance. We thank Dr. Michael
Rehli for provision of the CpG-free luciferase reporter vector, Drs.
Lienhard Schmitz and Stephan Ludwig for various plasmids and Dr.
Lothar Gro¨ be for cell sorting.
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 8 February 2014 | Volume 9 | Issue 2 | e88318

Author Contributions
Conceived and designed the experiments: LS LJ IS JH. Performed the
experiments: LS BP SF CF. Analyzed the data: LS BP SF CF. Contributed
reagents/materials/analysis tools: LS IS JH. Wrote the paper: LS JH.
References
1. Sakaguchi S (2005) Naturally arising Foxp3-expressing CD25
+
CD4
+
regulatory
T cells in immunological tolerance to self and non-self. Nat Immunol 6: 345–
352.
2. Fontenot JD, Rasmussen JP, Williams LM, Dooley JL, Farr AG, et al. (2005)
Regulatory T cell lineage specification by the forkhead transcription factor
foxp3. Immunity 22: 329–341.
3. Gavin MA, Rasmussen JP, Fontenot JD, Vasta V, Manganiello VC, et al. (2007)
Foxp3-dependent programme of regulatory T-cell differentiation. Nature 445:
771–775.
4. Williams LM, Rudensky AY (2007) Maintenance of the Foxp3-dependent
developmental program in mature regulatory T cells requires continued
expression of Foxp3. Nat Immunol 8: 277–284.
5. Leslie M (2011) Immunology. Regulatory T cells get their chance to shine.
Science 332: 1020–1021.
6. Hueh n J, Polansky JK, Hamann A (2009) Epigenetic control of FOXP3
expression: the key to a stable regulatory T-cell lineage? Nat Rev Immunol 9:
83–89.
7. Polansky JK, Kretschmer K, Freyer J, Floess S, Garbe A, et al. (2008) DNA
methylation controls Foxp3 gene expression. Eur J Immunol 38: 1654–1663.
8. Kim HP, Leonard WJ (2007) CREB/ATF-depe ndent T cell receptor-induced
FoxP3 gene expression: a role for DNA methylation. J Exp Med 204: 1543–
1551.
9. Floess S, Freyer J, Siewert C, Baron U, Olek S, et al. (2007) Epigenetic control of
the foxp3 locus in regulatory T cells. PLoS Biol 5: e38.
10. Polansky JK, Schreiber L, Thelemann C, Ludwig L, Kruger M, et al. (2010)
Methylation matters: binding of Ets-1 to the demethylated Foxp3 gene
contributes to the stabilization of Foxp3 expression in regulatory T cells. J Mol
Med (Berl) 88: 1029–1040.
11. Mouly E, Chemin K, Nguyen HV, Chopin M, Mesnard L, et al. (2010) The Ets-
1 transcription factor controls the development and function of natural
regulatory T cells. J Exp Med 207: 2113–2125.
12. Haiqi H, Yong Z, Yi L (2011) Transcri ptional regulation of Foxp3 in regulatory
T cells. Immunobiology 216: 678–685.
13. Hayden MS, Ghosh S (2011) NF-kappaB in immunobiology. Cell Res 21: 223–
244.
14. Hsieh CS (2009) Kickstarting Foxp3 with c-Rel. Immunity 31: 852–853.
15. Hayden MS, Ghosh S (2008) Shared principles in NF-kappaB signaling. Cell
132: 344–362.
16. Schulze-Luehrmann J, Ghosh S (2006) Antigen-receptor signaling to nuclear
factor kappa B. Immunity 25: 701–715.
17. Sun SC (2011) Non-canonical NF-kappaB signaling pathway. Cell Res 21: 71–
85.
18. Schmidt-Supprian M, Tian J, Grant EP, Pasparakis M, Maehr R, et al. (2004)
Differential dependence of CD4
+
CD25
+
regulatory and natural killer-like T cells
on signals leading to NF-kappaB activation. Proc Natl Acad Sci U S A 101:
4566–4571.
19. Medoff BD, Sandall BP, Landry A, Nagahama K, Mizoguchi A, et al. (2009)
Differential requirement for CARMA1 in agonist-selected T-cell development.
Eur J Immunol 39: 78–84.
20. Barnes MJ, Krebs P, Harris N, Eidenschenk C, Gonzalez-Quintial R, et al.
(2009) Commitment to the regulatory T cell lineage requires CARMA1 in the
thymus but not in the periphery. PLoS Biol 7: e51.
21. Deenick EK, Elford AR, Pellegrini M, Hall H, Mak TW, et al. (2010) c-Rel but
not NF-kappaB1 is important for T regulatory cell development. Eur J Immunol
40: 677–681.
22. Molinero LL, Yang J, Gajewski T, Abra ham C, Farrar MA, et al. (2009)
CARMA1 controls an early checkpoint in the thymic development of FoxP3
+
regulatory T cells. J Immunol 182: 6736–6743.
23. Gupta S, Manicassamy S, Vasu C, Kumar A, Shang W, et al. (2008) Differential
requirement of PKC-t heta in the development and function of natural
regulatory T cells. Mol Immunol.
24. Visekruna A, Huber M, Hellhund A, Bothur E, Reinhard K, et al. (2010) c-Rel
is crucial for the induction of Foxp3
+
regulatory CD4
+
T cells but not T(H)17
cells. Eur J Immunol 40: 671–676.
25. Long M, Park SG, Strickland I, Hayden MS, Ghosh S (2009) Nuclear factor-
kappaB modulates regulatory T cell deve lopment by directly regulating
expression of Foxp3 transcription factor. Immunity 31: 921–931.
26. Vang KB, Yang J, Pagan AJ, Li LX, Wang J, et al. (2010) Cutting edge: CD28
and c-Rel-dependent pathways initiate regulatory T cell development.
J Immunol 184: 4074–4077.
27. Guckel E, Frey S, Zaiss MM, Schett G, Ghosh S, et al. (2011) Cell-intrinsic NF-
kappaB activation is critical for the development of natural regulatory T cells in
mice. PLoS One 6: e20003.
28. Schuster M, Glauben R, Plaza-Sirvent C, Schreiber L, Annemann M, et al.
(2012) IkappaB(NS) Protein Mediates Regulatory T Cell Development via
Induction of the Foxp3 Transcription Factor. Immunity 37: 998–1008.
29. Ruan Q, Kameswaran V, Tone Y, Li L, Liou HC, et al. (2009) Development of
Foxp3
+
regulatory t cells is driven by the c-Rel enhanceosome. Immunity 31:
932–940.
30. Zheng Y, Josefowicz S, Chaudhry A, Peng XP, Forbush K, et al. (2010) Role of
conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell
fate. Nature 463: 808–812.
31. Grigoriadis G, Vasanthakumar A, Banerjee A, Grumont R, Overall S, et al.
(2011) c-Rel Controls Multiple Discrete Steps in the Thymic Development of
Foxp3 CD4 Regulatory T Cells. PLoS One 6: e26851.
32. Hori S (2010) c-Rel: a pioneer in directing regulatory T-cell lineage
commitment? Eur J Immunol 40: 664–667.
33. Mercurio F, Zhu H, Murray BW, Shevchenko A, Bennett BL, et al. (1997) IKK-
1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB
activation. Science 278: 860–866.
34. DiDonato J, Mercurio F, Rosette C, Wu-Li J, Suyang H, et al. (1996) Mapping
of the inducible IkappaB phosphorylation sites that signal its ubiquitination and
degradation. Mol Cell Biol 16: 1295–1304.
35. Isomura I, Palmer S, Grumont RJ, Bunting K, Hoyne G, et al. (2009) c-Rel is
required for the development of thymic Foxp3
+
CD4 regulatory T cells. J Exp
Med 206: 3001–3014.
36. Rao S, Gerondakis S, Woltring D, Shannon MF (2003) c-Rel is required for
chromatin remodeling across the IL-2 gene promoter. J Immunol 170: 3724–
3731.
37. Toker A, Huehn J (2011) To be or not to be a Treg cell: lineage decisions
controlled by epigenetic mechanisms. Sci Signal 4: pe4.
38. Toker A, Engelbert D, Garg G, Polansky JK, Floess S, et al. (2013) Active
Demethylation of the Foxp3 Locus Leads to the Generation of Stable
Regulatory T Cells within the Thymus. J Immunol.
39. Baron U, Floess S, Wieczorek G, Baumann K, Grutzkau A, et al. (2007) DNA
demethylation in the human FOXP3 locus discriminates regulatory T cells from
activated FOXP3
+
conventional T cells. Eur J Immunol 37: 2378–2389.
40. Miyao T, Floess S, Setoguchi R, Luche H, Fehling HJ, et al. (2012) Plasticity of
Foxp3
+
T cells reflects promiscuous Foxp3 expression in conventional T cells but
not reprogramming of regulatory T cells. Immunity 36: 262–275.
41. Ohkura N, Hamaguchi M, Morikawa H, Sugimura K, Tanaka A, et al. (2012) T
cell receptor stimulation-induced epigenetic changes and foxp3 expression are
independent and complementary events required for treg cell development.
Immunity 37: 785–799.
42. Josefowicz SZ, Wilson CB, Rudensky AY (2009) Cutting edge: TCR stimulation
is sufficient for induction of Foxp3 expression in the absence of DNA
methyltransferase 1. J Immunol 182: 6648–6652.
43. Zorn E, Nelson EA, Mohseni M, Porcheray F, Kim H, et al. (2006) IL-2
regulates FOXP3 expression in human CD4
+
CD25
+
regulatory T cells through
a STAT-dependent mechanism and induces the expansion of these cells in vivo.
Blood 108: 1571–1579.
44. Vivier E, da Silva AJ, Ackerly M, Levine H, Rudd CE, et al. (1993) Association
of a 70-kDa tyrosine phosphoprotein with the CD16: zeta: gamma complex
expressed in human natural killer cells. Eur J Immunol 23: 1872–1876.
45. Boyman O, Sprent J (2012) The role of interle ukin-2 during homeostasis and
activation of the immune system. Nat Rev Immunol 12: 180–190.
46. Yao Z, Kanno Y, Kerenyi M, Stephens G, Durant L, et al. (2007)
Nonredundant roles for Stat5a/b in directly regulating Foxp3. Blood 109:
4368–4375.
47. Eckerstorfer P, Novy M, Burgstaller-Muehlbacher S, Paster W, Schiller HB, et
al. (2010) Proximal human FOXP3 promoter transactivated by NF-kappaB and
negatively controlled by feedback loop and SP3. Mol Immunol 47: 2094–2102.
48. Oeckinghaus A, Hayden MS, Ghosh S (2011) Crosstalk in NF-kappaB signaling
pathways. Nat Immunol 12: 695–708.
49. Tumang JR, Owyang A, Andjelic S, Jin Z, Hardy RR, et al. (1998) c-Rel is
essential for B lymphocyte survival and cell cycle progression. Eur J Immunol 28:
4299–4312.
50. Ehlers M, Laule-Kilian K, Petter M, Aldrian CJ, Grueter B, et al. (2003)
Morpholino antisense oligonucleotide-mediated gene knockdown during thy-
mocyte development reveals role for Runx3 transcription factor in CD4
silencing during development of CD4
2/
CD8
+
thymocytes. J Immunol 171:
3594–3604.
51. Kim KJ, Kanellopoulos-Langevin C, Merwin RM, Sachs DH, Asofsky R (1979)
Establishment and characterization of BALB/c lymphoma lines with B cell
properties. J Immunol 122: 549–554.
52. Raschke WC, Baird S, Ralph P, Nakoinz I (1978) Functional macrophage cell
lines transformed by Abelson leukemia virus. Cell 15: 261–267.
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 9 February 2014 | Volume 9 | Issue 2 | e88318

53. Flory E, Kunz M, Scheller C, Jassoy C, Stauber R, et al. (2000) Influenza virus-
induced NF-kappaB-dependent gene expression is mediated by overexpression
of viral proteins and involves oxidative radicals and activation of IkappaB kinase.
J Biol Chem 275: 8307–8314.
54. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25
years of image analysis. Nat Methods 9: 671–675.
Transcriptional Control of Foxp3 TSDR
PLOS ONE | www.plosone.org 10 February 2014 | Volume 9 | Issue 2 | e88318