Virus - Science topic

In 2018, I, Reginald B. Little (RBL), wrote a book wherein I proposed multiple stable isotopes of nonzero nuclear magnetic moments (NMMs) play essential roles in living organisms. Prior scientists had reasoned nuclei with spin angular momentum could in some instances be involved in life and affect biomolecules and organisms thereby, but RBL first in 2002 proposed an nuclear orbital angular momentum with such nuclear spin angular momentum as expressed by NMMs and the import of parity of NMMs by positive and negative NMMs by bare protons and bare neutrons. On the basis of such, RBL later in 2013 proposed unusual isotopic distributions in molecules can causes diseases. In 2018, in his book RBL proposed that HIV and some other viruses fractionate stable isotopes for the origin of the virus and infectivity and advancement of the HIV and some other viruses. In 2023 a group of scientists led by Dr. Vincent Balters in France proved RBL theory of HIV fractionating stable isotopes correct as they measured HIV infecting cells fractionates zinc isotopes with HIV infected cells enriching in 64Zn and the HIV virus in the infected cell expressing similar 64Zn enrichment. These scientists measured the surrounding media and cells enriching in heavier zinc isotope 66Zn, 67Zn and 68Zn. In 2024, I developed more my theory from March 2020 of using static magnetic fields, electric fields and electromagnetic waves to stimulate the virus in this case HIV in presence of feeding particular stable isotope to induce mutating the virus, in this case HIV virus. I thereby proposed in 2024 using gamma rays to irradiate HIV host for selective inducing resonance in the 64Zn to selectively stimulate 64Zn enriched HIV infected cells and 64Zn enriched zinc fingers in the HIV virus and capsid in such infected cells for altering the biochemistry by the gamma stimulating of 64Zn in the HIV infected cells and HIV therein for killing the infected cells and mutating the HIV in the cells and even in hard to reach resevoirs. But I have not done much research on nuclear gamma spectroscopy. I read that there is a history of the uniqueness of 64Zn and a few other metals (four or five other metals) for giant dipole resonance (GDR) and such research on GDR dates back to the 1950s. I open this discussion to inquire about the feasibility of selectively using gamma dipole resonance on 64Zn in living organisms to kill HIV infected cells and inactivate HIV. Can the gamma rays be tuned only to 64Zn? Is there any general affect of the gamma rays on other biomolecules, cells and tissues and organs? Thanks Sincerely Reginald B. Little (Stillman College, Tuscaloosa, Alabama)

I have developed an AFM, and I want to capture an impressive image with it. So far, I have only scanned calibration samples. The resolution power and sharpness of the images are quite good. I thought I could image a virus with the AFM. However, I am a physicist. Where can I obtain a non-hazardous virus sample that I can find locally and prepare with my limited knowledge? How can I prepare it?

I focus on animal taxonomy, where everyone uses ancestral range estimation method to reconstruct species migration in the speciation process. I've operated BEAST many times, and have helped some researchers do their Bayesian stochastic search variable selection (BSSVS) analysis for virus spread. I think this method is wonderful that it can even estimate a rough migration trace. Though, I haven't seen any of my realm's studies used it instead of ancestral range eatimation and I want to know the reason. Doesn't this model have a good accuracy across species, or on a MYA-scaled timeline?

Dear experts it may concren,

We want to use stereotaxic injunction technique give AAV for up-regulating a protein in whole cerebella in P0 mice. Firstly, we have to try different injection locations and volumes for whole cerebella being infected. Normally, we should wait 4w to see the virus expression. Do you know someways to visualize AAV spreading area in 12h or 24h for saving time and reducing unnecessary harm to more mice ?

Thank you!

Hello,

I just want to know your thoughts of using the terms "capsid particles" and viral particles. I feel most people use these two terms interchangeably.

They are not the same thing right? since the viral particles can contain genome while also having capsid.

Thoughts?

1. Is there any significant correlation between Chinese university students’ Corona Virus Anxiety and generalized anxiety disorder?

2. Is there any significant correlation between Chinese university students’ Corona Virus Anxiety and depression, anxiety, and stress?

3. Is there any significant correlation between Chinese university students’ Corona Virus and Grade Point Average (GPA)?

4. What are the negative educational and psychological consequences from the Chinese students’ perspectives?

the genome of the virus is around 7 kb. what are the things I should pay attention to when taking measurements in the spectrophotometer and is there a calculation after the measurement like bacteria ?

Hello,

I recently did a plaque assay using MHV A59. L929 cells were exposed to the virus for 1 hour, with slight plate tilting every 15 minutes. I added 1% agarose directly to the diluted virus and swirled the plates to ensure that the virus and agarose mixed well. 48 Hours later, my plaques look white. I am wondering if this would be considered contamination. Any tips and assistance are greatly appreciated.

Hi,

I'm planning to start standardization of absolute quantification of Influenza virus in our lab.

For standard curve, I'm planning to use the Influenza virus stock and do a 10-fold serial dilutions, extract and run qPCR in duplicates/triplicates.

My question is: we usually express the qPCR results as viral RNA copies/mL. Since I'm using virus stock which is in TCID/mL, how can I do the conversion or calculation to get the results of unknown samples in copies/mL? Or what can be done to do the conversion.

Any lead would be really helpful.

Thank you in advance.

Hi everyone,

I'm part of a newly established virology lab working with Cytomegalovirus (HCMV). We're currently facing issues recovering HCMV from the BJ-5ta cell line. We're confident the virus infects the cells, as they become green due to the GFP-tagged virus, but when it comes to recovering and titering the virus, we consistently get negative results.

Has anyone else experienced a similar problem or have any suggestions?

Hello, I am currently establishing a virus infection model in my lab. The cell I use is a vero cell and the virus is porcine epidemic diarrhea virus (PDEV). I plan to use the virus stock without concentration titration to make the new virus stocks, and I will conduct TCID50 analysis of the virus stocks in the future.

First, 0.5 ug/ml to 2 ug/ml TPCK-trypsin test was conducted in 96 well for the condition of virus infection culture (including 0.3% BSA). The virus infection culture was treated after washing twice with plain DMEM using 80-90% vero cells (Figure 1). Then, the appropriate concentrations (0.5 ug/ml, 0.75 ug/ml, 1 ug/ml) were selected and PEDV infection was performed.

Similar to the above process, after washing twice with plain DMEM, the virus stock of unknown concentration was diluted by virus infection culture (by TPCK-trpysin concentration) at 1:10. Finally 5 ml was dispensed into 100 dishes for 1 hour incubation. Next, I washed it twice with plain DMEM, added 10ml of the virus-infected culture medium, and incubated it for 3 days (Figure 2).

What I am curious about is the concentration (0.5 ug/ml or 0.75 ug/ml?) of TPCK-trypsin to establish a virus infection model and the timepoint of harvesting cell supernatant for virus stock manufacturing. What state should the vero cell be in to manufacture the virus stock? Please advise us to establish a virus infection model. Thank you!

resistant to pvy

Dear all, I am studying A GENE influence viral replication and translation OR NOT. After knocking out THAT GENE by CRISPR, I infected the cells (both WT and KO) with virus at MOI of 0.02 and 0.2 . 3 days later, I collected the viral supernatant for TCID50 and extracted total RNA of supernatant and cell pellet (Mixture) by TRIzol. TCID50 showed that virus titer increased in KO groups, however, qPCR showed that virus copies decreased in KO groups. I am so confused which result was convincing, thank you all for kindly help.

Hello everyone.

Various incidence rates are used in mathematical epidemiological models. Representing the rate of spread of the virus. Which incidence rate would be more meaningful to choose for which virus?

Or do you pay attention to choosing the incidence rate according to the virus when creating your model?

M.G.

Recombination within potyvirus species is well documented (OLIVEIRA, Alexandre Moisés Ericsson. Distinct recombination patterns in genomes of potyviruses. 2020, 115 f. Tese (Doutorado em Agronomia) – Universidade Federal de Uberlândia, Uberlândia, 2020. http://doi.org/10.14393/ufu.te.2020.253.). Is there any importance of interspecies recombination for Potato Virus Y evolution?

I've been having difficulties inducing a proper amount of lung nodules in a KRAS-driven (KrasLSL-G12D) conditional mouse lung cancer model following this protocol:

Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase

This is the Nature Protocol paper from Tyler Jacks lab that I have been using as a reference

Reagents

Add 2.5 uL of Ad5CMVCre to 121.9 uL of MEM and mix well.

Add 0.6 uL of CaCl2 and mix well.

Let this mixture sit for ~20 minutes before use.

I have been using 2.5 x10E7 pfu for my experiments. Here are my questions:

1. When making the virus prep, is it a homogeneous solution after calcium phosphate precipitate formation? I wonder if one needs to flick the tube or pipette to mix it well after sitting on ice for 20 minutes and before giving it to the mice.

2. Can I make a "master mix" virus prep for all mice dosed on the same day? Or should I prepare one tube per mouse?

3. Is there a specific reason one must use 2M CaCl2 when making virus prep? Because sometimes 0.6 uL could be hard to pipette.

Does bacteria, a virus, both or neither, cause aging? How? Why? Which?

Mendoza-Núñez, Víctor Manuel, and Ana Belén Mendoza-Soto. “Is Aging a Disease? A Critical Review Within the Framework of Ageism.” Cureus vol. 16,2 e54834. 24 Feb. 2024, doi:10.7759/cureus.54834. “However, although the proposal is qualified with said change, the codes XT9T (Ageing-related) and MG2A (Ageing-associated decline in intrinsic capacity) are maintained in the recently published ICD-11 [10], for which reason the WHO currently considers aging as a disease.”

.https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10894070/ .

I need to perform DNA extraction from amniotic fluid, but I do not have a specific kit for this purpose. I would like to know if anyone has used the QIAamp MinElute Virus Spin kit for extracting human DNA.

I have infected Thp1 cells with lentivirus harboring GFP and my desired exogenous gene with the same promoter. Considering that everything is ok with the design of construct I expect to get 100 percent cells expressing both GFP and my desired gene expression. But, I have a population of cells with GFP expression but no expression of my desired gene. However, there is around 50 percent poulation expressing both GFP and the exogenous gene. By considering that my colleauge was susccessfull in getting the whole population with expressing both genes, there shoud be sth wrong in my hand. I just made one time virus packaging and infected my cells twice with the same batch of virus. Do you have any idea what is the problem.

I have always kept my cells in optimum density.

I sequenced two isolates of a virus and constructed a phylogenetic tree base on their partial sequence. Although both sequences are 100% identical, they are separated from each other by another NCBI sequence that has 99% identity to my sequences.

However, the number of sequences submitted in GenBank is limited (about four sequences) and when I constructed the tree based on a shorter sequence (but more sequences), this problem will be solved.

Is it possible the low number of sequences cause this issue? and which tree is more reliable? a tree with more sequences but shorter length or a tree with low number of isolates but longer sequence?

I know that depends of the person, but i don't understand why.

I would thank you answers

I have virus (viral hemorrhagic septicemia virus) in suspension and the experiment will not involve cells. What level of TCID50 is preferred?

I have done 3 blind passages to concentrate the viral stock in the supernatant without adding TPCK Trypsin. After passage 1 my Ct value for INF A was 36.96. After P2 the value decreased to 33.36. However, I was expecting a much lower value in the mid-20s. I am freeze-thawing the flasks at -20 degrees to lyse the cells and release the virus into the medium. Is it the correct approach? and can I get a much higher titre without adding TPCK Trypsin?

We do this for SARS-COV-2 detection from patients' swap samples. The virus is showing fluctuations in copy number in progress and there is no standard sampling, so we have trouble in deciding about the results of these samples with high Ct values.

Your suggestions would be of great help for us.

Hi,

I'm transducing Ly1 and L363 cell lines using our standard protocol for retroviral transduction. The cells are successfully transduced as evidenced by GFP expression. However, after 4-5 days they start dying off and look really stressed. I'm suspecting polybrene since we've got a new batch. The cells look really weird, irregular and start forming clumps which they don't normally do in standard cell culture. I've tried using the same polybrene concentration (8ug/ml) in standard culture medium without the virus to check toxicity and it appears that it is decreased. Which concentrations do you normally use? Should I make a polybrene concentration curve to find the minimal nontoxic condition?

I have some Covid-19 virus data and aI want a perform a CAI analysis using human codon usage data at CODON-W software.

My question is can I do that? and is there any chance that the presence of an internal stop codon can affect my results? as it is the Whole viral genome.

Thank You in Advance.

I would like to monitor cell viability during an experiment (in a quantitative way if possible) using the very same cells I'm using for the experiment. I'd be using poly IC and viruses, and would like to make sure that the potential effects are not due to cells dying, but they are actual responses by living -but stressed- cells. One option is to use a Caspase assay on a parallel set of cells, but the ideal would be to use the same cells. What are the best, most used methods to test this?

I synthesised from Viral RNA to cDNA.

And next, I performed PCR. But in the gel, no band and only smearing.

I changed primer concentration, template concentration, annealing temperature, template.. but same results were obtained.

So, I want to check my cDNA condition.

Can I check if cDNA exists?

I'm so sorry about my english skills.

Hi,

I have made multiple attempt to cultivate DENV2 and DENV3 virus from frozen stock using vero cells. ATCC recommended using LLC-MK2 cells, but since I don't have the cell line, I figured I could use vero cells since it is known to be infected by the virus. I had to get a new vial of the virus from ATCC after my first attempt didn't work.

Does anyone know how to go about this and how long DENV incubate for upon the first cultivation from frozen stock

I get two different bands from BCMV after PCR

Hey everyone,

I've been working with GRIN lenses (Inscopix) for almost 1 year and still had no luck seeing strong fluorescence on them. When I look at them, I can see good blood flow and, sometimes, some fluorescence, but never enough to get significant conclusions.

I've tried different virus concentrations (currently we're using 1:6), intervals between virus injection and lens implant (2-4 weeks), checking the calcium signal after 4-6 weeks, and still, I can't see a nice fluorescence.

It's important to highlight that when I perfuse the animals to check the virus expression, it is not as high as other regions/mice strains (since we depend on the D1 expression in the mPFC) but I'm still able to mark and visualize the GFP neurons in the confocal.

I've also injected in the striatum since it's another region that is involved in the type of behavior that I study, but I haven't done this immuno yet (probably in the following days).

In light of everything mentioned, does anyone have any suggestions to improve the fluorescence? Maybe some tips for the surgeries, intervals, virus, regions, concentrations etc. Every suggestion is more than welcome.

I'm attaching an example of one animal that I checked the fluorescence.

Let me know if you need further information and thank you very much for the help.

P.S. Relevant information:

- Target region: medial prefrontal cortex (mPFC) - DV -2.3mm

- Lens: Proview Integrated lens 0.5x4.0mm Inscopix

- Mice strain: D1-cre

- Virus: pAAV.Syn.GCaMP6f.WPRE.SV40 (Plasmid #100837 - Addgene)

- System: nVista Inscopix.

I am working on two viruses, when I do PCR for them separately they both showed on gel with their respective band sizes but when I multiplex them only one virus show different sizes and the other did not show at all.

We have a couple of primers but when we make a blast for those primers we see two results: When I use Blast from NCBI, I found many lineages which anniling with many lineages. But when I want to see in which part of the genome has an anniling, it was not possible to find the specific sequence.

Those are the primers:

F: TCAAGGAACTCCACACATGAGATGTACT

R: TGTATGCTGATGACACAGCAGGATGGGACAC

Thanks for your help.

Infected potato plant was negative for PVY, PVX, PVM, PVS. What can it be?

Hello everyone,

I am extremely confused about analysis of qPCR data after virus infection or stimulations, and I need help. I hope I can explain properly.

Let's say we have two different cell lines.

1. HFF WT and

2. HFF protein A knockout.

We infect (or stimulate) these cells with virus and then do IFNB1 and GAPDH qPCR.

So, we will have these conditions:

Let me try to explain what I understand how people analyse this kind of data:

First, you get the Cq values of IFNB1 and GAPDH.

Then, you do (IFNB1 - GAPDH)

Using (IFNB1-GAPDH) values, then you do (Virus infected HFF WT- Mock HFF WT) and (Virus infected HFF protein A KO - Mock HFF protein A KO).

Then you are doing POWER(2; -(Virus infected HFF WT- Mock HFF WT))

or POWER(2; -(Virus infected HFF protein A KO - Mock HFF protein A KO).

My problem is:

Since the mock cells are not stimulated, they usually give either negative or very high Cq value of IFNB1. (for example: 36, 38, 39). And this value is totally randomly changes experiment to experiment. Sometimes Mock HFF WT is 36, and the Mock HFF protein A KO negative. Sometimes vice versa. These also changes between biological replicates all the time. (I usually write 40 when it is negative, which is my cycle number).

In this case, can I just consider all the mock cells will have negative value and consider their Cq is 40 (eventhough I get 35-39). Of course they can have some IFNB1 even they are not stimulated/infected and this can change between these two cell lines, but having different mock results changes the whole outcome.

Note:

My IFNB1 Cq values are usually 20-26 in infected cells.

My GAPDH Cq values are usually 20-25.

I use GoTaq.

I convert total of 400 ng of RNA to cDNA (in 20 uL).

Then I take 1 uL for qPCR, so 20 ng. Can increasing the cDNA amount help me to get positive values from Mocks and equalize them?

Thank you very much.

Hello everyone,

I'm currently working on a project where I need to isolate viruses in culture from incubation with PCR-positive serum samples, but I'm facing the challenge of dissociating antibodies bound to the virus. Does anyone have a reliable protocol or references that could share for pre-treatment of infectious sample for isolation purposes?

Any guidance or suggestions would be greatly appreciated! Thank you in advance for your help.

we plan to detect a cell receptor (protein) that a certain type of virus with a certain serotype binds to it.

we will use Chicken embryo liver cells (CEL) from SPF chickens and make three replicates (three flasks) and one control (one flask). Next, we will infect the treatment group (3 flasks) with the virus and leave the control group uninfected once all flasks are confluent. then, we will store the infected flasks and proceed with the identification of the protein by other downstream tests (IP, SDS-PAGE and mass spectrometry). I wanted to know if:

1. using 3 replicates and one control would be enough

2. is the use of the below hypothesis correct or we do not need to use the hypothesis?

3. what statistical test should be used (in case if hypothesis is necessary) to reject/accept the null hypothesis?

thank you for your assistance,

our null hypothesis is as follows:

Hello all. I grew some cells for virus infection. I infected the cells with CMV (Cytomegalovirus) 8 days ago. The cells have not started lysis yet, but the plate is about to get dry. I wonder if I can add 5 mL of growth medium (DMEM) to the plate containing CMV-infected cells to prevent dryness at this moment (8 days after infection). Is there any risk to do so? Any advice is appreciated.

Hello all. I grew ARPE-19 cells in cell culture and infected them with a virus (Varicella-zoster virus). After the virus reached a high infection rate, I harvested everything in the plate and use freeze & thaw technique to release viruses into the supernatant. Now I want to store my viruses in -80 freezer. What is the composition of freezing medium for VZV? Are DMSO and FBS enough? Or do I need to add sucrose or something else? Any advice is appreciated.

I want to estimate the half-life value for the virus as a function of strain and concentration, and as a continuous function of temperature.

Could anybody tell me, how to calculate the half-life value in R programming?

I have attached a CSV file of the data

A number of definitions are found in publications ranging from 6 days to 14 days. Most frequent definitions mention 7 and 14 days. Some use onset of symptoms as staring point. Others use first detection of virus material as starting point. The end of shedding is usually defined by the last detection of viral material followed by negative sampling results. Usual duration of shedding (about 6 days) should probably be considered when the definition is chosen. Any suggestions?

Cancer as of now is not an infectious disease. The Papillomavirus, virtually, causes all cervical cancers and yet cervical cancer is "not considered" as an infectious disease? Some lung cancers of the smokers could, justifiably, be caused by papilloma virus and or other microorganismes, then why at least these cancers are not labeled as infectious diseases?

This question was extracted from the information from the journal “Tenants of Specimen Management in Diagnostic Microbiology” written by Rajeshwar Reddy Kasarla and Laxmi Pathak. The journal has relayed that most samples in Diagnostic Microbiology used for bacteriological examination or virus isolation were incubated, refrigerated, or incubated. Once the sample is received to be processed, what should be done to bring the sample back to its optimal temperature?

Does anyone knows the pH acceptable range for virus transport medium (VTM) for Sars cov 2 samples? I supose that it depends if you are only testing by PCR or if you need viability for culture but does anyone has experience in this subject?

Found a studie that defends that in normal individuals with no history of reflux or eustachian tube dysfunction, the pH values range from 6.10 to 7.92 with an average pH of 7.03 (SD, 0.67) so i believe that VTM should be buffered around pH 7 (with a variation of plus or minus 1) but need to confirm that.

Thank you and be safe.

Waiting for your suggestions.

Thanks

Uchurappa M

osmosis process occurs in bacterial and other cells.

But is it possible to virus?

Dear Researchers:

Could you please share some simple cures or prevention for COVID-19, Cold, Flu or Influenza, and possibly Other Viruses, and Cancers?

Updates on Oct. 10, 2023: First, many thanks to all contributors to this discussion. Here are some Natural Approaches found from surveying literature in medicine to Boost our Immune Systems against viruses such as COVID-19, Cold, Flu or Influenza infections and to avoid/minimize developing further inflammations in the lungs and hearts caused by some of those viruses:

Give it a try, please! Especially if you increase your Vitamin D level to a required level and consume Vitamin C sources, e.g., oranges, on a daily basis, you can check how rarely you would catch the virus. Or, even after catching the virus, the virus will likely develop very mild symptoms in your body.

1- Daily uptake of Vitamin D pills up to 100 IU per 1 kg weight is safe and very important, recommended by Afshar et al. (2000) and Dr. Hamid Sajjadi in an interview, to RAISE the Vitamin D level in our body to the POINT which is REQUIRED to BOOST our IMMUNE SYSTEMS against Viruses and Diseases including Cancers.

Please read the following article by Afshar et al. (2000) about the importance of vitamin D and the required daily dose of it (Up to 100 IU per 1 kg weight) to boost our Immune Systems.

Please also read the following Review article by Jordan et al. (2022) about the importance of Vitamin D on the level of infection & disease progression for COVID-19. You may find in the article the importance of our Forgotten SUN.

Vitamin D is rarely available in food sources, except in fatty fish which needs to be eaten high enough to get the required amount of Vitamin D for a body.

Another good natural source is daily sunbathing with naked skin; however, in cloudy regions such as Europe, sunbathing doesn't work well.

Vitamin D helps to absorb Calcium in our intestines and thus, in order to avoid excessive absorption of Calcium by our body, it would be better to use Vitamin D pills with Calcium sources such as warmed-up milk and Magnesium sources such as bananas on a daily basis. Because magnesium competes with calcium in our intestines to get absorbed.

Here is a text from A Review article by Kulie et al. (2009) about some of the importance of Vitamin D on our health:

"Vitamin D is a fat-soluble vitamin that plays an important role in Bone Metabolism and seems to have some Anti-Inflammatory and Immune-Modulating properties. In addition, recent epidemiologic studies have observed relationships between low vitamin D levels and multiple disease states.

Low vitamin D levels are associated with increased overall and Cardiovascular mortality, Cancer incidence and mortality, and Autoimmune Diseases such as Multiple Sclerosis. Although it is well known that the combination of vitamin D and calcium is necessary to maintain Bone Density as people age, vitamin D may also be an independent risk factor for falls among the Elderly."

2- Having Good Nutrients including Protein sources, Minerals, and Other Vitamins, e.g., C, A, and E, sources from fresh fruits, vegetables, and nuts. For example, the good sources of fruits and vegetables for these vitamins could be a daily use of 1-2 Oranges for Vitamin C, Carrots for Vitamin A, and Almonds or Sunflower Seeds for Vitamin E.

As Vitamin C is a water-soluble vitamin, the excess of it will be excreted from the body, it needs to be consumed every day to provide everyday vitamin C requirements for the body, as it is the 2nd most important vitamin after Vitamin D to boost our Immune Systems against viruses and diseases.

And, Vitamin B family from grains, poultry, and meat sources.

3- After the infection by those viruses, gargling salty water to disinfect the throat to avoid further movement of the virus into the lungs as the virus may stay in the throat for a few days

4- Inhaling Steamed Fresh Leaves, if not available, the Oil, of Eucalyptus 4-5 times a day for several continuous days to kill the virus in the lungs.

Here is A Review article by Mieres-Castro et al. (2021) about the "Antiviral Activities of Eucalyptus Essential Oils: Their Effectiveness as Therapeutic Targets against Human Viruses"

Australian Aboriginals are very much using Eucalyptus to Treat Infections.

5- Having plenty of Warm Drinks to wash out the virus from our body and dilute the blood to avoid blood clotting.

6- Having enough sleep and daily activities/exercises

7- Kids are proven to have High Immunity Against COVID-19, likely due to having a high amount of Melatonin, the Sleep Hormone, in their blood. So, that is why kids sleep very much as you know.

Melatonin production in our body usually decreases with increasing age. Thus, we may use daily melatonin pills after the infection based on what physicians may prescribe for us.

Here is A Review article by Carrillo-Vico et al. (2013) about the Importance of Melatonin on the Functionality of Our Immune Systems:

8- Avoid Fear/Panic as it Substantially Deteriorates the Functionality of Immune Systems against viruses and diseases.

Here is an interview by Dr. Lauren Deville about How Fear Affects Our Immune System:

Hi, I've done a plaque reduction assay to analyze my possible plant activity, I used a HSV 2 virus at 6,5x10^3 as control, and I count (added file) the PFU... do I need to calculate something or I can make a graph with PFU results?

Akin to the oral "polio vaccine technology", is it possible for a healthy human to build antibodies against a said "bacterium, an example being a Steptococcal infection?".

In my opinion, yes we can. Our bodies have the required armoury "an adept immune system and the relevant enzymes", to tackle bacterial infections.

Please elucidate in detail, how you think our bodies could fight against a bacterial infection.

The previous discussion had been answered so well by "Rizzi". Looking forward to an answer like that of "Rizzi'.

I have been having an issue with my plaque assay for a few weeks now, I am working with a soil sample I inoculate a certain amount of virus PFU/mL into the soil then use some recovery method to recover the virus sample and run a plaque assay using methyl cellulose as an overly but the problem I keep having was mold growing on the sample which prevents seen any place on the sample. I would greatly appreciate any technical advice on how to get rid of the mold from the sample as we don't want to autoclave the soil or use UV radiation I would prefer using any mold inhibitory substance I have used Anti-Anti which it did not work as it only inhibits bacteria and fungi so is not efficient for my work. Thank you.

I am after the sequence for the murine leukemia virus-derived MND promoter (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted), MNDU3. Can someone help me out?

Thanks Karin

I want to design tagman probe and primers to detect a virus.  I had searched the complete DNA in NCBI. 

What should I do next?

What is the standard procedure to design PCR probe and primers in general?

A patient with desminopathy (mutation Thr341Pro DES in a heterozygous state) with the progression of the disease has a decrease in taste and smell, immunosuppression, and an increase in IgA in the blood.

Oddly enough, but all this is characteristic of infections, including viral ones. For example, it is known that if the hepatitis C virus is not treated, then death will occur in 20 years.

In the identified case of late onset desminopathy, muscle weakness manifests itself at the age of 30, and death occurs 20 years after the onset of the disease.

Dear colleagues,

I defended my Ph.D. thesis in October 2016 and now I am looking for a postdoctoral position in microscopy (AFM, TEM, SEM) and biophysics of microorganisms (especially, viruses, I like them :)).

My CV is attached. If there is an open position in your lab, please, write me.

Best regards,

Denis  

Various pandemic diseases have taught us various lessons from time to time, lastly, the spread of corona virus spread has shown how fickle human condition or survival is in face of sudden outbreak of dangerous diseases!

What are the human security implications of 'corona virus spread' around the world?

I have knocked down my gene of interest by lentiviral transduction. I revived the vials and continue growing cells for 72 h without any selection. After confluency, I passaged the cells later 24 hours I have used puromycin 1ug/ml, 3ug/ml, 5ug/ml for selection of transduced cells. After 2 days, most of my virus transduced cells die at all the puro conc. The viral transduction itself doesn't seem to be toxic as cells were growing up until selection. Any suggestions would be greatly appreciated!

I would like to increase the titre of my virus before spin infection to increase my infection efficiency. 

The patient is being kept alive by 100% O₂ input.

Q1

We have animal behavior scores of 4 group, Normal+ctrl virus, Normal+down-regulation virus, Model+ctrl virus and Model+down-regulation virus. It has two factors(Independent Variable): Model and virus. Editors suggested we use two way ANOVA to analyze, and now we obtained main effects of Model (F(1, 56)=201.18, P<0.0001) and virus (F(1, 56)=11.17, P=0.00427), as well as Model × virus interactions (F(1, 56)=16.13, P=0.0007).

If we should continue to calculate? For example, Model+ctrl virus vs. Model+down-regulation virus. We want to confirm the role of virus in Model animals.

Q2

Next, we used chemical drug to treat the Model animals and Normal animal. It has 4 drug concentration. Should we still use two way ANOVA to analyze the behavior scores? We want to know the role of different drug concentration in Model animals. And what do we do after two way ANOVA？

Thanks very very much!!!

Hi, here in my lab I have a kit for RT-PCR with probes (for the real time quantification). Can I run my reaction without adding the probes, in order to obtain en “end point” product? I was thinking about running two reactions, one without the probes and one with the probes, in order to obtain the product amplified but also its quantification.

I want to do this because I have to amplify a gene from a ssRNA+ virus and insert it into a plasmid.

Do you think it is possible? Does the absence of the probes impacts negatively on the Taqman polymerase? Thank you for your help

Physalis rugose mosaic virus (PhyRMV) is a Sobemovirus that causes severe damage to Physalis peruviana L., affecting vegetative parameters, fruit quantity and quality.

It was reported in Brasil and some other parts of South America. We are looking for photo of typical symptoms caused by this virus on host plants, especially on tomato.