Vitamin D - Science topic

I have wondered why Covid-19 was not as devastating as predicted in African content. Since Vitamin could be made from sun exposure and most Africans are outside for their daily living activities, I have wondered if they have optimal Vitamin D3 that might have conferred them with some protection.

There is a lot of matrix effect that disable me to quantify it. what i need is a quick and fast extraction method. what should i add?

Dear Researchers:

Could you please share some simple cures or prevention for COVID-19, Cold, Flu or Influenza, and possibly Other Viruses, and Cancers?

Updates on Oct. 10, 2023: First, many thanks to all contributors to this discussion. Here are some Natural Approaches found from surveying literature in medicine to Boost our Immune Systems against viruses such as COVID-19, Cold, Flu or Influenza infections and to avoid/minimize developing further inflammations in the lungs and hearts caused by some of those viruses:

Give it a try, please! Especially if you increase your Vitamin D level to a required level and consume Vitamin C sources, e.g., oranges, on a daily basis, you can check how rarely you would catch the virus. Or, even after catching the virus, the virus will likely develop very mild symptoms in your body.

1- Daily uptake of Vitamin D pills up to 100 IU per 1 kg weight is safe and very important, recommended by Afshar et al. (2000) and Dr. Hamid Sajjadi in an interview, to RAISE the Vitamin D level in our body to the POINT which is REQUIRED to BOOST our IMMUNE SYSTEMS against Viruses and Diseases including Cancers.

Please read the following article by Afshar et al. (2000) about the importance of vitamin D and the required daily dose of it (Up to 100 IU per 1 kg weight) to boost our Immune Systems.

Please also read the following Review article by Jordan et al. (2022) about the importance of Vitamin D on the level of infection & disease progression for COVID-19. You may find in the article the importance of our Forgotten SUN.

Vitamin D is rarely available in food sources, except in fatty fish which needs to be eaten high enough to get the required amount of Vitamin D for a body.

Another good natural source is daily sunbathing with naked skin; however, in cloudy regions such as Europe, sunbathing doesn't work well.

Vitamin D helps to absorb Calcium in our intestines and thus, in order to avoid excessive absorption of Calcium by our body, it would be better to use Vitamin D pills with Calcium sources such as warmed-up milk and Magnesium sources such as bananas on a daily basis. Because magnesium competes with calcium in our intestines to get absorbed.

Here is a text from A Review article by Kulie et al. (2009) about some of the importance of Vitamin D on our health:

"Vitamin D is a fat-soluble vitamin that plays an important role in Bone Metabolism and seems to have some Anti-Inflammatory and Immune-Modulating properties. In addition, recent epidemiologic studies have observed relationships between low vitamin D levels and multiple disease states.

Low vitamin D levels are associated with increased overall and Cardiovascular mortality, Cancer incidence and mortality, and Autoimmune Diseases such as Multiple Sclerosis. Although it is well known that the combination of vitamin D and calcium is necessary to maintain Bone Density as people age, vitamin D may also be an independent risk factor for falls among the Elderly."

2- Having Good Nutrients including Protein sources, Minerals, and Other Vitamins, e.g., C, A, and E, sources from fresh fruits, vegetables, and nuts. For example, the good sources of fruits and vegetables for these vitamins could be a daily use of 1-2 Oranges for Vitamin C, Carrots for Vitamin A, and Almonds or Sunflower Seeds for Vitamin E.

As Vitamin C is a water-soluble vitamin, the excess of it will be excreted from the body, it needs to be consumed every day to provide everyday vitamin C requirements for the body, as it is the 2nd most important vitamin after Vitamin D to boost our Immune Systems against viruses and diseases.

And, Vitamin B family from grains, poultry, and meat sources.

3- After the infection by those viruses, gargling salty water to disinfect the throat to avoid further movement of the virus into the lungs as the virus may stay in the throat for a few days

4- Inhaling Steamed Fresh Leaves, if not available, the Oil, of Eucalyptus 4-5 times a day for several continuous days to kill the virus in the lungs.

Here is A Review article by Mieres-Castro et al. (2021) about the "Antiviral Activities of Eucalyptus Essential Oils: Their Effectiveness as Therapeutic Targets against Human Viruses"

Australian Aboriginals are very much using Eucalyptus to Treat Infections.

5- Having plenty of Warm Drinks to wash out the virus from our body and dilute the blood to avoid blood clotting.

6- Having enough sleep and daily activities/exercises

7- Kids are proven to have High Immunity Against COVID-19, likely due to having a high amount of Melatonin, the Sleep Hormone, in their blood. So, that is why kids sleep very much as you know.

Melatonin production in our body usually decreases with increasing age. Thus, we may use daily melatonin pills after the infection based on what physicians may prescribe for us.

Here is A Review article by Carrillo-Vico et al. (2013) about the Importance of Melatonin on the Functionality of Our Immune Systems:

8- Avoid Fear/Panic as it Substantially Deteriorates the Functionality of Immune Systems against viruses and diseases.

Here is an interview by Dr. Lauren Deville about How Fear Affects Our Immune System:

Determination of vitamin d in egg yolks. The eggs are collected from farms with different husbandry conditions. Caged, free range and organic eggs. I have data collected today.

Concentration of Vitamin D2 in whole egg yolk (ug) MEAN for Caged/Free range/ Organic

Whole egg yolk (g) MEAN for Caged/Free range/ Organic

How to refine search results?

Hi! How can i refine my search results? And where can i see how much results did i got? I am shown more than 5000 pages, for example, when I type "Vitamin d + Bone density + Older Adults " It is required for a systematic review.

Kind Regards

I will be analyzing the vitamin D content of chicken eggs. I have been advised to use Perkin Elmer Gas Chromatography as the most appropriate gas chromatograph for this experiment. What steps are involved in the preparation of my samples? Could anyone assist me with the equipment list as well?

Vitamin D is a fat-soluble vitamin and very essential not only for oral skeletal health but has many important actions on the extra skeleton system. It is essential to maintain strong bones and teeth as that helps in the absorption of calcium-phosphorus. It’s a hormone that interacts with every cell in the body and is important for several other functions, like building immunity and even cancer resistance.

So, is there a link between vitamin and obesity? What is the role of this vitamin to combat obesity and supporting the body’s immunity? And what is the role of this vitamin in supporting the body’s immunity?

All comments and contributions are welcome.

I have seen several patients having low vitamin D levels in Louisiana with no specific ethnicity, comorbidity or gender.

Together with evidence on the importance of sufficiently high levels of 25-OH-vitamin D for the optimization of functioning in all parameters of the immune system, clinicians observed that

-- transitorily even higher doses are needed in acute peroids of illness/inflammation,

-- transitorily even higher doses are needed when lymphocytes are active in detoxification from metals, parasites, nanotech such as ribbons or other graphene based structures, circulating spike proteins etc. etc,

-- lhigher doses are or may be needed when there is a ack of complementary micronutrients such as magnesium, vit. K2

and similar factors.

In addition to those observations, questions regarding the impact of vitamin D quality emerged:

Do vegan production, duration of storage and othe parameters of quality impact bioavailabilty?

Hello I wish good health to all my friends. I had two questions. 1: Is free vitamin D in serum the same as vitamin D in VDBP in terms of immunological properties and can it be identified with a similar monoclonal antibody? 2: In making the extraction buffer for vitamin D ELISA kit, is the best way to separate vitamin D from VDBP pH shock or can other cases be used? If my friends have any other suggestions, I would be grateful if you could guide me. Thanks

Is there any HPLC procedure for detection of vitamin D with run time shorter than 4 minutes ?

Now to the question, how do I know which of these masses represent vitamin D and its metabolites? Is it just a matter of freely searching for the masses of vitamin D and its metabolites and starting from that?

Hello Guys

I have collected 9000 vitamin D samples and I want to know how to determine how many of the samples (having Vitamin D deficiency, Insufficiency, Normal, or toxicity). what I mean is how to compare them ti the standards, for example (deficiency = <30, Insufficiency < 40 and so on).

and another question is what kind of tests I have to uses when I compare both genders in term of vitamin D level (which one is having more or less Vitamin D) when the data is not normally distributed.

*Note: I use Graphpad Prism

Thank you very much for your kind help

Recent literature suggest that Vitamin D pre infection deficiency associated with Severe COVID outcome .Role of Vitamin D has already been proven beneficial in various autoimmune diseases and the deficiency has been associated with various respiratory diseases like influenza as well.Moreover, It has been estimated that 5.9% of USA population, 7% of Canada population is deficient in Vitamin D. Literature suggest deficiency in large population in even tropical countries like India. Sign and symptoms of Vitamin D deficiency are non specific like bone pain , fatigue , mood changes. Should Vitamin D testing(Despite of high cost) be done routinely in high risk groups like elderly , people living in high altitude with less exposure to sunlight ,Obese?. Besides sunlight Cod-liver oil, eggs , cheese , mushrooms(for vegans) are good source pf Vitamin D. Should Vitamin D supplements be advocated in high risk groups and Sunlight deficient areas.

Does vitamin D have remarkable effects on athletes' performance?

Which performance does vitamin D improve for athletes?

What performance is significantly enhanced by vitamin D intake?

I am searching but not getting specific doses.

For example, I want to know how baseline characteristics of patients (age, BMI...) and the confounding factors (smoking, diabetes or other chronic diseases) affect the serum vitamin D value. Which regression model should I use?

I use SPSS and R for analyzing the data

Hypothetically, can the body use the 25(OH)vitamine D derived from skin and sunlight (initially D3, then processed in liver) and that is further metabolized by CYP27B1 to active-D-vit - if you have no PTH?

From Pubmed PMID: 17656568 Parathyroid hormone regulates histone deacetylases in osteoblasts Emi Shimizu, Nagarajan Selvamurugan, Jennifer J Westendorf, Nicola C Partridge:

Vitamin D undergoes two enzymatic steps to form the active compound 1,25-dihydroxyvitamin D3 (1,25(OH)2D3).2 CYP27B1 is a cytochrome P450 enzyme that performs the second step in this process, metabolizing 25-hydroxyvitamin D3 to 1,25(OH)2D3 (1, 2), and thus controls the biological activity of vitamin D.

CYP27B1 is tightly regulated. A primary signal in mediating induction of 1,25(OH)2D3 in the kidney is elevated parathyroid hormone (PTH). This was demonstrated in early animal studies in which thyroparathyroidectomy resulted in reduced production of 1,25(OH)2D3, whereas administration of parathyroid extract restored 1,25(OH)2D3 production almost to control levels (5).

1,25(OH)2D3 is known to regulate its own production by inhibiting CYP27B1. In addition to 1,25(OH)2D3, the phosphaturic factor fibroblast growth factor 23 (FGF23), which acts as an endocrine factor, also suppresses expression of renal CYP27B1 (1, 2) (Fig. 1). But, what are the molecular mechanisms connecting these hormones to CYP27B1 and each other? Some initial hints have emerged. Early studies showed that 1,25(OH)2D3 treatment could suppress Cyp27b1 expression in both thyroparathyroidectomy and sham-operated rats, suggesting that activation by PTH and suppression by 1,25(OH)2D3 are two distinct events (6). It was suggested that 1,25(OH)2D3-mediated suppression may not be based on direct binding of the vitamin D receptor to a consensus vitamin D response element in the Cyp27b1 gene but rather may be indirect (7).

what is the best time for sun exposure in order to improve the effectiveness in the production of vitamin d? and what are the adjuvant factors?

Dear all,

I am doing Vitamin D derivatization with PTAD like described in this paper (reaction mechanism is in Figure 3) to enhance sensitivity in LC-MS.

Normally this reaction is done in absence of water and works great, but completely drying it is a pain, so the ability to do the reaction in presence of 10% water (90% ACN) would be great.

So I tried and could observe close to complete disapperance of the unmodified vitamin D species in the presence of PTAD (not in the absence of PTAD). But, the normal modified form is only present in very minor amount, so there must be another reaction. Does anyone has a clue, what could be this side-reaction? Unfortunately, I have only a Triple-Quad, so I cannot really look unbiased with HR-MS.

Hello

As the vitamin D3 is usually in crystallin or powder form and it is insoluble in the water, I want to know how it's possible to mix it in a homogenized way in fortifying process in order not to make toxicity because of the vitamin d high dose aqumulation?

Jones, Glenville: Pharmacokinetics of vitamin D toxicity 2008, Am J Clin Nutr , Vol. 88, No. 2 p. 582S-586S

gives this as a possible mechanism of vitamin D toxicity.

I wonder if anybody has tested if binding occurs at all (with low affinity at most) and if the effect is agonist.

can we treat breast cancer with vitamin d?

Hello As the vitamin D3 is usually in crystallin or powder form and it is insoluble in the water, I want to know how it's possible to mix it in a homogenized way in fortifying process in order not to make toxicity because of the vitamin d high dose aqumulation?

As Vitamin A is a fat soluble vitamin . It has a significant impact on the bone health. I am concerned particularly for the studies in context with the association of the dietary vitamin A intake and its correlation with the serum level of vitamin D in adult males and females ( Age group=30-70 years). Any help will be appreciated.

Do you think there is a correlation between diet and the spread of the SARS CoV-2?

Maybe a diet based on fish, rich in fat, omega-3 and vitamin D is better ?

I wanted to give Cholecaliciferol (vitamin D) dissolved in ethanol orally to Wistar rats aged 5 to 6 months. Majority of the research articles suggests Subcutaneous route however I would like to know if it is possible to administer it orally. if yes, how much will the animal tolerate ?

I understood ingested D2 and D3 are reflected by 25(OH)D and do not understand why this paper uses 25(OH)D3 to refer to cumulative blood levels of vitamin D.

This is an usual phenomena that the poor people remain more longer exposed to sunlight, specially mid day sunlight . Because of their nature of work engagement they have great advantage to get exposure to sun light, does this support /compliment COVID prevention in any way . As there are some research instances where the correlation of Vitamin D in COVID prevention has been highlighted . Any clear scientific evidence on that ??

Hello, I would like to ask about GG genotype of vitamin D receptor. Does it have an alternative name?. I've read about common VDR polymorphisms including BsmI, ApaI, TaqI and FokI etc. But the references did not mention anything about GG genotype. Please help me.

Thank you very much!

Good morning to everyone,

To induce my cells, I use a medium (DMEM, 4.5 g/mL glucose) supplemented with vitamin D, vitamin C and Beta- glycerophosphate.

I used this mix for long, so I know it works fine.

Yesterday, I added vitamin D to the mix and I had an unusual reaction: the bubbles on the surface burst and a strange veil, like a milk skin, appeared and didn't dissolve.

I used the same tube of vitamin D in the previous day, and I've never had problems.

I changed medium and tube of vitamin D, but the problem presented itself again (I added vitamin before the other compounds).

Furthermore, I tried to add vitamin D in BSA- free medium, but I had the same reaction. The vitamin was reconstituted in sterile, filtered EtOH and always kept at -20.

Did someone have the same problem and could suggest me the reason?

Thank you in advance

I want to check the different serum levels of vitamins (D, C, B12) and minerals (zinc, selenium) in two group of study. So my question is that how long can I store the serum samples for tests in -45 C. Is -45 C  temp will be sufficient to store the serum for long term preservation ( about 9 month). Please any one guide me.

See also: Alexander, J., Tinkov, A., Strand, T. A., Alehagen, U., Skalny, A., & Aaseth, J. (2020). Early nutritional interventions with zinc, selenium and vitamin D for raising anti-viral resistance against progressive COVID-19. Nutrients, 12(8), 2358.

Vitamin D is a unique vitamin, which is made from the cholesterol in the skin when it is exposed to sunlight. Thus, it is said that it's important to get enough sun for maintaining the optimal vitamin D levels (unless taking supplements). But, too much exposure to sunlight also has its own set of health risks.

Not everybody absorbs vitamin D3 in the gut as others do. This can cause vitamin D deficiency. So, what causes vitamin D critically low? And what are the right way and the optimal exposure time to get Vitamin D from the sun?

All comments and contributions are welcome.

Vitamin D acts as a hormone and is vital for the health of the brain, for the cardiovascular and respiratory tract, the skin, and the immune and endocrine systems. It is well known that vitamin D deficiency can impair the correct immune response to oral microbial infections, increasing the risk of periodontitis. Moreover, vitamin D plays an important role in the metabolism of bone. In the bone, vitamin D stimulates the activity of osteoclasts and increases the production of extracellular matrix proteins by osteoblasts.

Today, vitamin D is considered deficient when serum 25(OH) levels are 30 ng/mL . Vitamin D deficiency, which can result from inadequate dietary intake together with insufficient exposure to sunlight, is today a worldwide public health concern and suspected to be aggravated more in the current worldwide situation of the pandemic and lockdowns.

Is it any relation between vitamin D deficiency and diabetic complications?

Did Vitamin D has any effect on reducing the growth of tumors in colon.

If yes, Is any proved scientific researches to verify the this effect.

Any other measures for avoiding the risk of colorectoral cancer.

I am going to run a research on synergistic effect of vitamin D and flavonoids plus cur-cumin in decreasing inflammation markers in obese teenager in Shiraz.

and looking forward for any related article or helpful comments.

Regards

Amirhossein asadi

M.s student of nutrition

Shiraz university of medical science

Looking for method of extracting and analyzing vitamin D in foods by HPLC

Aside from the socioeconomic factors, already discussed at length in the media, are there other factors that may increase the susceptibility of the BAME community to severe complications and death from COVID 19 infectionA marked increase of non-Caucasian ethnicities has been observed of healthcare workers who have succumbed fatally to the COVID 19 virus.A second genetic factor could be considered regarding skin colour and melanin content. Skin type influences vitamin D levels where darker skin has greater amounts of melanin, which competes for UVB photons with 7-dehydrocholesterol (vitamin D making substrate). Several epidemiological studies link higher susceptibility to immune mediated disorders with vitamin D deficiency.The non-skeletal effects of vitamin D have been of increasing interest with regard to its association with several diseases and, in particular, its role in regulating the immune system at the cellular level. 1,25-dihydoxyvitamin D3, the active form of vitamin D, has a physiological role in immunomodulation targeting several cells of the immune system and is a key factor linking innate and adaptive immunity and both are compromised with vitamin D deficiency. Hypovitaminosis D is associated with several immune and autoimmune disorders in addition to the classical association with osteomalacia.Several immune cells have the cellular ability to convert 25-hydroxyvitamin D to active 1,25-duhydroxyvitamin D, which promote responses to pathogens in macrophages. Another antimicrobial response is in regulating the maturation of antigen-presenting dendritic cells and this pathway controls T-lymphocyte function. T cells also responds directly to activated vitamin D. Another immunomodulatory function is that cells of the immune system express vitamin D-activating enzymes also enabling the conversion of vitamin D into its active form.The amount of UV exposure is related to the global UV index is also associated with vitamin D synthesis in skin and thus undergoes activation via a binding protein in the liver and kidney. As higher levels of melanin inhibit vitamin D synthesis from UV exposure and the currently low UV index in the UK, this may influence the demographic findings of healthcare workers that have succumbed to the virus.Vitamin D insufficiency or deficiency is associated with regulation of insulin secretion and glucose levels. Deficiency also causes the inflammation associated with adipose metabolic diseases, such as obesity, multiple sclerosis, diabetes, and fatty liver.The vitamin D receptor is expressed in adipose tissue and the vitamin itself is stored there. It is suggested that vitamin D exerts antiadipogenic influence on some preadipocytes and regulates the expression of adipocyte transcription factors, such as, PPARγ, C/EBPα, and LPL. Obesity has also been a factor associated with more severe disease and death from COVID 19 infection.Having already established that genetic factors determining skin colour may influence disease outcomes to COVID 19 infection, it should also be considered that genetic differences in vitamin D receptor genes (VDR), such as, polymorphisms occur frequently in might influence disease outcomes. Vitamin D receptor (VDR) polymorphisms also alter vitamin D levels and can influence disease but is not necessarily a factor differentiating between different ethnic groups.Located on chromosome 12q13.11 in humans, the VDR gene consists of eleven exons. Several polymorphisms of the VDR gene have been identified, but four single-nucleotide polymorphisms (SNPs) of this gene are the ones that have been most studied, namely, BsmI (rs1544410), ApaI (rs7975232), TaqI (T> C; rs731236), and FokI (C> T; rs2228570, formerly known as rs10735810).Another factor in this discussion is that the marked increase of non-Caucasian ethnicities has been observed of healthcare workers who have succumbed fatally to the COVID 19 virus may be related to hypertensive drug treatment regimens, as there is a difference, according to the treatment British Hypertension Society recommendations, for combining blood pressure lowering drugs for different ages and ethnicity, where black patients and older patients tend to be treated with diuretics and calcium channel blockers whereas the younger or non-black patients receive ACEI/ARB and Beta blockers.In a retrospective study in Hubei province in China, COVID 19 patients, admitted to 9 hospitals in a multi centre study, between December 31st and February 29th 2020. 1128 hospitalised adult patients with hypertension and diagnosed with COVID 19 were included in the study. There were 188 patients taking ACEI/ARB and 940 not taking ACEI/ARB with a median age of 64 years.ACEI/ARB was associated with lower risk of all-cause mortality compared with ACEI/ARB non-users (ACEI/ARB group versus the non-ACEI/ARB group (3.7% vs. 9.8%; P = 0.01)).References

Transcription FactorsGlassAntimicrobialsGreen IT

How much Vitamin D3 dose is recommended for Broiler chicken ?

#vitamin D, #vitamin D3, #animal health

Importance of Vitamin - D in human body.

Hello everyone, may I ask about the purpose of adding ultrapure water after incubation for 30 minutes at 80 degree Celsius (under saponification process of vitamin D?

Secondly, what is the purpose of adding 40% ethanol solution during extraction process of vitamin D? Then, during washing step, the ether layer was washed once with 1M potassium hydroxide, twice with 40% ethanol and lastly once with ultrapure water and I am unsure what is their purpose of washing ether layer with these reagents. I have tried to search online but it does not mention on the purpose.

I am looking forward to answers from everyone, thank you in advance!

I want to derivatize Vitamin D analytes usign PTAD for LC-MS analysis, to improve the sensitivites. My vitamin D native and internal standards are in ethanol.

My proposed protocol for derivatised-Analytes:

1. Prepare a concentration of analytes, for example. 100 ppb

2. Evaporate solvent using N2 blow

3. Add 200 uL of PTAD at 1 mg/mL in Acetonitrile

4. Add water 0.8 mL to stop reaction

5. Reconstitute 1 mL using mobile phase.

Is this protocol accurate for mass infustion?

Your valuable suggestions are highly appreciated.

Dear researchers,

I am working onn the influence of vitamin D on cancer.

I was wondering whether ther is Vitamin D free media , since I wanna be completly sure of my negative control without depriving the cells of the other nutrients ( thats why I dont want to use serum free media)

Thanks in advance

Seeking information on vitamin D in pregnancy.

There are reports of an association between autoimmune thyroid disease and vitamin D deficiency. Some patients, following a thyroidectomy for non-toxic goitres, are non responsive to supplementation with thyroxine [T4]. Has any colleague experience of this condition and its possible relationship to vitamin D deficiency

Vitamin C protects body functions due to its anti-oxidant properties, and vitamin D enhances immune functions, in high doses.

Both have been extensively used in COVID-19 patients; there are approximately 20 trials listed on "clinicaltrials.gov" which are evaluating the role of these vitamins either alone or in combination with other nutrients/drugs.

Seeking valuable opinions from RG community for improving decisions when advising patients for the intake of these vitamins in high doses.

I have recently started reading about the possible association between Vitamin D deficiency and an increased prevalence of autoimmune diseases, in particular the association between vitamin D deficiency and an increased prevalence of Multiple Sclerosis. I am interested in hearing different ideas or insights that people might have on this topic

As I know Vitamin D is diluted in fat. But I want to try it for cell culture medium. Any help will be appreciated.Thank you.

I want to investigate vitamin D status in rat models. That's why I need more information about the cut-off values of vitamin D in rats models.

It is cost effective and far more practical to treat with Viamin D supplements across population/ communities to have larger positive impact on health. Countries with resource constraints can't test Vitamin D deficiency in their entire population because of high costs.

Dietary fiber helps in maintaining good gastrointestinal health. There is a trend to consume a diet with high fiber content. On the other hand, a high fiber diet containing phosphates and phytates can deplete Vit D stores and increase calcium requirement. What will be the minimum daily vitamin-D requirement when a person consumes a diet containing high fiber?

Can anyone provide me protocol for Vitamin D estimation from animal brain tissue.

Could photodynamic therapy be a new tool to fight the COVID19 pandemic? Light-based technology can be used to prevent and treat viral infections and is indicated as a method to decontaminate humans that have already received exposure to biological agents, without causing undue harm to host tissue.

When we consider the apparent seasonal differences in the recent COVID19 spread throughout the global hemisphere and the global possibility of viral transmission throughout the world as a result of international travel and globalisation, the apparent low infection rate in the southern hemisphere with apparent seasonal influence on COVID19 spread may be explained by the atmospheric UV levels in those regions. Currently the UK has UV index of 1-2 and Australia has a UV index of 5-12, South Africa maximum 12, several times that of the UK. Seasonal flu epidemics in the Middle East occur at relatively high global temperatures but reduced UV indexes, indicating that UV levels may be a factor in these seasonal epidemics.

Germicidal UV (UVC) light from monochromatic or polychromatic light sources destroys many viruses and research data suggests that UVC has a high selectivity over host mammalian cells and tissues. Further Near Infra Red (NIR) has been shown to cause damage to the protein coat of a virus or bacteria, thus inactivating it using NIR femtosecond laser. This process targets the mechanical or vibrational properties of microorganisms.

If low-level UV emitters from light sources equivalent to safe summer values were placed in public places or where people frequent could this affect the transmission of the virus in the most affected countries?

Light is non-polluting and environmentally friendly, and when containment of the virus is accomplished and the bio-threat has been neutralized photodynamic means will leave no lasting pollution or drug reactions.

Using a very low power visible femtosecond laser to selectively inactivate viruses and other microorganisms has been found to leave sensitive materials unharmed by manipulating and controlling with the femtosecond laser system in experiments.

Obviously, consideration should be made for individuals as UV light is a mutagen to microbes and humans alike and people who are susceptible to UV DNA damage (eg P53 mutations, Li–Fraumeni) should be warned about exposure but if levels are well within safe values similar to safe levels of natural sunlight exposure for unaffected individuals then clearly this is a strategy well worth considering in countries affected by the COVID19 virus. Antimicrobial germicidal sterilisation lamps are already available commercially to effectively inactivate viruses.

McDevitt JJ, Milton DK, Rudnick SN, First MW. Inactivation of poxviruses by upper-room UVC light in a simulated hospital room environment. PLoS One. 2008;3:e3186. doi: 10.1371/journal.pone.0003186.

Sagripanti JL, Lytle CD. Sensitivity to ultraviolet radiation of Lassa, vaccinia, and Ebola viruses dried on surfaces. Arch Virol. 2011;156:489–94.

Fatma Vatansever, Cleber Ferraresi, Marcelo Victor Pires de Sousa, Rui Yin, Ardeshir Rineh, Sulbha K Sharma, and Michael R Hamblin, Can biowarfare agents be defeated with light? Virulence. 2013 Nov 15; 4(8): 796–825.

Dai T, Vrahas MS, Murray CK, Hamblin MR. Ultraviolet C irradiation: an alternative antimicrobial approach to localized infections? Expert Rev Anti Infect Ther. 2012;10:185–95. doi: 10.1586/eri.11.166

Pinna D, Sampson-Johannes A, Clementi M, Poli G, Rossini S, Lin L, Vicenzi E. Amotosalen photochemical inactivation of severe acute respiratory syndrome coronavirus in human platelet concentrates. Transfus Med. 2005;15:269–76. doi: 10.1111/j.0958-7578.2005.00588.x.

Costa L, Faustino MA, Neves MG, Cunha A, Almeida A. Photodynamic inactivation of mammalian viruses and bacteriophages. Viruses. 2012;4:1034–74. doi: 10.3390/v4071034.

Tsen K, Tsen S, Chang C, Hung C, Wu T, Kiang J. Inactivation of viruses with a very low power visible femtosecond laser. J Phys Condens Matter. 2007;19:322102. doi: 10.1088/0953-8984/19/32/322102

Doing an in vitro study with nanostructured lipid carriers with vitamin D and with just vitamin D alone, and just trying to figure out the optimal incubation time so I don't stop it too late having saturated the cells and wind up seeing no difference.

I am doing a study on the impact of vitamin D fortification on bone markers among adolescents aged (11-16 years)

40+ studies have found Sarcopenia to be related to low vitamin D

Vitamin D seems to be an important factor for protecting from COVID-19 and treating patients that are ill with this virus. In brief, active vitamin D (calcitriol) has antiviral activity (e.g., via increasing synthesis of cathelicidin), modulates the immune system and has anti-inflammatory effects (and also damping the "cytokine storm").

Unfortunately, there is no official guidelines that could help the clinicians (particularly, family physicians) in dosing vitamin D for their patients, if the goal is to prevent the COVID-19 infection or at least to prevent heavy clinical forms and complications of that infection (like SARS or sepsis).

Some authors suggest that, for the aforementioned purpose, the 25-hydroxy-vitamin D levels should be at least 40 mg/ml. Therefore, the daily dose ~2000 IU that is recommended for the middle-age adults and ~4000 IU for low vitamin D risk group (the elderly, obese/overweight, those with malabsorption syndromes etc.) are too low. And also there is another problem: for many out-patients at present there is no possibility to perform 25-hydroxy-vitamin D analysis, due to well known reason (many patients should stay at home and avoid visits to out-patient clinics and laboratories, in order to avoid being infected with COVID-19).

So, what should You advise - what could be the starting dose? I guess we should recommend at least 4000 IU for generally healthy adults, and 8000 IU - for low vitamin D risk group (the elderly, obese/overweight, those with malabsorption syndromes etc.) per day. And after 8 weeks the analysis of 25-hydroxy-vitamin D levels should be performed, if possible.

Or maybe we should recommend much higher doses?

I want to know the co-relation between Vitamin D and pancreas. Is there any connecting metabolic pathway or Are there any receptors for VDR on pancreas?

What is the exact mechanism of their co-relation?

As a part of my study, I am supplementing Cholecalciferol (Vitamin D) to c57 mice. As per protocol, I have to give Vitamin D supplementation intraperitoneally. After supplementing Vitamin D, animals are dying continuously. Please suggest me the possible reasons for this.

to find any significant association between childhood celiac disease and deficiency of vitamin D

Calcium and other vitamins are essential for human and disease It is important to remember that it is difficult if not impossible to discuss calcium alone. Calcium metabolism is a collaborative effort between calcium, phosphorus, vitamin D, and protein. Just like a musical orchestra, all of these nutrients are needed to create the end product whether it is a beautiful song or a perfect bone matrix.

Calcium comprises a complex interactive dependency on the actions of other nutrients. Dietary calcium must move across the intestinal lumen during normal digestion to provide a calcium pool to maintain serum levels. However, dietary protein is required to provide serum IGF-1 which in turns interacts with the renal system to transform vitamin D to an active form. The resulting vitamin D receptor transcription provides the necessary substrates to move the calcium across luminal, basolateral, or intercellular compartments as needed to maintain serum levels. Without these interval steps, calcium would not be available to replace and maintain serum pools. Each step requires an interaction with another nutrient [

Calcium metabolism interacts with phosphorus in healthy adults

A recent meta-analysis by Fenton and colleagues illustrated the dependent relationship between phosphate and changes in calcium balance that occur primarily in the kidney. This research showed an inverse correlation between decreases in urinary calcium with increasing phosphate doses while demonstrating that calcium balance increases proportionately with phosphate. Particularly during periods of growth, foods that contain both calcium and phosphorus can lead to positive effects on bone health

so how can we correlate trace calcium and diet to heart disease?

If there any correlation between V.D and Omega3, and if they found are they positive or negative?

I have seen several cases of low growth on children (girls) with no hormonal problem, but high blood cholesterol. Thinking about the similarity of the chemical structure between cholesterol and vitamin D, could there be some kind of causality?

Lately I find many cases of low growth in girls (3-4 years old) who also have high blood cholesterol. Could there be a relationship? I can't find studies that associate these two factors and the similarity of the chemical structure with vitamin D is what comes to mind.

We are trying to encapsulate vitamin-D in chitosan. Kindly suggest me the solubility of vitamin-D in ethanol and the simplest method to encapsulate vitamin-D.

Thanks with regards

There are a lot of published data that showed association between vitD deficiency and many disorders e.g. diabetes, metabolic syndrome, CVD, cancer,...

this is the article I try to add, but when I click on the add box, I'm taken to my own download file. Please advice.

Mary Pittaway

Steven A. Abrams, MD, Connie M. Weaver, PhD, Mary Pittaway, MA, RDFirst Published January 26, 2012 Research Article📷https://doi.org/10.1177/1941406411434581Article information 

Calcium and Vitamin D Supplementation in Adolescents

Crossref DOI link: https://doi.org/10.1177/1941406411434581

Published: 2012-02

Update policy: https://doi.org/10.1177/SAGE-JOURNALS-UPDATE-POLICY

Calcium is considered important,with vitamin D, While the function of vitamin D in regulating calcium homeostasis is well established, there has been growing interest in its role in the prevention of numerous chronic diseases, including cardiovascular disease (CVD). There is mounting epidemiological evidence suggesting that vitamin D deficiency is linked to increased CVD risk. However, the results of previous vitamin D supplementation trials have yielded mixed results in regards to cardiovascular health, and the results of on-going large-scale randomized controlled trials are not yet available. Further complicating the issue, calcium supplementation, which is often prescribed concurrently with vitamin D, has been associated with increased CVD risk in some (but not all) studies. Thus, it is currently unclear whether vitamin D supplements, particularly for those that are deficient, can help prevent the development of CVD. In addition, there has not been uniform consensus regarding the threshold of 25-hydroxyvitamin D levels that constitutes “sufficiency” across organizational guidelines. This review will provide an update on the most recent evidence regarding the effects of vitamin D and calcium supplements on CVD clinical outcomes, summarize ongoing vitamin D trials, so why calcium is still important?

How do I known the annealing temperature of PCR reaction? Primer Sequence is – i> F: ATCTTCCGAAGAATACAAGA and R: CTCAACCCCTATTTAACCTTT . AGAP2 gene , SNPs rs12368653. I work on multiple sclerosis with Vitamin D

Vitamin D is interlinked with metabolic diseases which causes obesity, diabetes, CVDs, immune disorders, gut microbionta issues in human if sufficient Vitamin D is not provided. so, multiple sources of vitamin D are superfoods, sun exposure, skin types and some other sources, so how can we get rid of metabolic diseases through Vitamin D supplementation, Please highlight issues related to vitamain D and metabolic diseases to tackle these diseases.

We use AOAC 2011.11 to test for Vitamin D3 and D2 in cooked meals containing veggies and meat (Beef or Chicken or any kind). Our client says they put 500 IU in the meal but we don't detect anything. Another lab tested the same samples and they don't detect anything either. Any experience in testing Vit D3 in that kind of matrix?

We cant validate an HPLC analythical  method for vitamin D in the finish Pharmaceutical product, due the interference with lanolin.

thats why, we need to analize in the previos mix made in the process.

Thanks in advance for you kindly support.

Hello,

Although there are several papers using vitamin D antagonist like TEI-9647, none these products seem to be available in the market. I was wondering if anybody know any vitamin D receptor antagonist with its supplier.

I also would like to know if anybody has experience with using recombinant vitamin D receptor, recombinant vitamin D binding protein or ELISA antibody available in the market as vitamin D binders(and potentially antagonist).

Thanks

We are spiking human serum with synthetic 25-hydroxyvitamin D and wanted to determine whether the vitamin D binding protein would be able to bind this exogenous synthetic 25-hydroxyvitamin D...