PCR Primer Design

PCR Primer Design

  • António Maximiano Fernandes added an answer:
    2
    I am doing PCR with GJB2 Gene for human hearing loss. When i dilute the primer for the first time, it work only for 2 days, after it does not work?

    I am doing PCR with GJB2 primer regarding hearing loss. When i dilute the primer for the first time from the stock, it works only for 2 days. After it it does not work even i dilute it again from the stock. Can anyone help me what is the main cause of it?

    António Maximiano Fernandes

    We use to face this problem when thawing the primers several times. As Paul said should check the solution the primers is diluted in. If the problem persist should consider the quality of your primers. 

    Good Job

  • Ernest Tambo added an answer:
    2
    Zika molecular genotypying from from blood fed Aedes mosquitto?

    Zika molecular genotypying from fed mosquito protocol? Do you have a protocol or SOP to share o multiplex or qPCR primers?

    Ernest Tambo

    Thanks Murat, This will help with the literature I can proceed further.

  • Laurence Stuart Hall added an answer:
    4
    Can anyone plz tell me why we use primers that yield short fragment of PCR product in Real time PCR?

    I am working with a gene which is not sequenced for my model. We, in our laboratory partially sequenced it. It was almost 500 bp fragment. Now I have to do real time PCR but read that , I should use primers that yield upto 200 bp. My problem is if I use a degenarate primers designed from some very related other species, how can 200bp fragment can ensure that the product is actually my gene of interest and not a nonspecified one? Plz help. Another thing is----  Is it  very important to show sequencing and partial homology of the product in real time PCR , just like  like RT-PCR

    Laurence Stuart Hall

    Hello Shreyasi

    the reason in real time PCR you are only amplify short amplicons  - on average 100bp to 200bp - is linked to PCR efficiency in the main: Specifically, because real time PCR is a technique for measuring mRNA levels to gauge gene expression and because the standard measurement of transcripts (delta delta ct method) presupposes something approximating to doubling during the exponential phase of amplification, for this to hold true and thus for mRNA measurement level to be valid priming efficiency must be 85% of above

    To maximise your chances of amplifying with high efficiency keeping products short is best. To put that in perspective I tend to obtain high efficiency with most primers of 100bp to 200bp when the GC content of the target is < 60% (high GC content regardless of amplicon size will also reduce PCR efficiency) but on occasions I have known people try and assay expression using primers which amplify products > 400bp and invariably this leads to primer efficiency values < 75% which is insufficient to calculate transcript levels accurately based on the standard delta delta Ct paradigm:

    You can correct for low primer efficiency by introducing a correction co efficient into the standard delta delta Ct expression analysis ( the so called pfaffl methos of analysis) but best practice is always to make short amplicons in real time PCR

    For general back ground on this subject see attached which is the best real time PCR guide in 10 years of practicing this technique I have ever come across: see pp. 10 & 29 for example 

    I have also included a paper which talks about data analysis principles and parameters including the impact of primer efficiency

    + 1 more attachment

  • Keerthy Vijayan added an answer:
    2
    What is the reason for Primer Dimer formation in a PCR reaction? What is the role of PCR reagents in Primer Dimer formation?

    Again while doing the PCR amplification of snail DNA, I got stuck with no visible bands on gel. But there is the presence of primer dimers in the gel. The DNA pellet I got readily dissolved in double distilled water and it is about 100ng/ul in quantity. I had added about 8ul of DNA templte to 50ul reaction mixture. What could be the possible reason of no band formation? Is it due to more amount of template DNA? or due to any of the PCR components? Does Primer Dimer formation is due to defective PCR reagents?

    But primer dimers are seen on every gel.

    Please help.

    Keerthy Vijayan

    Pranay,

    Thank you so much. I will try doing it and update my results

  • Divya Pasumarthi added an answer:
    6
    Can anyone explain how to design STR primers?

    As part of my work i have planed for haplotype analysis. Can anyone explain how it is useful in genetics and how to design STR primers for the gene. is there any online tools available for STR primer designing .

    Divya Pasumarthi

    hai pablo  why i studied means we analyse mucolipidosis disorders  of patients . in  20  mutations i got 6 similar mutations (means in exon 19 tc deletion occures in all 6 mutation)  .so we go for STR analysis of exon -19

  • Jack M Gallup added an answer:
    7
    Primers are not yielding bands, could they be working?

    I have designed qPCR primers for multiple genes, tested them using regular PCR (35 cycle) and agarose gel and most of them are yielding a band of the expected size, However, some are not giving any band of any size which indicate they might not be working for some reason but a friend suggested that the primers could be actually working but the band is not sharp enough to appear on the gel and that I should test them in a qPCR reaction since SYBR green is more sensitive than the Taq poly in detecting any amplification. Is that true? I don't want to waste my time if this is not correct.

    Jack M Gallup

    Dr. Renee Horner of Ambion has reported using primers demonstrating as low as 48% efficiency in qPCR.  As long as the apparently stable (albeit low) efficiency is acknowledged in the ensuing mathematics, it can be useful.

    Efficiency itself (in the PCR/qPCR) sense is a fairly misused idea. The only reason efficiency ranges like "90-100%" or "80 to 115%" and so on have been cited is due to lack of precision and/or the existing potential caveats in the technique itself.

    As we all know, efficiencies above 100% in a '2 to the n' process is molecularly impossible. Linus Pauling once proposed a triple helix for the structure of DNA - in which case a '3 to the n' process would have been the playing field if he was correct.

    So, reaction inhibition (either introduced by carryover contaminants in the sample preparations, or by too much target template being added to the reactions) of the first point or points in the dilution curves, and/or flattening of the curve at the dilute end by primer dimer and/or non-specific product formations/signal contributions have haunted the PCR/qPCR technique since its inception - giving rise to the mythic lore of efficiencies exceeding 100%. Efficiencies exceeding 100% always indicate something that needs to be addressed and fixed. 

    Perhaps just as troubling are efficiencies below 100% - yet, interestingly, these efficiencies seem quite stable and consistent (R2 values for dilution curves often >0.97) - indicating that the suboptimal kinetic certain sequence interactions attain by PCR is an intrinsic property of the PCR gymnastic itself when faced with the Tm and thermodynamic (known and unknown) properties of the specific primers and templates involved (all coupled with the effects of diminishing reactants, accumulating product and possible fluor accumulation over the course of 35 to 45 cycles). 

    Efficiency is not even constant from cycle to cycle (as demonstrated eloquently by Rutledge and Stewart in 2008 and elsewhere).

    When (if) low efficiency is a stable phenomena, and the standards and samples have the same matrix interference to the point that both can be considered 'equally deleterious' to the efficacy of the PCR/qPCR, then using calculations that correct for efficiency is an approach that can be helpful.  In the end, it is always best to seek to design primers that exhibit ~100% efficiency, 100% of the time, but perhaps this is not the planet on which to expect that to happen 100% of the time. I would say: 70-100% efficiency is a better/more realistic range if indeed dilution curve (or dilution profile) stability is observed (high R2) therein.

    Once you find yourself dealing with efficiencies above 100%, you are either adding too much sample to the reactions, and/or you have non-specific product formation(s) and/or primer dimer contributions to signal; all problems that need to be eliminated or creatively avoided before expecting good information out of the endeavor.  Efficiency may actually be a "ghost' of some sort, a specter of highly-assembled reactants in a tube - which is a scary thought.  When I found out that rainbows weren't actually created by a magical flying elf with a multi-colored paint-brush, it changed my view of the world ;].  Keep a healthy suspicion about the notion of PCR/qPCR efficiency - even when working at apparently 100%, because the very process by which you calculated 100% efficiency from a dilution curve, isn't even 100% efficient from cycle to cycle itself... therein lies the rub.

  • Naglaa Azab added an answer:
    9
    Where to find the forward primer sequences for various miRNAs when analyzing miRNA expression using RT-PCR?
    Does anyone know how to find or create the sequence for the forward primers used when confirming microRNA levels with Reverse Transcriptase-PCR? My supervisor wants me to try to find them so we can synthesize our own instead of buying them for around $100 a primer.
    Naglaa Azab

    what about the 3 ' dgenerate anchot of the reverse transcription primer of qiagen this means that not poly ttttt tail only are attached to tha cdna of the mirna but there is a separating degenerate anchor????

  • Katherine Balasingham added an answer:
    7
    Why won't my PCR Primers amplify DNA extracted from a kit but will amplify all other samples?

    I have different samples of Atlantic salmon. I have PCR primers (amplify region of ~280bp) which worked on eDNA samples of ATL (I gathered water from a tank filled with ATL and extracted via PCI), the PCR primers work very well from samples extracted off tissue; however the same primers refuse to work on a second set of water samples taken from the same ATL tank but extracted using the EZ-10 Spin Column Soil DNA Mini-prep Kit.

    Now, when I used fish COI primers (amplify COI region of 800bp) all my samples even the ones straight from the ATL tank amplified beautifully (these samples are extracted from the same kit). In fact, my controls (water taken from the same tank) amplified really nicely (really big thick bands) which were similar to those taken from tissue samples.

    I've tried re-optimizing the primers with these samples, tried diluting these samples, I run double PCRs on them. The first PCR run will give me only blanks and when I run the PCR product for a second time, I get amplification of bands below and above the desired size. It's either I get no bands, or I get way too many unspecific bands all over the place.

    I just want to know why the samples straight from the ATL tank which do contain a lot of DNA (ATL are the only fish having been kept in this tank - no other species) won't amplify at all.

    Thanks!

    Katherine Balasingham

    So I've been trying different gradients, dilutions, new reagents etc. I still cannot get any bands to show up during the first PCR...it will only show up once I run the PCR product from the first run, and onto a second run.

    I've done numerous touchdown PCRs with different settings, and once it appeared I got very faint faint bands - once I did a replicate of the whole process I got nothing. 

    I no longer know what to do...my positives work every time and my negatives are always clear. I just need the bands to come up during the first PCR run. 

  • Josh Espinoza added an answer:
    5
    Can I PCR a fragment while adding linkers?

    I have a large vector (~10kb) and I'm trying to trim it down to just the parts I need (~4kb) while adding 5'/3' linkers (~20b each).  My plan was to make primers ~60 b long, where 40 of those bases are the backbone and the remaining 20 contain the linker.  I've used this method before and it worked but I had more funding to use more reagents.  I'm limited in what I can purchase so designing new primers or order more polymerase is a last resort.

    Here are my primers:

    F: GAACGTGGCGAGAAAGGAAGGGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAA
    R: CGCCGGCTTTCCCCGTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACT

    The GC content is ~50% and they don't seem to form any primer dimers of particular significance. When I run the gel you can see them amplified at the bottom of the gel. My primers are 10 µM. The Annealing temperature suggested by the NEB calculator was 72 C, which is also the elongation step temp.  

    What are my options? If I do a gradient, how far should I step? I'm using Q5 polymerase. 

    Josh Espinoza

    @Uwe That is my plan, I found some restriction sites that I could use to chop up my vector.  I don't have much left so I would need to do some preps to make more.  Accounting for just the 40 b binding, the annealing temp is still 72.  

    @

  • Md. Harun-Ur- Rashid added an answer:
    5
    How can I easily find the drought stress tolerance genes in Leucaena leucocephala?

    How can I easily find the drought stress tolerance genes in Leucaena leucocephala? For designing primer in qPCR.

    Md. Harun-Ur- Rashid

    Thank you very much Dear David Lawlor.

    I would like to provide stress in vitro in Leucaena plant and after that I would like to check their gene expression pattern via qPCR. For that, I need to develop primer related to drought and their reference genes. This is the ultimate objective of my question. Could you help me Dear David Lawlor.

  • Deepankar Chakroborty added an answer:
    9
    Is there a software to predict non specific binding of PCR primers?

    Is there any software for predicting non-specific binding of PCR primers?

    By non-specific I mean, sites which even though are not a perfect match to the primer sequence, but still amplify.

    I have used Oligo analyzer (link: http://eu.idtdna.com/calc/analyzer) to find out if my primer forms Hairpin loops or forms dimers with itself, but there are certain times when I do get non specific bands and I was wondering isn't there a way to check for these non specific binding sites if I submit sequences of my Primer set sequence and the Target DNA sequence from which I am trying to amplify a region.

    I have read about the software Fast PCR (link: http://primerdigital.com/fastpcr/m11.html) and MFE Primer (link: http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0), but I was not able to use them to get the information I needed.

    Are there any tools you would like to recommend for this purpose?

    Deepankar Chakroborty

    Thanks a lot for the responses. I found NCBI'S Primer-BLAST search using the primer pair, adding the whole amplicon sequence and selecting the target species to be useful in predicting possible non-specific bands.

  • Don Mathew added an answer:
    4
    I did not Pre-check the Tm difference of my PCR primers as they were from a reputed journal. but they have >10'c difference. How to decide the Ta,?

    Forward Primer Tm- 59.8

    Reverse primer Tm- 69.6

    Ta- Gradient temperature tried from 56-67'c

    DNA concentration also varied and checked.

    Primer concentration also varied, but no help.

    Any other suggestions please help.

    Don Mathew

    Thanks everyone, I'll try the touch down and touch up PCR along with MgCl2 gradient. Hope it works. Thanks again.

  • Malini Rajan added an answer:
    1
    Which are programes that take consideration for NON WHATSON BASE PAIRING in primer design ?

    Currently I designed primer by Primer BLAST but even it showed the no non specific band the real time results showed non specific binding

    I am not aware of fact whether BLAST take consideration of the non whatson base pairing also in consideration or not.

    Is this lack of training based on unconventional base pairing may be the reason why still failures in primer design occur.

    Malini Rajan

    Hi Sathyajeet
    What was your PCR template? Did you select the corresponding organism in Primer Blast? 

    Most PCR is performed using ds DNA as template and ds DNA maintains its helical structure by Watson-Crick Base pairing. Most primer design softwares are designed for such PCR reactions and therefore don't include Non-Watson-Crick base pairing. 

    If your PCR template is dsDNA, please review further details of the primers you designed - Tm, GC%, self complementarity, 3'end bases of the primer, etc. and also review the reaction conditions - temperature profile, primer and template concentration, buffers, number of cycles etc. 

    Also check if the primers you received from the company are indeed having the same sequence that you designed. Mistakes sometimes happen. 

  • Daniele Costantini added an answer:
    1
    Can you give me the 16 S RNA primer details to identify actinomycetes?

    Can you give me the 16 S RNA primer details to identify actinomycetes?

    Daniele Costantini

    Hi! I´ve been used this research motor which I attached here and it works pretty well. I didn't work with actinomycetes but with other microrganisms. You can do specific reasearch with it.

    http://probebase.csb.univie.ac.at/pb_search

    Good luck with your experiments!

  • Jigar Suthar added an answer:
    2
    Which are the upstream and downstream primers for the human beta globin gene in PCR?

    i want to find these primers sequences and where is the binding in the gene .  I need the primers for the mutation which causes anemia.

    Jigar Suthar

    Here are the beta globin gene primer sequences for forward and reverse primers, which are we using in our lab as an internal control for diagnosis of other human gene mutations.

    Forward : - "GAA GAG CCA AGG ACA GGT AC"   20 nT.

    Reverse : - "CAA CTT CAT CCA CGT TAC ACC" 21 nT.

    these primers will work good at following cycling condition.

    95 degree for 5 min.

    95 D C for 1min, 55 D C for 2 min, 72 D C for 1 Min  X 35 Cycle

    72 D C for 4 min. 

    These will give you the 268 base pair product on agarose gel.

    You can also check these primers on PRIMER3 software available free on google by adding sequence of beta globin gene freom NCBI.

  • Sascha Hill added an answer:
    7
    Is it possible to design primers made of DNA to bind mRNA?

    Hi everyone! 

    I would like to search for a particular mRNA-template in my samples after isolating RNA via RNeasy Kit by Qiagen. (Just to check out if the Kit works and the specific gene related mRNA was isolated).
    So I was wondering if it was possible to design some primers (preferably made of desoxyribonucleotides) that bind the RNA directly, followed by PCR and gel electrophoresis? 


    Sascha Hill

    Hey everyone! 
    It figured out, that the RNA-Isolation Kit probably didn't work well. Concentrations of both the gene of interest and the reference gene were pretty low at NanoDrop.
    I ordered a new one and it seems to work well!
    Thanks for your replies!

  • Harishankar Mahto added an answer:
    2
    What Allele Specific PCR Primer designing tool can you suggest?

    Hello,

    Can you please tell me applications of AS-PCR primer designing tool except "WASP"?

    Harishankar Mahto

    Thank you dear Abid

  • Syed A Ali added an answer:
    8
    Hello Everyone!! How to get PCR product amplified, if Tm difference between two primers is very high ?

    Hello Everyone!! 

    How to get PCR product amplified, if Tm difference between two primers is very high ? FP is 53 °C and RP is 80 °C.  Thank you. 

    Syed A Ali

    In that case you are perhaps wrongly calculating the Tm. Please do not include that 18 bp region in the Tm calculation.

  • Bhanupratap R Vanga added an answer:
    7
    Can anyone assist me in avoiding primer dimer in real-time PCR?

    Hi.

    I did real-time PCR for 50% samples without any problem. I had just one great pick for my gene. No primer dimer. but suddenly, for other 50% samples I got primer dimer pick as well as my gene pick. I changed every thing: primer concentration- template concentration- new dilution of primers- PCR program like annealing time etc. However I couldn`t remove primer dimer. I repeated PCR for some previous samples that didn`t have primer dimer, But I found primer dimer. My samples have great pick for other genes and I`m sure my template is perfect.

    Can any one help me?

    Bhanupratap R Vanga

    Hi, you may try designing new set of primers for this particular gene, did you check if the existing once have more complementary bases which could allow self binding of the primers to an extent that might give a second smaller peak. 

  • Denish Dholaria added an answer:
    2
    Can anyone suggest a SSR Primer Dilution for PCR?

    Actually I am having 10micro lit of primers, stock concentration 100micro molar i am having 260 samples is it sufficient to run all samples with this primer please suggest.

    Denish Dholaria

    1. If you have qPCR thermal cycler, you can try run 5 micro L reaction volume for pcr, consider that your instrument supports it.

    2. Lower the primer concentration, see if that works.

  • Ben Christopher Houghton added an answer:
    3
    How can I rehydrate a primer ?

    My boss just told me Hey man, teach those kids how to rehydrate primer and im like ok sir without any knowledge of it. pls save me, i dont wanna ask him

    Ben Christopher Houghton

    Rehydration of lyophilised primers usually occurs quickly. Spin the tubes down first to make sure the primer is in the bottom of the tube. Add the required amount of nuclease-free water, incubate 5 mins. Vortex briefly, spin again and you're ready to go.

    Rehydrate to make a 100uM (may also be written as 100pmol/uL) stock. This can then be diluted 1:10 to make a working stock for use in PCR reactions. Check your existing protocols but usually around 1 - 5uL (10 - 50pmol) is used in a 50uL PCR reaction. This working dilution can be frozen and thawed multiple times, but if you are worried it's gone off/contaminated you can dilute again from the concentrated stock without repurchasing the primer.

    The examples in the link may help to understand the calculations to get a 100uM stock.

    https://www.thermofisher.com/uk/en/home/products-and-services/product-types/primers-oligos-nucleotides/invitrogen-custom-dna-oligos/technical-resources-for-oligonucleotides/protocols-for-oligonucleotides.html#2

  • Fausto Sánchez-Muñoz added an answer:
    6
    How can I overcome such problematic melt curve in qPCR?

    I am facing problem in qPCR analysis. The file attached shows the melt curve of GAPDH. In my setting, my template was 100ng and primer concentration 500nM in 20ul. Cycling number was 40 cycles. In this run, I did for 2 other genes. Only my GAPDH have this problem. Ct value is about 25.9. I am suspecting primer dimer. However, 1uM of primer can give a nice melt curve. Why 500nM can give this result? 

    Fausto Sánchez-Muñoz

    Hi! I recommend you to use less than 50 ng of template. Also, you can use between 200 and 1000 nM for each primer. It is puzzling to see that you got good results with 1000nM (This may happen when primers get old and degraded). If you don't need to maintain PCR temperature conditions use  touch down PCR.    

  • Alicia Jorquera added an answer:
    4
    Can anyone help me to get on paper contain primers for detection of Leishmania donovani?

    primer of L.donovani Can anyone help me to get on paper contain primers for detection of Leishmania donovani?

    Alicia Jorquera

    I think this paper can help to you:  DETECTION OF LEISHMANIA CAUSING VISCERAL LEISHMANIASIS IN THE OLD AND NEW WORLDS BY A POLYMERASE CHAIN REACTION ASSAY BASED ON TELOMERIC SEQUENCES. Chiurillo et al. 2001. Am. J. Trop. Med. Hyg., 65(5), 2001, pp. 573–582

  • Tobias Johner added an answer:
    6
    Any advice for 5'-primer modifications that prevent degradation of PCR products while using circular DNA?

    I'm currently trying to amplify circularized DNA. Only a small sequence of this circularized DNA is known and was used for Primer design. The other part of the circularized DNA is unknown genomic DNA.

    I tried to amplify this circular DNA with the aim to have one part of the known sequence on the left border and the other part of the known sequence on the right border of the genomic DNA. It is necessary to obtain these left and right borders for a following sequencing step.

    Here arises the problem: I tried to amplify the DNA with Taq, but the 5'-3' exonuclease activity made it impossible to obtain the left and right borders. I also tried the same amplification with 5'-Biotin labelled Primer trusting that the Biotin stops the 5'-3' Exonuclease activity of Taq. But this was also not succesful. A third way I tried was an isothermal amplification with phi29 to obtain long repeating linear DNA, which I than used as template for a 2nd PCR with Taq. But somehow this idea also didn't work out. Has anyone of you some idea how I could modify the 5' end of the primer which stops the 5'-3' exonuclease activity of Taq. Or has anyone another idea how to get this linear DNA with the desired left and right border?

    Thank you in advance

    Tobias Johner

    Just to keep you updated.

    The usage of primers with 5'-overlaps with non-complementary nucleotide and Q5 polymerases solved the problem. Thank you all for your suggestions!

  • Amira Mohamad added an answer:
    3
    Who has experience regarding bisulfite modification and methylation-specific PCR ?

    I already optimized methylation-specific PCR (MSP) and got results for 50 samples. However when I repeat it again using a new bisulfite treatment kit, I cannot get consistent band. 

    Below are the detail situation when I use the new bisulfite treatment kit.

    When I did for first time the bands appear very clear and thick. But when I repeated 4 times treatment and about 10-12 MSP, mostly no bands appear. If they appear they were faint and smear. I tried to change the MSP reagents (AmpliTaq gold polymerase, buffer, MgCl2, dNTP, primers) to the latest one I got less than 6 months ago but still don't get any result. 

    The concentration of treated DNAs were above 12 and purity mostly 2.1-2.7. Only one time purity was 0.17. Initial DNAs for treatment are of excellent concentration and purity.

    I really appreciate if anyone can suggest any idea to get the band. I just want to amplify 4 samples for DNA sequencing.. already took few months to do.. 

    Amira Mohamad

    Tq Prof Donlon and Dr. Barault.. 

  • Rafik Karaman added an answer:
    3
    Can anyone help me about the stability of biotinylated primers?

    Hi dear all

    I have a problem about immobilization of my PCR product by reverse biotynilated primer on streptavidin magnetic beads. I thought it may related to my primers stability. what is the stability of biotinylated modified primers?

    Rafik Karaman

    Dear Leila,

    The recommended storage conditions:

    I recommend aliquoting your reconstituted primer into reaction size volumes and storing at -20 celsius in a non frost-free freezer. The aliquots should be stable for at least 6 months.

    Oligos should always be resuspended in TE pH 8.0, or at least 1/10 TE. As a buffer, 10 mM Tris pH 8 should work fine. However, please avoid freeze-thawing.

    Hoping this will be helpful,

    Rafik

Topic followers (132) See all