Science topic

rRNA Genes - Science topic

Genes, found in both prokaryotes and eukaryotes, which are transcribed to produce the RNA which is incorporated into RIBOSOMES. Prokaryotic rRNA genes are usually found in OPERONS dispersed throughout the GENOME, whereas eukaryotic rRNA genes are clustered, multicistronic transcriptional units.
Questions related to rRNA Genes
  • asked a question related to rRNA Genes
Question
3 answers
What are the possible genotyping methods for Acinetobacter spp.? In other words, what are the possible interspecies genotyping methods for different Acinetobacter spp.?
I'm not aiming for identification at this point but only for typing isolates into species-specific groups.
One that I know is the amplification of the 16S rRNA genes by PCR followed by RFLP.
Are there other methods with better discriminatory Power?
Relevant answer
Answer
PCR is the most accurate method for molecular characterization.
  • asked a question related to rRNA Genes
Question
4 answers
We are trying to quantify 16S rRNA gene of total bacteria in wastewater samples by using 341f/534r primers in qPCR assay. We got okay standard curves despite the efficiency was unsatisfactory (<85%). However, we got strange amplification curves, low Ct values (2.00) but no melting peaks for all wastewater samples. The gel electrophoresis confirmed no expected amplicons (194 bp) in these samples except smeared bands (Lane 2: standard; Lane 6, 7, 8: wastewater samples). It will be greatly appreciated if somebody can provide us with insightful opinions.
Relevant answer
Answer
you may have post pcr contaminaion of one of your reagents. What does your no template control sample look like? Does it amplufy?
  • asked a question related to rRNA Genes
Question
2 answers
Disposable columns from NucleoSpin® Gel and PCR Clean-up can we able to reuse for 16s rRNA gene without affecting the quality of the product?
Relevant answer
Answer
You can reuse the column for the same sample. But the efficiency of binding and hence extraction will keep declining after subsequent extraction.
  • asked a question related to rRNA Genes
Question
2 answers
To give some background, I was instructed by my supervisor to analyse the relationship between the bacteria using the measurements listed in the title and to see whether they were in the same genus using 16S rRNA, ANI, AF and DDH value measurements. So I have had no problems finding the percentage genus cutoff for the 16S rRNA, but I can't find anything for the ANI, AF and DDH and this is particularly problematic because from my understanding, you can't just rely on 16S rRNA to determine whether they're in a different genus, because the 16S rRNA gene is only one gene and very short and so I would imagine you'd need other measurements to back up the idea that they're in different genera. What would be the best way to go about doing this?
Relevant answer
Answer
You could check out those literatures:
Barco RA, Garrity GM, Scott JJ, et al. A Genus Definition for Bacteria and Archaea Based on a Standard Genome Relatedness Index. Mbio. 2020 Jan;11(1):e02475-19. DOI: 10.1128/mbio.02475-19. PMID: 31937639; PMCID: PMC6960282.
Meehan CJ, Barco RA, Loh YE, Cogneau S, Rigouts L. Reconstituting the genus Mycobacterium. Int J Syst Evol Microbiol. 2021 Sep;71(9):004922. doi: 10.1099/ijsem.0.004922. PMID: 34554081; PMCID: PMC8549266.
However, I still could not find the recommended DDH threshold for genus delineanation. If you have any information, welcome to reply me.
  • asked a question related to rRNA Genes
Question
3 answers
For example, when a 16S rRNA gene sequence is searched against the database by BLAST with the max target sequence being set at 500, the total hits (root/bacteria/etc.) are much higher than 500. How?
Relevant answer
Answer
Unfortunately, it's not a glitch, it's annoying when comparing a sequence against a lot of hits... It wasn't like this few years ago, in my opinion, the web-based BLAST server became less practical these last two years... I don't know why and when I talked about it with the NCBI staff, they advised me to use the command line based BLAST.
  • asked a question related to rRNA Genes
Question
2 answers
Hi dear researchers,
While two organisms sharing ≥97% identical 16S rRNA genes may or may not belong to the same species, so why many researchers using 16S rRNA gene for their studies? For example, the 16S rRNA genes of three Bacillus species (B. anthracis, B.thuringiensis, and B. subtilis) are >99% identical, yet key features of their physiologies differ greatly, which is why they are treated as separate species.
Thank you
Relevant answer
Answer
1). Phasing of 16S gene SNPs has been determined highly similar substitution profiles for closely related taxa, indicating that the profiles provide a robust method for species level taxonomic identification.
2). It may be assume that 99%
sequence similarity is an adequate threshold for clustering sequences originating from the similar genome, differences in SNP profiles, reflecting polymorphisms in one or more 16S gene copies reproducibly reflected differences between strains of the similar species.
3). By several results determined that appropriate handling of high-throughput, full length 16S sequence data has the potential to enable accurate classification of individual organisms at very high taxonomic resolution.
  • asked a question related to rRNA Genes
Question
3 answers
Dear experts,
I want to construct bacterial phylogenetic tree based on 4 house keeping genes (16S rRNA, gyrB, rpoD and rpoB genes).
Is there any online tools where I can upload the my novel bacterial genome sequence and where I can select the above 4 genes to construct phylogenetic tree?
Note that: I have my novel bacterial genome sequence and I know well to construction of phylogenic tree (NJ, ML etc) using 16s rRNA gene. And also I can construct MLSA tree using whole genome sequence.
I want suggestions or link from expert to construct bacterial phylogenetic tree based on 4 house keeping genes (16S rRNA, gyrB, rpoD and rpoB genes).
Thanks in advance.
Relevant answer
Answer
It really depends on what genus of bacteria you are working with, and what level of phylogenetic resolution you want. Some bacteria such as Shigella, Escherichia, Salmonella have been extensively studied down to individual clonal outbreak lineages, while other bacteria are mostly represented by uncultured environmental samples with no information about them. The rules for taxonomy and nomenclature of bacteria are also sometimes seemingly confusing. For one example a bacteria that produces botulinum toxin and is isolated and characterized after killing one or more humans will be named as "Clostridium botulinum" while the very same bacteria found in the environment or after killing a duck or any other non-human vertebrate could be named "Clostridium butyricum" or "Clostridium sporogenes".
  • asked a question related to rRNA Genes
Question
2 answers
sequence upload in the NCBI
Relevant answer
Answer
thanks for u r suggestion
  • asked a question related to rRNA Genes
Question
2 answers
I want to make a phylo tree using the 16S rRNA gene of the complete Aeromonas hydrophila genomes/strains available from GenBank. But each genome has several 16S rRNA genes (as many as 10) and they may have different sequences.
Do I just select one and omit the rest? Do them one by one (but takes a lot of time as there are many existing genomes)?
Relevant answer
Answer
Kenneth Joseph Chan Bureros Just try to cluster all sequences from the same organism at 100% identity using cd-hit. If all sequences are identical or <1% distance or any negligible distance then you don't have to worry and you can pick any one sequence.
The fact that Ajay Saini mentioned is true and 16S rRNA being very conserved in the same organism will always differ more than in other organisms. Hence, after picking anyone sequence and doing Multiple Sequence Alignment, you will observe some of the nucleotide positions you have to clean.
So in my experience, it doesn't make any huge difference in the final phylogenetic tree. You can always try with different sequences and play to choose the final sequences and tree.
  • asked a question related to rRNA Genes
Question
3 answers
References or manuals list to analyze 16S rRNA rumen bacteria data
Relevant answer
Answer
Mohamed Tarek Badr
Timur Yergaliyev , Thank you so much!!!
  • asked a question related to rRNA Genes
Question
1 answer
Would appreciate any advice/suggestions on the following task:
The sample was Illumina NGS sequenced for 16S amplicon and by WGS approach (I have fastq files for both). From 16S amplicon data, I have 400 nuc piece of 16S rRNA gene of bacteria which need to be analyzed by qPCR from the original sample. In the original sample these OTU is quite abundant - 15-20%. It would be nice to have a sequence of the whole 16S rRNA gene to be able to design several specific qPCR primers.
What could be the best strategy/software (is it possible at all?) to extract/re-construct the sequence information of the whole 16S rRNA gene from fastq files of WGS data? Any comments on a strategy of opening the fastq file in notepad and trying to do alignment and assembling starting from the known 400 nuc piece?
Relevant answer
Answer
For WGS, assemble and annotate. Annotation will easily give you your gene. If not, you can use assembly with blast to get your gene.
  • asked a question related to rRNA Genes
Question
2 answers
Many research articles have removed the 3rd codon positions in PCGs and rRNA genes for the Phylogenetic tree construction.
Relevant answer
Answer
The 3rd position of a codon, also called the wobble position can vary quite a lot. A nucleotide in this position can have many types of non Watson-Crick base pairing. In phylogenetics the removal or coding of this position is employed to reduce compositional heterogeneity, as it can drasticallly change the trees obtained.
Read about it over here:
Yang H, Li T, Dang K, Bu W. Compositional and mutational rate heterogeneity in mitochondrial genomes and its effect on the phylogenetic inferences of Cimicomorpha (Hemiptera: Heteroptera). BMC Genomics. 2018;19(1):264. Published 2018 Apr 18. doi:10.1186/s12864-018-4650-9
Breinholt JW, Kawahara AY. Phylotranscriptomics: saturated third codon positions radically influence the estimation of trees based on next-gen data. Genome Biol Evol. 2013;5(11):2082-92. doi: 10.1093/gbe/evt157. PMID: 24148944; PMCID: PMC3845638.
  • asked a question related to rRNA Genes
Question
5 answers
I'm optimising a protocol for coral mucus sampling and DNA extraction for 16S rRNA gene sequencing. There are many different methods described in papers, mainly by syringes or swabs and different extraction kits being used. Which method minimizes coral tissue contamination and gives the highest DNA yield?
Relevant answer
Answer
Hello Alessandra
The method depends on the coral species you want to sample. In general, you can extract liquid mucus from the Acropora colonies by exposing it in air for some time. In this method, small branches of the colonies will be collected and exposed to air. The mucus secreted for the first five minutes will be washed off with filter-sterilized seawater. The mucus secreted thereafter will be collected by inverting the branches into the sterile tubes. After collection, the branches can be planted back in the reef. This is one of the less destructive ways of sampling. However, this method will not work in the case of boulder-type coral like Porites. These corals secrete mucus as sheets that can be collected underwater using syringes without needles. Contamination with seawater is unavoidable. Therefore you have to collect seawater from the sampling location and sequence it to identify the contaminants
  • asked a question related to rRNA Genes
Question
4 answers
I am doing 16S rRNA gene sequencing on the Illumina MiSeq platform. In several papers, I found that they have targeted different variable regions for this purpose. Although there might not be a concrete answer to this, I want to make sure that I target the best variable region during 16s library preparation. In this case, I am positive about targeting variable region V3-V4. Does anyone have a good suggestion regarding this? Help will be appreciated. Thank you!
Relevant answer
Answer
Thank you Dr. Timur Yergaliyev for your suggestion. I am doing PE300 for sequencing.
  • asked a question related to rRNA Genes
Question
6 answers
Dear experts,
I want to extract a bacterial complete 16S rRNA gene sequence from WGS (Whole-genome sequence). I have a bacterial WGS (FASTA file=assembled scaffold's FASTA) with 6857405 bp that was divided into 22 Scaffolds.
Can you suggest to me that how can I easily know/extract the complete 16S rRNA gene sequence from WGS ? Is there any software or online tools?
Thank you so much.
Relevant answer
Answer
  • asked a question related to rRNA Genes
Question
2 answers
I am designing a PCR to detect the presence of Proteus vulgaris. Unfortunately, all the literature I have come across use either the 16S rRNA gene or the 16S-23S ITS. Does anyone know of a virulent or structural gene specific only to Proteus vulgaris?
Relevant answer
Answer
Hi Jonas Boateng I would like to know which species-specific gene did you choose to target Proteus vulgaris.
Mohamed Mahrous Amer I would like to read the paper you mention: ''Zh Mikrobiol Epidemiol Immunobiol. 2005 May-Jun;(3):33-9.
[Species-specific detection of Proteus vulgaris and Proteus mirabilis by the polymerase chain reaction].'' Could you send to me the full article?
Thanks in advanced, best regards.
María
  • asked a question related to rRNA Genes
Question
12 answers
Based on 16S rRNA gene sequencing
Relevant answer
Answer
Go for MEGA
You can find a comprehensive list of phylogenetics software here https://wiki2.org/en/List_of_phylogenetics_software
  • asked a question related to rRNA Genes
Question
3 answers
i am looking for the name and sequence of the best one
Relevant answer
Answer
Here is the primer BGI tech used in 16s/18s/ITS amplicon sequencing. Hope helpful.http://www.bgitechsolutions.com/sequencing/32
  • asked a question related to rRNA Genes
Question
4 answers
What would be the cause of a smeared bacterial 16s rRNA band?
I add 3ul of DNA in the PCR reaction.
I load 5ul of the PCR reaction and 2ul of the losing dye into gel electrophoresis .
1 % gel 100 V for 60 minutes 1kb ladder.
Relevant answer
Answer
Read this Article, it's ganna helpful for you
  • asked a question related to rRNA Genes
Question
4 answers
If I have the genomic sequence of a bacterium and know the region where a 16S ribosomal RNA gene is located, How do I determine 5' and 3' ends of the 16S ribosomal RNA gene?  Or, how do I figure out the 16S rRNA sequence from this gene?
Relevant answer
Answer
Hello Nanfei. There is a conserved hairpin nearby the 3' end of the 16S ribosomal RNA that recruits an RNAse. The RNAse cuts downstream of the hairpin as part of the "processing" of the rRNA. The resulting 16S rRNA has a new 3' end that almost always ends in ACCTCCTTA (most gram negative bacteria) or ACCTCCTTT (most gram positive bacteria).
As part of our RBS Calculator model, we automatically identify the hairpin and calculate where the RNAse cleaves to determine the processed 3' end of the 16S rRNA across many bacterial species.
Hope that helps.
  • asked a question related to rRNA Genes
Question
6 answers
I got the Illumina paired-end 16S sequences results. I tried to analysis them with QIIME2, but unfortunately, I found myself stuck many times. Can anyone help me,and how much will it cost? Please inbox me
Relevant answer
Answer
Thank very much for your help, it is highly appreciated
جزاكم الله خيرا و ان شاء الله نتعاون مستقبلا
  • asked a question related to rRNA Genes
Question
10 answers
Hello Everyone,
I have whole genome sequence of bacteria (which I want to prove as a novel spp. and 99% novel). I want to extract the 16s rRNA gene sequence from it digitally. What is the easiest method to do that?
P.S:In the past, I did you Truebac app from Ezbiocloud and it was pretty easy but I guess, they do not allow more than two genomes to evaluate freely? (Perhaps, i need to pay after analzing two new genomes)? In short, I am not able to use Trueback to analyze another new genome.
Best regards,
Timsy
Relevant answer
Answer
Maybe my answer is very late, but for other student, i used a very easy method at Ezbiocloud I used the tool ContEst16S, it can help to extract 16s fragments.
  • asked a question related to rRNA Genes
Question
4 answers
Exists a lof of variable region on reseaches.
Relevant answer
Answer
Maria Jara Montibeller and
Shan Thomas
The use of variable region V3-V4 in 16S rRNA gene is mostly preferred in microbial community analysis, however, the reasons supporting this region in the previous answer are not correct.
"..and have a vast database compared to other regions."
>> Not correct! Databases are not region-specific and it has nothing to do with variable regions. Reference databases are based on full 16S sequences.
"Also, the region does not have any effect on your sequencing technique."
>> Not correct! It is also not because of the sequencing technique or technology. However, is due to the target you want to capture.
"The selected region affects your post sequencing data analysis."
>> Not correct! Data processing or analysis has nothing to do with which region you are targetting.
Most of the pipelines support v3-v4 region and it allows you to assign accurate taxonomy for your sequences.
>> Not correct! Sequence analysis pipelines are region independent.
The main reason why most of the studies are based on V3-V4 region is because of the heterogeneity of the region and low evolution as compared to other hypervariable regions which can help in better identification of the organism (not always true, however). V3-V4 region also has its own limitations and can not always resolve the sequence identity at the species level, therefore generally used at genus level classifications.
Additionally, this region is not universal and it may be possible that it cannot target a community you might be interested in. In stool samples, surely a lot of organisms will not be targetted by V3-V4 specific primers. So, you have to use any other region or design your own primers which can use some other regions of 16S sequence, any from region 1-9.
And as the data processing and databases are independent of which sequence region you are using it would make no difference in your analysis. The reason why databases have a major proportion of 16S sequence submitted from V3-V4 region is just because they are produced by V3-V4 region primers (most commonly used primers in microbial community analysis), and not because of software, data-processing or database specificity.
  • asked a question related to rRNA Genes
Question
3 answers
Hi,
I am confused with NADs (Nucleolus associated chromatin domains) and NORs (Nucleolus organizer regions). NOR contain multiple copies of ribosomal RNA genes (rDNA) around which nucleoli form. They are located on the short arms of the acrocentric chromosomes (13, 14, 15, 21 and 22 in humans). These regions code for 5.8S, 18S, and 28S ribosomal RNA. NADs are primarily genomic regions with heterochromatic signatures and include transposable elements (TEs), sub-telomeric regions, and mostly inactive protein-coding genes. if you see the figure 3 of this paper "Genome organization in and around the nucleolus" or in this linkhttp://www.ur.de/laengst/anemeth.html The NADs found in all chromosome but NOR found only in acrocentric chromosome. Overall nucleolus is the site of rRNA gene transcription, rRNA processing, and ribosome biogenesis. So my doubt is nucleolus forms due to NOR regions basically acrocentric chromosome then how NAD associated with all chromosome? Also, does anyone know the gtf file of chromosome position of NOR and NAD? Thanks.
Relevant answer
Nice Dear Ankit Agrawal
  • asked a question related to rRNA Genes
Question
1 answer
Hi all,
Please I will like to know the hypervariable region of bacteria gene that will reveal abundant taxonomic composition from metagenomic DNA.
Relevant answer
Answer
Dear Tosin,
The answer to your question depends on which sequencing technology you are going to use. For Illumina MiSeq 2 x 300 cycles kit, I would recommend V3-4 (e.g. B357f-B786r pair), for HiSeq 2 x 150 cycles, this would be V4 alone. For other technologies, such as PacBio or OxfordNanonpore whole 16S sequence could and should be used.
I can refer you to my review paper:
It's free access, so there shouldn't be any problems with download, but in case you can't download the paper, don't hesitate to request full text via RG.
Best regards,
Marcin
  • asked a question related to rRNA Genes
Question
7 answers
Hi all,
I'd like to ask for advices on how to combine the results from two different variables of 16S rRNA (V3 and V6, respectively) of human gut microbiome sequences. Would you combine their raw fastq reads and process them (I'm using LotuS here), or would you process them separately and then merge their taxonomic results together?
I've searched a lot and found only this paper ( ) that is focusing on merging multiple 16S variables, but I failed to run it's software. So I'm looking for other way to do this. Could anyone please suggest me or provide me any references on how people combine different variables of 16S rRNA data? Thank you in advance!
Relevant answer
Answer
You can try using the software you proposed, but you are going to have a strong bias due to the use of a reference database to "merge" the 2 amplified regions.
Using the both fastq datasets for data analysis makes not sense because you are going to have the double amount of samples (XX_V3 and XX_V6), maybe some problems along data analysis, and finally the same results that perform the analysis independently.
If you check a bite more the paper you proposed, although it has many citations almost nobody has employed this software... really I don't know the reason but I can imagine why.
You can see an example of use several regions here ( ). The other option is perform long metabarcoding sequencing, by PacBio or Nanopore, but if you have done Illumina you have data to work with and present good results.
  • asked a question related to rRNA Genes
Question
3 answers
18S rRNA gene has high level of amplification in candida genome (from 20 to 180 copy number) 
is there any database who can approximate an average number?
Relevant answer
Answer
Hello Everyone, Does anyone know how many gene copies of ITS (ITS86-ITS2) exist in the Candida albicans genome?
I tried to find but couldn't get a proper answer. Candida Genome Database. http://www.candidagenome.org/ says C. albicans carries 55 copies of 18S rDNA and no information about ITS. I assume that each 18S carries one copy ITS, which means 55 copies of ITS too. Does anyone have a better answer or explanation?
Thanks,
  • asked a question related to rRNA Genes
Question
22 answers
I was trying to amplify 16S rRNA gene of my Lactic acid bacteria (LAB) isolates. However, some commonly used primers failed to amplify some of my LAB isolates. Can anybody suggest the best primer pair for this purpose?
Relevant answer
Answer
Do not you think the suggestion
27F (5’-AGAGTTTGATCCTGGCTCAG-3’)
1492R (5’-GGTTACCTTGTTACGACTT-3’)
is too longer? Have you got any a solid reason?
Thanks
  • asked a question related to rRNA Genes
Question
6 answers
At the current moment I've come across 2 studies: Castelino et al. 2017 and Parnell et al. 2017 who compared different regions regarding amplification of low biomass samples and the comparison with negative controls (Parnell). Perhaps anyone could suggest any other study covering this topic?
Relevant answer
Answer
Muhammad Arslan: Yes, the exact question is not clearly understood
  • asked a question related to rRNA Genes
Question
5 answers
Hello, everyone. At present, I plan to study the diversity and environmental distribution of bacteria belonged to the same order. Therefore, I am eager for someone to show me how to design a pair primers (16S rRNA gene or housekeeping gene) for specific amplification of bacteria within the same order.
I am looking forward to receiving the kind replys, no matter to the detailed protocal, the similar researches or references.
Best wishes.
Relevant answer
Answer
Yang Liu for example you want to amplify the tubulin gene. You research all the sequences deposed on NCBI about tubulin of your organism. You make the alignment of all sequence and you draw the primer on the part of sequence is in common. And at the end, you blast the sequence of your primer versus all the sequence in NCBI and yiu check the specificity of your primer.
  • asked a question related to rRNA Genes
Question
5 answers
I am working on a project aimed to determine the influence of long-term fertilization on soil microbial communities.  I am sampling both the rhizosphere and the bulk soil and hope to use the current best choice of primers for targeting bacterial and archaeal 16S rRNA genes. Initially I planned to use the primer pair 341F/785R, which targets the V3-V4 region of 16S and is reported to have good domain coverage for both bacteria and archaea. However, I now also have the option to use separate, archaea (956F/1401R)- or bacteria (969F/1406R) -specific primers, which target the V6-V8 region of 16S. The benefits of the separate primers are better coverage for archaea, and less eukaryotic sequence contamination, but the V3-V4 primers are the standard tool typically used in similar research. I am confused with which set should I proceed with or if there are any other primer sets I should be considering?
Relevant answer
Answer
Thanks all for your comments. Haitao Wang I agree with your suggestion but I guess the 515F/806R are shown to be biased against both the Crenarchaeota/Thaumarchaeota (https://msystems.asm.org/content/1/1/e00009-15) so after going through some articles I found that the V4-V5 primers 515F/926R performs well and can reduce bias and can detect more environmentally important taxa including archaea. I just posted here as I thought it might be helpful.
Best,
Sandipan
  • asked a question related to rRNA Genes
Question
1 answer
What dna extraction kit do I need to use for fecal sample to prepare them for a Swift Amplicon 16s +ITS panel? The panel provides a primer pool for 16S rRNA genes (V1-V9) and the Fungal ITS1 and ITS 2 genes.
Relevant answer
Answer
Does not matter as long as you are doing an amplicon based sequencing.
  • asked a question related to rRNA Genes
Question
3 answers
When amplifying the 16s rRNA gene and differentiating between species.
Relevant answer
Answer
Abhijeet Singh
Regarding the answer to such kind of questions, I would first look at the impact factor of the journal which almost reflect the level of such journals which are being thorough in terms of serious reviewing and therefore validation of their methodology and results
  • asked a question related to rRNA Genes
Question
2 answers
Hello, I want to construct 16s rRNA gene phylogentic tree. I have retrieved the similar sequences from NCBI and alligend that sequences through clustalx . I have installed Paup4 to my PC what should I do know to construct a tree with bootstrap values and also how will I save that tree?
Relevant answer
Answer
Abhijeet Singh Thank you
  • asked a question related to rRNA Genes
Question
5 answers
I have downloaded a sequence of 16S rRNA gene of Staphylococcus aureus from online database SILVA (https://www.arb-silva.de). While the DNA sequence of any gene is supposed to have 'Ts' instead of 'Us' the sequence of 16S rRNA gene is showing Us instead of Ts. I am not able to figure this out. Can someone please guide?
Relevant answer
Answer
For example, the attached pic is the same case, the left part is from silva and right part is from the silva reference to ENA. In silva this and most of the entries are enlisted as RNA molecule.
  • asked a question related to rRNA Genes
Question
5 answers
Dear everyone, 
I need to perform this real time PCR in order to obtain an estimation of total bacteria in my samples by amplifying the 16s rRNA gene of each microrganism. The problem is that my melting curve looks as you can see, very steep with sharp and matching peaks for replicates but the amplification in my samples is noisy and with chunky peaks. The samples consists of DNA coming from wastewater microorganisms. The point is, how can i improve the preparation or conditions to have more reliable data? Do you have any experience in the field of qPCR with 16s of bacteria?
Relevant answer
Saverio Conti Hello, I appreciate if you could share how you solved the problem.
I have the same problem now. It seems for 16S, the NTC amplification normally happens. but my unknown samples don't show significant and sharp peak in melting curve!
  • asked a question related to rRNA Genes
Question
4 answers
I was asked to provide the 16S rRNA gene primer's name.
I designed the primer for 16S rRNA gene with these details.
926F and 1392R primer Pair
I googled its name but I did not catch anything.
Please share your opinion!
Relevant answer
Answer
Thanks for reply. Yeah it is universal primer.
Sometimes I heard come people say V3 V4 variable region 3 and variable region 4, respectively. Or maybe the primers have special name! I looked it up I did not fine any answer.
Abhijeet Singh yes, it is widely used! but I used stagger + barcode when I chose the primer sets and designed in terms of primer dimer and self-complementary that's why I said 'I designed'. Anyway, thanks for the reply!
  • asked a question related to rRNA Genes
Question
5 answers
Hi, I am doubtful about quality of 16s rRNA reverse sequence. I want to know how to confirm sequence quality. Please find attached file below to ascertain whether it is good enough or not.
Relevant answer
Answer
Asim Zahoor Abbasi I suggest you to request the company to make a new sequencing run, they might have saved the samples, if it is not a long time ago. Such sequencing is too bad to be used.
  • asked a question related to rRNA Genes
Question
6 answers
We would like to study the microalgae diversity in environmental samples (being mostly constituted by microalgae) using culture-independent studies: a first approach using DGGE followed by NGS, Illumina. Which would be the most specific primers for microalgae amplification from environmental samples?
In several studies, 18S rRNA gene is the target for the study of microbial eukariotic diversity for both DGGE and NGS. The primers Euk1A and Euk 516r (Diez et al 2001) are used in several recent studies. Also the primer pair 3NDF (5′-GGCAAGTCTGGTGCCAG-3′)/V4_euk_R2 (5′-ACGGTATCT(AG)ATC(AG)TCTTCG-3′).
For cyanobacteria the primers described in the literature are Cya-b-F37/Cya-R783 and
GC-CYA353f/CYA781rA (Zwart et al 2005; Nubel et al. 1997) but always with simultaneous amplification of bacteria and plastid DNA.
Which primers you recommend for this type of experiments?
Thanks in advance!
Relevant answer
Answer
an interesting paper from an old colleague-scientist with regards the DGGE assays.
  • Eland LE, Davenport RJ, Mota CR. Evaluation of DNA extraction methods for freshwater eukaryotic microalgae. Water Research 2012, 46(16), 5355-5364.
  • asked a question related to rRNA Genes
Question
4 answers
Dear all,
My questions concern the Silva and Greengenes databases to assign taxonomy in 16S rRNA gene sequencing studies. I recognize that each database has its merits and drawbacks and as such I am evaluating which of these two databases is best suited for my data. Therefore, I used both to assign taxonomy and analyzed for which percentage of reads each database was unable to assign taxonomy to each of the taxonomic ranks (from domain to species). In other words, for Greengenes, I counted the blank cells at the domain, phylum, class, etc. rank. For Silva, I counted not only the blank cells, but also cells containing any of the following: ambiguous taxa, uncultured bacterium, and uncultured. The output yielded the following, which includes the absolute number of unassigned cells as well as their respective relative proportions:
Rank | Silva_absolute_unassigned | gg_absolute_unassigned
Domain | 0 | 0
Phylum | 446 | 447
Class | 936 | 682
Order | 2637 | 1778
Family | 4398 | 7969
Genus | 10573 | 14200
Species | 18044 | 17734
Rank | Silva_relative_unassigned | gg_relative_unassigned
Domain | 0.000000 | 0.000000
Phylum | 2.460282 | 2.467160
Class | 5.163283 | 3.764212
Order | 14.546558 | 9.813445
Family | 24.260812 | 43.983883
Genus | 58.324139 | 78.375097
Species | 99.536628 | 97.880561
Here, Silva and Greengenes assigned similar proportions of features at the phylum level (note that domain is 0 because I filtered the reads to obtain bacteria only), then Greengenes assigned more for the class and order ranks, after which Silva assigned a greater proportion of features at the family and genus ranks. Since Silva does not curate its database to include the species level, it makes sense why Greengenes assigned more features here. Has anyone else observed this pattern that Greengenes assigns more features than Silva at the class and order ranks? This seems somewhat counterintuitive considering that Silva is the larger of the two databases.
I have looked into the publication SILVA, RDP, Greengenes, NCBI and OTT — how do these taxonomies compare? by Monika Balvočiūtė and Daniel Huson (2017) for answers and noticed that in the Venn diagrams depicted in Figure 3, the amount of unique taxa in the Greengenes database increases until the order rank and begins to decrease from family onwards, mirroring my observations. However, I am not sure if there is a concrete reason for this similarity or if I'm seeing this pattern simply because I am searching for an answer. So, in short, my questions are: Why does Greengenes assign more features at the class and order ranks than Silva? Based on the table provided, which database is better suited for my analysis?
Many thanks in advance!
Gloria
Relevant answer
Answer
Small and simple answer to a big question - Do not use Greengenes as it is discontinued and not been updated since many years, also there are several mistakes in the taxonomy (> 20 %) which is even more than the mistakes in Silva or RDP (15-20 %). With your description it feels like you have an inclination towards GG which is not so good indication towards your results.
- Further, if you want to know why GG assigned more reads, but this is not a good criteria to judge. Higher percentage assigning is not an indication of accuracy of assignment.
- Indeed Silva has a species level formatted database, but it is not suggested to use because 16S is not a good marker for species level identification. Thus comparing Silva or GG at species level is practicallynot accurate.
  • asked a question related to rRNA Genes
Question
4 answers
I need step by step guidance on how to analyse 16s rRNA gene. I received sequencing results containing Forward and Reverse primers along with a chromatogram file.
Relevant answer
Answer
Jaroslaw Krol Thanks for guiding
  • asked a question related to rRNA Genes
Question
2 answers
I need the primer sequence for reverse transcription of 18S rRNA gene, to be used as internal standard while working with plants.
Relevant answer
Answer
18s rRNA-F GCTTAATTTGACTCAACACGGGA
18s rRNA-R AGCTATCAATCTGTCAATCCTGTC
  • asked a question related to rRNA Genes
Question
8 answers
like a general threshold of 97 or 99 percent at species level, or 90% at genus level, although there are exceptions. Hence there will be some percentage that will be shared by every bacterial species . I need to know that, thank You very much in advance.
Relevant answer
Answer
Kingdom - 61.39, Phylum - 69.30, Class - 75.39, Order - 83.40, Family - 90.95, Genus - 93.07, Species - 98.62 and Strain - 99.59.
  • asked a question related to rRNA Genes
Question
6 answers
rRNA and genes that encode RNA proteins, although highly conserved, are used for phylogenetic analysis of distant species. Why is tRNA not recommended for determining phylogenetic relationships?
Relevant answer
Answer
We commonly use tRNAs in mitochondrial phylogenomic studies. Of course, not individually, but as a part of the entire concatenated dataset. Especially in taxa where the architecture is highly conserved, as it is really easy to "pair" them.
Things get a bit complicated when there are duplications and/or missing genes, but a part of the tRNA dataset can be used even in such cases.
In some cases they can improve the phylogenetic resolution. If I remember correctly, Cameron found it to be the case in insects.
Here are examples of papers where all mitochondrial RNA genes were used:
And this is an example of a situation where there are duplicated missing genes:
  • asked a question related to rRNA Genes
Question
5 answers
Hi! I am trying to build a phylogeny using a mixture of mitochondrial and nuclear protein-coding genes and rRNA genes. Is it possible to specify the specific type of gene in the partition file? I am using RAxML through the CIPRES portal to create the phylogeny. Many thanks in advance!
Relevant answer
Answer
nope, first you should use e.g. jmodeltest (or other) to find the best-fit model for each partition and this can be added to the partition file (in MrBayes it looks like something so
charset COI = 1-658; charset 16S = 659-1184; charset ITS = 1185-1807; partition favored= 3: COI, 16S, ITS; set partition=favored; Prset statefreqpr=dirichlet(1,1,1,1); Lset applyto=(1) nst=6 rates=invgamma; Lset applyto=(2) nst=6 rates=invgamma; Lset applyto=(3) nst=6 rates=gamma;
  • asked a question related to rRNA Genes
Question
2 answers
The universal 16S rRNA gene and universal 16S rRNA primers are admittedly used to identify both bacteria and archaea domains at the same time. I would like to learn more about its feature, and compare bacterial and archaeal 16S rRNA genes each other as well as their application in molecular level. It is actually required papers or book to reach my answer.
The best
Relevant answer
Answer
You can find more information in the following article:
  • asked a question related to rRNA Genes
Question
3 answers
I am working with qPCR on Lactobacillus plantarum WCFS1 and there is a high expression level of 16S rRNA gene comparing to the other genes. Therefore, I am looking for the other housekeeping genes that have lower expression level. If anyone knows, please tell me. Thank you very much!
Relevant answer
Answer
Hua Xiao Thank you for your information.
  • asked a question related to rRNA Genes
Question
3 answers
I work on Vitek 2 Compact System for identification of bacterial isolates and PCR technique using 16S rRNA gene ... but the results are mismatched... can any one tell me why
Relevant answer
Answer
It makes sense if you see the differences in results. 16s is not always an excellent technique for the identification at species level. And the results can differ a lot on the basis of sample prep and sequence data processing. There are been several studies which compared both methods and found vitek outperforms 16s sequencing. Find attachment
  • asked a question related to rRNA Genes
Question
2 answers
What is the significance of a high A-T content in rRNA genes of the Cryptosporidium parasite?
Relevant answer
Answer
Maybe this paper is useful:
Sci Rep. 2015; 5: 16324. Published online 2015 Nov 9.
Revisiting the reference genomes of human pathogenic Cryptosporidium species: reannotation of C. parvum Iowa and a new C. hominis reference
Juan P. Isaza et al.
  • asked a question related to rRNA Genes
Question
5 answers
I intend to use illumina 2 X 150 bp sequencing kit to sequence the V4 region of 16s rRNA gene. The DNA samples are from different soils. I was wondering what is the recommended sequencing depth per sample.
Relevant answer
Answer
Thanks Christian.
  • asked a question related to rRNA Genes
Question
12 answers
Hello,
Greetings.I am aware of tools like Vikodak, PiCrust,Tax4Fun etc for prediction of functional potential from 16S rRNA genes of bacterial communities.In my current study, I also checked for fungal community structure and diversity targeting internal transcribed spacer (ITS) region using ITS3 and ITS4 primer combination.
So, I am interested to know is there any similar tool for analyzing functional potential for Fungi?
Looking forward for some suggestions.
Thanks,
Sandipan
Relevant answer
Answer
In addition to what Tyler Bourret pointed out, there is an increasing body of literature that the ITS region(s) vary in their utility for identification of a large number of fungi (see some of the previous discussions elsewhere on ResearchGate such as https://www.researchgate.net/post/What_primer_sets_are_good_for_fungal_community_profiling_by_pyrosequencing) and that multilocus methods are much better for many important and diverse groups of fungi (e.g. http://www.westerdijkinstitute.nl/fusarium/). In addition, there are numerous errors in the identifications and classifications associated with ITS in some of the major databases (e.g. DOI 10.1007/s13225-014-0291-8, doi.org/10.1101/288654, etc.) as well as database biases (e.g. http://geoffreyzahn.com/limitations-of-the-unite-fungal-database/). These types of complications and errors make assigning a functional prediction based on ITS difficult and such assignments questionable.
  • asked a question related to rRNA Genes
Question
6 answers
I am very much interested for illumina sequencing of 16S rRNA gene of gut microbiota.
Relevant answer
Answer
Illumina sequencing requires costly enzymes and technology in order to sequence via PCR chemistry.
There is a newer NGS platform that is extremely cheap in comparison. Nanopore sequencing by Oxford Nanopore Technologies is a great option, especially for 16S sequencing. Look into the MinION for a cheap option. They even offer quick analysis tools post-sequencing to help with data analysis of metagenomic samples.
Hope this helps!
  • asked a question related to rRNA Genes
Question
4 answers
NGS for Gut Microbiotal Analysis
Relevant answer
Answer
Center for Microbial Systems at the University of Michigan
  • asked a question related to rRNA Genes
Question
5 answers
Does using High fidelity polymerase helps in the amplification of 16S rRNA gene from the total community DNA (sediment, water) if the normal Taq polymerase don't work ?
  • asked a question related to rRNA Genes
Question
2 answers
Best software for amplicon seq data analysis for malaria parasite. Edit
I know that there are many software (QIIME,mothur, and others )  to analysis amplicon sequence data for microbial (SPECIALLY FOR BACTERIA). I am currently doing amplicon sequencing using 200 loci specific primers for malaria parasites (Vivax). 200 primers were designed for each locus and multiplex at least 10 primers in primary PCR. I,e a total of 20 PCR reactions. 2nd secondary PCR was done to add sample specific barcodes and Illumina index primers for library preparations and sequenced using  MiSeq Illumina. So what would be the best software to analyze this data for detecting different malaria parasite clones from different patients and downstream Population genetics analysis. Can I use QIIME or mothur for my data analysis assuming different parasite clones as OTU???
Best regards,
Abe
  • asked a question related to rRNA Genes
Question
3 answers
And if so, to what?
Relevant answer
Answer
It is recommended. At the least, ensure that the DNA concentrations of your samples are similar so that all samples have similar template complexity and the PCR conditions (primer concentration and cycle number) are appropriate for all samples. You want to avoid samples having very low DNA template amount/diversity and experiencing a jackpot event during PCR.
  • asked a question related to rRNA Genes
Question
3 answers
I am limited on funds so a kit is out. I need to extract gDNA from pure culture GN rod bacteria that is clean and not sheared. I am trying to PCR up the 16S rRNA gene and potential toxin genes as well.
Everything I have tried to date will extract the gDNA but none of my PCRs will work. My positive control gDNA is working fine so nothing is wrong with my primers, buffers, Taq, or thermocycling conditions.
Thanks in advance!
Relevant answer
Answer
Hello,, Use lysis buffer for DNA extraction it is cheap and easy method. you only need to have,
1: buffer salt (tris HCL), PH 8
2; Detergent (triton X-100),
3: chelating agent (EDTA). PH 8
the recipe i used was 100 mM tris HCL, 0.5 M EDTA and triton X.
good luck
  • asked a question related to rRNA Genes
Question
3 answers
Hi everybody,
it is well-known that the 18s rRNA lacks Poly-A tail. I was wondering whether, why 18s rRNA gene can be amplified when cDNA is synthesized by oligo-dT?
Relevant answer
Answer
It may be the secondary structure of this RNA molecule that permits the first DNA strand synthesis by the reverse transcriptase
  • asked a question related to rRNA Genes
Question
4 answers
I am working on microbial diversity and planing to send samples for Next Generation Sequencing (NGS); Which hypervariable region of 16S rRNA gene will appropriate to target most of bacterial taxa present in seawater.
Relevant answer
Answer
Hi Rajeev,
This depends a bit on what you need from the study. The V4 region has (probably) the closest to universal primer set and it has the advantage that you can completely sequence through in both directions (on a MiSeq) the amplified region of 254 base and perform sequencing error correction (I do this in the Mother pipeline). I haven't used it, but there seems to be a lot of positive talk about the use of DADA4 in the Qiime package for helping go deal with the issue of sequence error. You might want to check out the recommended protocol from the earth microbiome project, http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/16s/
I use this for a variety of sample types. Again I have to stess that there is no perfect primer set/target region, but V4 has worked well for many, including me.
Good luck,
Frank
  • asked a question related to rRNA Genes
Question
2 answers
I already have the ones from beiresources, ATCC and Zymo. 
Any help would be appreciated!
Best, Nynne
Relevant answer
Answer
  • asked a question related to rRNA Genes
Question
2 answers
I designed synthetic DNA template containing 4 targets of 16s rRNA gene of bacteria in Bacteroidales group for using as DNA standard in real time PCR (standard curve generation). The synthetic DNA template has already validated in all 4 target assays. I would like to know that does it have any database that I can submit my synthetic DNA template for publication? 
Relevant answer
Answer
Sequences containing a mix of genomic and mRNA sequences are not accepted by GenBank or NCBI. Please let me know if you have the way to submit it.
  • asked a question related to rRNA Genes
Question
10 answers
I want to compare bacterial communities using 16s rRNA sequences. I used Illumina Miseq and I has big differences in the number of OTUs and reads in all the samples. I use Primer-6 software to get diversity indexes and comparative analysis (ie. MDS, CAP). The question is: Is it necessary to normalize the total number of reads for these analyses and comparisons? If it is true, Which methodology is recommended?
Thanks!
Relevant answer
Answer
I can't understand why people here is recommending rarefying while at the same time suggesting an article that state in its very title that that procedure is inadmissible. That article in fact was referenced previously here by Adam Šťovíček in his first answer. The complete reference is:
McMurdie, Paul J., and Susan Holmes. "Waste not, want not: why rarefying microbiome data is inadmissible." PLoS computational biology 10.4 (2014): e1003531.
And indeed it's a must-read for everyone working in microbial ecology. Here the authors, demonstrate that rarefying (subsetting samples to even size, as previously called here) is the worst option (they regard it as 'inadmissible'!) since it requires loss of potentially valuable information in the analyses (loss of statistical power). However, normalization by sample size (use of proportions), only has the drawback of not addressing heteroscedasticity, which is the differential dispersion or variance that the counted features (e.g. species) may display across the samples. This condition is normally found in RNA-seq data, because gene expression is a highly dynamical process -- way more than the dynamics of microbial communities, and some genes can vary a lot their expression patterns while others can simply not. Thus, it is unclear that the presence of species can have such characteristic in every experiment. So, for starting with something simple, or exploratory, I still recommend proportions (dividing counts by sample size) rather than rarefied counts (one may ask why the authors rather did not entitle the article ...normalize by sample size is inadmissible). Then, of course, if one suspects the data may have the heteroscedasticity problem, the statistical solutions given in that article must be considered.
EDITED: so much controversy still exists for this normalization process... a more recent article lend support to rarefying in some cases, and I am updating this here because I've being suggesting naive proportions instead. The article also suggests another method called ANCOM. In summary, it does not exists a single best normalization method, and exploring all the possibilities is currently the best way to go.
Weiss, Sophie, et al. "Normalization and microbial differential abundance strategies depend upon data characteristics." Microbiome 5.1 (2017): 27.
  • asked a question related to rRNA Genes
Question
2 answers
Mitochondrial DNA s are getting integrated into nuclear DNA as NUMTS. I want to know how many copies of 16 S r_RNA genes are integrated into human and chicken nuclear DNA /
Relevant answer
Answer
The simplest way to determine this is to take the mtDNA 16S human nucleotide sequence and then go to the NCBI website and blast that sequence against the human reference.  To find that website simply google "NCBI BLAST".  The human 16S sequence can also be obtained from NCBI.  That will give you a list of all sites in the reference sequence that match the 16S gene, and there will be several.
Repeat the same process with the mtDNA 16S chicken nucleotide sequence and the chicken reference genome.
  • asked a question related to rRNA Genes
Question
28 answers
I have a bacteria for which 16S rRNA gene was sequenced and BLASTn showed ~98% similarity with organism A. However, when WGS was done for my bacteria, whole genome comparison using ANI shows very low similarity ~70% with not only with organism A but all the top 10 hits in my 16S rRNA BLASTn result. What does this mean?
Relevant answer
  • asked a question related to rRNA Genes
Question
2 answers
I'm working with Oomycetes sequences, and I need to compare them (from 454 pyrosequencing and after ITS extraction) with ITS1 sequences from GenBank for the genus Pythiogeton, to understand which is the closest species.
Which is the similarity treshold I should use? Can I set it in MEGA 7?
Thanks :)
Relevant answer
Answer
For finding the closest sequence, you don't need any threshold, and no, there is not this possibility in MEGA. It should be noted that closest in term of maximum identity and closest evolutionary speaking may be different as in evolution different base changes happens at different rates; this is taken into account in phylogenetics methods (especially ML), while the percentage of identity does not account for these differences. So I would suggest to collect the most similar sequences through a blast search against an appropriate database, and then building a phylogenetic tree using some ML method. MEGA can be a good start.
  • asked a question related to rRNA Genes
Question
3 answers
I am using universal 16S primers in a qPCR on total DNA extracted from stool samples. Have repeated the qPCR several times and have tried other universal 16S primer pairs, but am still consistently getting melting peaks showing multiple amplicons.
Could this be because I am using DNA from a mix of bacteria, resulting in amplicons of varying length?
If not, what could be the reason?
And, if so, are there any other techniques for determining relative concentration of bacteria from DNA, e.g. a gene conserved across all/majority of bacterial phyla with the same/similar copy number in each species? I understand there is varying gene copy number of 16S so it may not be the best gene to quantify bacterial load.
Relevant answer
Answer
How large is your PCR product?  You can also get a "shouldered" or multiple peaks from a single large amplicon, especially if it has regions with variable GC content.  Have you tried running your reactions out on an agarose gel?  If you really want to know what's happening, you will have to clone and sequence your PCR products 
  • asked a question related to rRNA Genes
Question
7 answers
the best protocol for analyzing 16S rRNA gene to identify bacterial strain
Relevant answer
Answer
Hi, you need to determine the primers that would be appropriate for amplifying the 16S rRNA. Although there are universal primers, sometimes it depends on the bacterial group that you are looking for. 
Once determining the primers to use, you can also check the PCR protocol too. This would be dependent what kind of reagents or kits you are using. So please check. 
Once you successfully amplified the 16S rRNA, you need to have it sequenced. Once you get the sequence you need to clean it and make sure it is of good quality. You can presumptively try to get the identification of your sample by doing BLAST. However, this is only for presumptive identification. What you need to do next is to get the type sequences of the bacterial group you are interested in and do a simple phylogenetic analysis to determine which bacterial species is close to your sample. 
There are many pieces of literature out there that provide the detailed steps in using the 16S rRNA for determining bacterial identification. You can check out some of my publication that dealt with Methylobacteirum group. 
Good luck!
  • asked a question related to rRNA Genes
Question
3 answers
Reasons behind the in-congruence in plant genera based on taxonomy and evolution?
Relevant answer
Answer
I appreciate Dr. Schneider's response.  Although it is absolutely correct that phenotype and genotype are lightly linked, I would add that the link between phenotype and genotype can sometimes be obscured and is not always one-to-one.  Many traits are quantitatively controlled and thus result from the interactions of multiple genes.  Unless this genetic control mechanism is understood, there may be some discordance between morphology and molecules.  Another example is when a phenotype is impacted by epigenetic mechanisms.  I absolutely agree that genotype and phenotype are tightly linked, but I think the discordance can come in when these links are not fully understood or when phenotype is coded without complete knowledge of the genetic control (which is most of the time the case).  And, like Dr Schneider states, when these instances of discordance occur -- it presents a wonderful opportunity for investigation.
  • asked a question related to rRNA Genes
Question
4 answers
I have 16s rRNA sequence of cellulatic bacteria, Genus Aneurinibacillus. Now how to find a functional gene in this bacteria?
My gene of interests are cellulase.
Relevant answer
Answer
There's any number of ways, but probably the easiest is to try BLASTing known cellulase genes against the Aneurinibacillus genome sequences available. Best of luck!
  • asked a question related to rRNA Genes
Question
3 answers
I am looking for Universal primers sequences, protocols, articles and so on to identify bacterials strains isolated from the nature. I would like from researchers with experience in this topic.
  • asked a question related to rRNA Genes
Question
3 answers
I am looking forward to analyze changes in soil bacterial community by 16S amplicon sequencing.
Previously there were more reports on targeting V1-V2 region with primer sets of 27F/514R(or something similar). But recent reports e.g. Klindworth et al 2012 and Thijis et al 2017 suggest usage of V3-V4 region preferably with primer sets 341F/785R(or 805R). Is here any specific reason for change in targeting regions?
Reports suggest this region(primer set) gives better coverage and high phyla spectra but somehow the aforementioned primer set wasn't included in the comparative studies.
May be i am missing something. All help will be appreciated. 
Relevant answer
Answer
Hi 
As you said some evidences from Klindworth et al 2012  that the better in some several aspects comparing to using other variable regions. It might be not completely true when you go with the sequencing large numbers of samples (you can check the http://blog.mothur.org/2014/09/11/Why-such-a-large-distance-matrix/)
Another thing, it is something to do with the miSeq platform from Illumina, we also were adviced to use the V3-V4 region for our analyses, but at the end of the day, we had many things to deal with,  then we recognize that  using single variable region such as V3 and V4 could be a better option
  • asked a question related to rRNA Genes
Question
2 answers
Hi, pls can any one help me on how i can prepare master mix for a PCR reactionto for identification Acinetobacter species
Relevant answer
Answer
Hi Muhammad thanks a lot
  • asked a question related to rRNA Genes
Question
3 answers
I have recently come across some papers that suggest 16S RNA sequencing as a technique to know the active microbial population in metagenome and require some views about it. Also if this experiment is effective, I would like to know how to specifically isolate rRNA as most kits offer specific isolations of mRNA only.  
Relevant answer
Answer
Any extraction protocol to extract total RNA, if no specific treatment is included to avoid rRNA, will actually extract mainly rRNA (over 90% of total RNA) and minor amounts of mRNA. RNA strands is in general a very fragile and unstable molecules, so I recommend you to proceed to produce cDNA as soon as you obtain the RNA. There are many possibilities with bacterial RNA but one is to use random hexamers or external primers comprising the targeted region for the PCR amplicon generation (like nested PCR fragments). As example you can use for reverse transcription primers of the outer conserved regions of 16S (like 17F and 1492R) and then for PCR, use on this cDNA template, primers targeting regions inside those fragments (such as V4). Or you can use for the RT reaction random hexamers (NNNNN) and use that cDNA produced as template for PCR amplification of region V4. 
  • asked a question related to rRNA Genes
Question
2 answers
I am using ARB silva software to create a 16Sr Phylogenetic tree. I created the tree by using the Neighbor-joining method. The general stopping criteria typically stop computations after 550-800 replicates
Q2. I have 651 bacterial 16Sr sequences and when I create tree then I always get only 130 nodes in my tree. ...why?
Relevant answer
Answer
I agree  with joseph
  • asked a question related to rRNA Genes
Question
1 answer
The result in ncbi blast was NO SIGNIFICANT SIMILARITY FOUND
Relevant answer
Answer
As per molecular phylogeny is concerned don't rely on NCBI blast result. It is useful to get an idea of the specimen or its nearest neighbour but such estimation depends on the availability of correct sequences. There are many instances where people submit mislabeled or sequences from wrongly identified specimen. This can easily misguide your research. Moreover, there is every possibility that your sequences are the first to be submitted or in other words no similar sequences exists. In such scenario, proceed with the combined approach of morphology or classical taxonomic keys along with the genetic data.
All you have to do is that visit any good taxonomic literature to confirm your specimen's taxa like genus /species /family and so on or try to find its nearest neighbor taxa. Retrieve the sequences from the related taxa from NCBI (be sure to check the sequence length, publication status, geographic location or country/origin of the database sequence, etc.) and go for NJ clustering to see the clustering of your samples with the global dataset comprising maximum member of the taxa. In the subsequent step you can go for ML, MP or Baysian tree based on your hypothesis.
  • asked a question related to rRNA Genes
Question
4 answers
i want to sequence some of my dna samples
Relevant answer
Answer
Its commercially sequenced from Korea and cost is around 3 to 4 thousand per sample.
  • asked a question related to rRNA Genes
Question
5 answers
Hi,
I recently decided to opt for the ITS3_KYO2/ITS4 primer combination in the Toju et al., (2012) High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples. PLos One. In the paper it specifies and tests a mock community composed of  Ascomycetes and Basidiomycetes, but I wonder if anyone has used these primer sets and got a wider coverage of the fungal community from environmental samples?
The paper by Balint et al., (2014) An Illumina metabarcoding pipeline for fungi. Ecology and Evolution that used ITS3_KYO2/ITS4_KYO3 says that they lost a number of reads during the clean up and only managed to assign 33% of OTUs to fungi.
I also then found a paper by Asemaninejad et al., (2016) New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA. PLos ONE that compared a new primer set with the Toju et al (2012) primer set. Their new primer set target the LSU and while they performed better than the Toju primer set, is it better to target the ITS region where a lot of the research has previously been performed so that we have a larger database to assign taxonomy?