Viral Genome - Science topic

Recovering viruses from bacterial genomes involves extracting bacterial DNA, detecting and isolating viral sequences, and characterizing the virus. The exact methods and techniques may vary depending on the type of virus and the specifics of the bacterial system

Thank you for your help

we use a storage duration of 2 year below -30°C for HIV-RNA run controls (<10% decline). I would expect some decline at -20°C is present. Following several preparations over time we have seen there is no general deterioration of HIV-RNA

Guanidine thiocyanate is a stronger protein denaturant agent that is more commonly used in RNA isolation, while guanidine hydrochloride is a weaker protein denaturant that is less commonly used in RNA isolation. Thus, this is the key difference between guanidine thiocyanate and guanidine hydrochloride.

please read whole the answer .

Yes, you can use a hot-start polymerase for amplifying PCR products before sequencing. Hot-start polymerases are designed to minimize non-specific amplification and primer-dimer formation during PCR setup by blocking the polymerase activity at lower temperatures. This feature helps to improve the specificity and efficiency of PCR amplification.

Using a hot-start polymerase can be particularly beneficial when amplifying PCR products for sequencing, as it helps to reduce background noise and improve the quality of the sequencing results. By preventing non-specific amplification, the hot-start polymerase can help ensure that the amplified product corresponds to the intended target sequence, leading to more accurate sequencing data.

There are different types of hot-start approaches available, including antibody-based methods and chemically modified polymerases. Antibody-based hot-start polymerases typically use antibodies to block the polymerase activity at lower temperatures, which is then released during the initial denaturation step of PCR when the temperature is raised. This ensures that the polymerase becomes active only at the optimal temperature for PCR amplification.

It's important to note that the choice of polymerase depends on various factors, including the specific requirements of your experiment and the compatibility of the polymerase with the sequencing method you plan to use. Therefore, it is recommended to carefully select a hot-start polymerase that is compatible with your specific sequencing protocol and follow the manufacturer's instructions for optimal performance.

Using a hot-start polymerase that is bound to an antibody for nested PCR amplification should not interfere with the subsequent sequencing analysis. The antibody that blocks the polymerase activity at lower temperatures is designed to be released and activate the polymerase at the optimal temperature for PCR amplification.

Once the PCR amplification is complete and the desired fragment of the viral genome is amplified, the antibody-bound polymerase will have been fully activated and catalyzed the synthesis of the PCR product. At this point, the polymerase will no longer be bound to the antibody and any remaining antibody will not interfere with the subsequent steps, including sequencing.

For Sanger sequencing, the amplified PCR product is typically purified to remove any remaining primers, dNTPs, enzymes, and other contaminants. The purification process, such as using spin columns or enzymatic purification kits, will effectively remove the antibody and any other residual components of the PCR reaction. The purified PCR product can then be used as the template for Sanger sequencing, and the sequencing reaction will proceed without interference from the hot-start polymerase or its antibody.

However, it's always a good practice to confirm the compatibility of your specific hot-start polymerase and antibody combination with the downstream sequencing method you plan to use. You may want to consult the manufacturer's guidelines or perform some pilot experiments to ensure that the hot-start polymerase you have and its associated antibody do not interfere with the sequencing analysis.

ICP8 or the other homolog in the genome might be what you are after.

Thank you for the files Agnes Dencs . The traces are very strong at one end and very weak at the other. This looks like either you are using too much dna template or too much sequencing primer and the chemistry is running out at short sequences. I would not read sample 8.2 until the sequence ggAgA base 34 up to base 359 CTTgA. I would also trim sample 412f at base 19 ggAgA to base 170 gAAgT because the signal is too strong at one end and too weak at the other. Peak spacing is a problem when the signal strength is weak an we see irregular spacing of the peaks with weak signal and they cannot be trusted.. If we include only those bases that are trustworthy then your odd sequenced base is not included. Iwould not trust the sequencing here. I expect if the template to primer ratio was correct that the odd bases would not appear

You should be looking to produce a VCF (variant call format) file for your samples. This requires all samples to be sequenced, then the reads mapped to a reference genome (same across all samples), then variants called.

Once you have done this, you can get the information you need about each variant position in the genome across all samples from this file.

You can use our SimPlot++ software (available for Windows, Mac and Linux) to perform the analysis: https://github.com/Stephane-S/Simplot_PlusPlus

Keep in mind that cloning and entire viral genome may change the biosafety level of your plants. As your in a viral lab you should already have the paperwork in place for working with the virus, just make sure you update your permissions to include these plants.

Likhith R K You can use the protocol as a starting point and optimize according to your needs.

For a 20microlitre reaction the composition is as follows:

10x buffer - 2microlitre

10mM dNTP - 2microlitre

Random hexamer - 2microlitre

Template - variable

Make up the volume to 17.4microlitre with nuclease-free water

Incubate the above components at 950C for 3mins and cool on ice.

Add the following components:

Pyrophosphatase (1:9 - Enzyme:buffer) - 2microlitre

Phi29 polymerase - 0.6microlitre

Incubate at 30degree Celcius for 18hrs.

Hope this helps. Good luck with your experiment.

I used it for HBV which is circular partially single stranded (Incomplete ds) DNA virus and it works.

Kindly check the following RG link that discusses commonly used techniques for the detection and diagnosis of viruses in clinical samples.

To the best of my knowledge, VTM or UTM media are designed to stabilize whole virus particles (genomic RNA encapsulated in the virus capsid) for transportation purposes and are not recommended for non-encapsulated or naked RNA. There are other RNA stabilizing chemicals for the purpose, such as isopropanol, Trizol etc.

I used Gibson assembly once for my plasmid but I was trying to generate a library of compounds and I did not get enough efficiency, but I did get some clones. You can also try some overlapping PCR steps to generate some of the inserts and then, RD/ligation.

Mutations arise as a natural by-product of viral replication. It refers to the actual change in sequence: D614G is an aspartic acid-to-glycine substitution at position 614 of the spike glycoprotein. Genomes that differ in sequence are often called variants. This term is somewhat less precise because 2 variants can differ by 1 mutation or many. Strictly speaking, a variant is a strain when it has a demonstrably different phenotype. Some of these mutations may make the virus more virulent and spread faster, and some mutations may also lead to the virus loses some of its virulence factors. Mutations are an uncontrolled process that occurs due to faster viral replication...For more information kindly check the following link:

Oxford nanopore technology is good one. You should prepare quality samples like avoid host DNA contamination. Try to chose the correct assembler.

I agree with Yanpeng Li, you need to prepare more individual cDNA libraries with higher sequencing depth, or perform PCR and Sanger sequencing with specific primers designed based on the obtained contigs.

Thank you Abhijeet Singh and Mathew A Beale - this is very helpful.

Hi, did any one try with Genomiphi™ V2 DNA Amplification Kit ?

Amro Hashish I hope you are using BankIt format for submission of this viral genome.

You can add the features by completing input form and define each gene. However, alternatively, you can submit the complete viral genome by sending email to GenBank submission at gb-sub@ncbi.nlm.nih.gov. This would be much easier.

Nice replied by Rajkumar

Make Phylogenetic tree with the orthologues of the viral genomes. Use partition and concatenation technique.

Download the sequence in different formats according to the attached image.

Hi!,

You can download all the raw data from the NCBI using the sra toolkit to your server. The general code is:

fastq-dump --outdir /here you write your directory/ --split-files /home/[USER]/ncbi/public/sra/SRR925811.sra

After, you can use different tools to work with this data, you can perform BLAST, make FastQC analysis to confirm the quality of the reads, and the most common way is creating your own assembly with the reads to identify specific genes that your are interested on. For this, you can create for example a DeNovo Assembly and use different software like SOAP De Novo, Trinity...

I hope this can help you.

Visit the following link please

https://rdrr.io/rforge/seqinr/man/comp.html

https://www.r-bloggers.com/r-function-to-reverse-and-complement-a-dna-sequence/

Dear Ima,

You might find this useful:

Capsid's total charge as well as charge distrubution at a selected radii can be measured. Also, psf files (for further physical properties analysis, molecular dynamics, ..etc) are also generated and deposited at IRAM database.

Hi,

I am not sure about bacteriophage but for bacterial genomes COG, you can try CloVR : http://clovr.org/

Hope it helps,

Best Wishes

Pankaj

Thank you Renata! I will try it.

Thank you so much!!!

To answer Katie's question, there are several kits that combine ribo depletion and globin depletion together. Zymo makes some great kits or your can home brew your own.

Ah. I did. They do not have. Any other suggestions?

@ Ibrahim Bitar I am looking for electrocompetents since i ve read that are muy efficient for large DNA because with an electrick shock the pores are bigger

Hi Chirag,

I'll respond to each question point-by-point.

- Estimating dN/dS and detecting positive selection across such highly diverged viruses, due to their high mutation rate and recombination, will be difficult. I guess this depends on what your question is - is this about molecular evolution across RNA viruses as a whole? Additionally, detecting positive selection can be done site-wise, gene-wise, or for a proportion of sites on specific branches of a phylogeny. My gut reaction is that alignment across all of these is going to be messy and lead to a lot of false-positive signatures of positive selection. But, if the question is compelling enough, there might be reasonable ways to deal with these sources of uncertainty.

- For within-species, there is just not enough information to reliably estimate dN/dS. Usually, population-level work applies nonsynonymous and synonymous nucleotide polymorphism, which is just counting and does not rely on some underlying substitution model and phylogeny. This depends on evolutionary distance among individuals within that species though, so viruses like HIV usually have reasonable levels of evolutionary distance to estimate dN/dS between strains and samples within those strains (see work from Sergei Kosakovsky-Pond's lab and colleagues - the HYPHY developers).

-Your results sounds right. There were only 4 taxa, correct? There will be almost no power to detect selection with a site-wise method such as fixed effects likelihood (FEL). You want at least 10, more is better. I forget where that number comes from, it might actually be specific to some simulations from MEME (another type of test), but the point is that you should not be surprised by your result.

by using restriction enzyme you can do sequencing according to yr desire size of virus DNA.

Could you use fluorescent labelled antibody to viral protein to measure viral concentration as a proxy for viral genome concentration?

for selection presure analysis you can read this book that might be helpful:

Molecular Evolution and Phylogenetics

Masatoshi Nei, Sudhir Kumar

Oxford University Press, 2000 - Medical - 333 pages

Yes Dr Beale, I did in fact converted the nucleotide sequence to AA sequence.

Thank you for sorting it out.

We are using KAPA (now Roche) ltp kit for viral genomes and for 16s Nextera XT and both are working perfectly.

Entecavir is a guanosine analogue nucleoside with activity on HBV polymerase, it is effectively phosphorylated to the active form triphosphate (TP), which has a cellular half-life of 15 hours. When competing with the natural substrate deoxyguanosine-TP, entecavir-TP functionally inhibits the activities of the viral polymerase (priming, reverse transcription of RNA and synthesis of the complementary strand of DNA).

My best regards

Luis Rodrigo

Thanks folks for answers. One metric I found that seems potentially useful for comparing 'relative' abundance of different microbe genomes is RPKM - Reads per Kilobase per Million mapped reads. It's usually used for genes, but I think it could be applied (maybe modified?) to genomes, to correct for both sample sequencing depth and genome length:

RPKM = number of reads mapped to genome/(Length of genome/1000)(total mapped reads/1,000,000)

Can you explain more about the 16S metagenomic data? I may explain more better way. 

The development and validation of a one-step, real-time, and quantitative dengue virus serotype-specific reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay targeting the 3' noncoding region for the rapid detection and differentiation of dengue virus serotypes are reported. The RT-LAMP assay is very simple and rapid, wherein the amplification can be obtained in 30 min under isothermal conditions at 63 degrees C by employing a set of four serotype-specific primer mixtures through real-time monitoring in an inexpensive turbidimeter. The evaluation of the RT-LAMP assay for use for clinical diagnosis with a limited number of patient serum samples, confirmed to be infected with each serotype, revealed a higher sensitivity by picking up 100% samples as positive, whereas 87% and 81% of the samples were positive by reverse transcription-PCR and virus isolation, respectively. The sensitivity and specificity of the RT-LAMP assay for the detection of viral RNA in patient serum samples with reference to virus isolation were 100% and 93%, respectively. The optimal assay conditions with zero background and no cross-reaction with other closely related members of the Flavivirus family (Japanese encephalitis, West Nile, and St. Louis encephalitis viruses) as well as within the four serotypes of dengue virus were established. None of the serum samples from healthy individuals screened in this study showed any cross-reaction with the four dengue virus serotype-specific RT-LAMP assay primers. These findings demonstrate that RT-LAMP assay has the potential clinical application for detection and differentiation of dengue virus serotypes, especially in developing countries.

Sincerely

Luis del Carpio Orantes

Hi,

You may check https://www.thermofisher.com/us/en/home/technical-resources/technical-reference-library/protein-expression-support-center/lentiviral-gene-delivery-support/lentiviral-gene-delivery-support-getting-started.html

regards

I've previously done this by comparing to a plasmid standard curve. If you have your target sequence on a plasmid, you can then dilute that plasmid standard down to a range of 10 - 100,000 copies/uL. You can then estimate copy number from the Ct values you obtain from your genomic template. If you know the copy number of your gene per genome, you can then deduce how many genome equivalents are in a sample.

A key assumption here is that your primer set can amplify from genomic DNA as efficiently as it can from plasmid DNA, so it is important to test this assumption before you try to use it for real. Another caveat is that in normal diploid cells we know most genes have 2 copies but there are exceptions and, if you are working in cancer cell lines, you really can't assume that there are 2 copies per gene anymore.

I don't know if this is the best way to do it but it's worked for me in the past. If you're not totally committed to a qPCR based method, I think this might be easier to do with a NanoString assay.

Hi Dr.

Please find the following chapter in title:

Designing Lentiviral Gene Vectors

Hi

9 mers are too short, it leads to find too many sites matching your request. of course you'll get the right answer, but embedded in a large amount of other sites. for instance the common blast does not allow to search for strings under 20 nucleotides.

fred

Thank you Bruce for your answer.

Because I want to analyse virome and microbiome present in my samples it doesn't seem adapted to use blood derived samples or to try to expanse them on permissive cell lines.

but I keep your idea for specific viral analyses.

Thx

Hi Denisa,

If I add to @engelbert buxbaum's answer, you may have also wanted to know which tranlsation initiation factor are involved in (eukaryotic) ribosomal subunit joining? This topic is far from trivial and still under scrutiny. Apparently, eIF5B and eIF1A play a role.

Have a look at the section entitled

'A closer look at subunit joining' in the review

Biochem Soc Trans. 2008 Aug;36(Pt 4):653-7. doi: 10.1042/BST0360653.

Mechanism of ribosomal subunit joining during eukaryotic translation initiation.

Acker MG1, Lorsch JR., http://www.biochemsoctrans.org/content/36/4/653.long

Best wishes, Ernst

Lots of tools out there depending on your data type and what you want to do with it. Here's a good place to start: https://www.ncbi.nlm.nih.gov/pubmed/25918519

Thank you very much :)

Hello Victor,

please keep in mind that assembling ribosomal rRNA gene sequences from metagenomic/metatranscriptomic data is especially problematic, because of the multiple large conserved rRNA-regions. Because these are conserved on DNA-level even between seperate taxa, the danger of assembling chimeras is very high. You may end up with sequences that actually consist of multiple species but may not always be recognized by chimera detection tools. If you do not have a paired end approach, you should not even bother to assemble the ribosomal genes. And even then I would only use relatively long reads (e.g. Miseq >250bp). Additionally, If you are assembling them with a k-mer based assembler, I would use relatively large kmers (>100bp) that span most conserved regions, to reduce the risk of chimeric assemblies. But even then I would regard the results with suspicion, if I cannot verify my sequences by another independent approach (e.g. sanger sequencing of 28S clones, or reference sequences which are known to occur in the sample), and would prefer to do that only for relatively simple (low diverse) communities.

Non-rRNA genes are less of a problem, because they are usually not that conserved on DNA level (even IF they are conserved on protein level)

Considering these complications, you may want to consider not assembling these rRNA reads after all. Instead you could use the above suggested tools (sortmeRNA is really very good) to just identify the 28S reads, then align them against a reference database to identify different hypervariable regions, and finally just focus on a specific hypervariable region in order to taxonomically classify these reads (basically mimmicking an amplicon approach for that data)

It's a shame you don't have access to an ultracentrifuge, they do make virology a lot easier! However in the absence of one I would go for filtration (such as 0.45 um syringe filters) of your crude extract followed by some sort of precipitation, such as PEG precipitation or ammonium sulfate. I would then clarify by centrifugation, filter over a 0.2 um syringe filter, and that should give you a reasonably pure virus prep. I would then treat this prep with nuclease (such as micrococcal nuclease) in order to degrade any nucleic acid that may have co-purified with your particles (your viral genome should be protected inside the virions), then deactivate the nuclease and extract the viral genome using a phenol:chloroform extraction followed by nucleic acid precipitation. I hope this helps!

I'm not sure but arbovirus are ssRNA virus, right? You could order biotinylated oligos specific for your virus and enrich your preparation using streptavidin magnetic beads.

Hi Ravi!

So nice to see you are so familiar with Nextera kit and its sequencing primer kit. I am going to start my experiments with Nextera XT kit for ATAC-seq. On the protocol of Nextera XT kit, they clearly said: make sure to use Trueseq dual-index sequencing primer kit for single read of double read sequencing of your Nextera kit-prepared libraries. Do you know the detailed sequence of the primer in the Trueseq dual-index sequencing primer kit? I want to double check if it is compatible with the transposase sequence, the adaptor sequence, then design my own sequence for other purposes.

Could you help me with this? Or you can tell me where I can find the detailed information of the sequencing primers.

Thank you so so so so much in advance!

Best,

Lu

See the bottom of the attached file for some possible ideas.

Always a good question.

Hi,

This is all normal. If your expression cassette involves any florescent protein under any promoter (TET inducible or tissue specific promoter) you should see  some fluorescence. The reason is that lentivirus is it self driven by strong promoter to express the RNA.  That is,  the packaged viral RNA span from 5'LTR to 3'LTR and since there is no promoter in LTR (BTW, the promoter which in the 3'LTR has been removed for safety reason since the first generation of lentivirus) a secondary promoter upstream 5'LTR is required for the expression of the viral RNA. Some RNA do not make it to the cell membrane to be packaged,  it's translated to protein like any other RNA. Thus the fluorescence you're seeing! I hope this help.

Abdel

 I will keep trying! Thank you very much!

Hi Heena,

You can optimize the PCR reactions for HPV by adjusting the temperature and the annealing time.

I recommend reading the paper: PCR Detection of Human Papillomavirus: Comparison between MY09/MY11 and GP51/GP61 Primer Systems. JOURNAL OF CLINICAL MICROBIOLOGY, 0095-1137/97/$04.0010, June 1997, p. 1304–1310

I suggest also the pair of  primers FAP 59/FAP64.

I see a lot of answers but before giving mine I need to ask some questions;

Do you know the genome structure beforehand?

Since you are doing RCAI guess that there is little to no previous knowledge about the genome?!

If doing RCA on clinical samples, there is a great risk/possibility of amplifying off-targets such as the genome of the host and/or other viral fragments in the sample.

So, before I answer exactly I would like to know how the sample is composed before RCA?

Betaine. I use 2M betaine (final concentration) in both my RT and PCR and it makes a huge difference! I found it more effective than denaturing at a higher or longer temp. For RT I use Superscript IV.

Vrushali

This new paper can help you  

cheers

Yes, we do not have any problem to detect viral RNA in dry mosquitoes kept at room temperature for some weeks. Full genome sequencing works as well.

hi, we have quite good success with this protocol for metagenomic RNA seq from stool, hope it will be helpful to you.

good luck

paolo

You please refer to the links below to obtain certain valuable informations:-

1. http://www.sciencedirect.com/science/article/pii/S004268220900422X

2. http://www.biomedcentral.com/1471-2164/16/117

3. http://www.pnas.org/content/107/4/1606.abstract

What kind of virus do you have? Keep in mind that there is a vast literature on discovering viral genetic diversity with deep sequencing. A couple of reviews are linked here.

 This article may be helpful: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC290248/

I've noticed Raskas's paper published in 1983.  And I haven't found any paper reporting intron in 3UTR in any other gene during 1977-1983. Then it seems that is the first paper.

Thank you very much.

Just a quick note in regards to controls that you should also include a negative extraction control (water sample that is extracted in the same way as your DNA) on top of your regular NTC. If these are positive then you should take more care when changing pipette tips, the use of reagents on your bench that may be contaminated (especially buffer/water used to elute nucleic acids) etc.

Thank you, Alsamman. I am still newbie in bioinformatic things. Hope I can did it using your suggested software :-)

Hi Michael,

I would give MUMmer3 a try. This is typically very fast and provides you with lots of options to look at the overlap of the viruses.

Best

cacgcacccacccagccgcgcccccggcacacccaacccgacgccggcgcgggacggggc /cut/

tccattccgggccgtgtgttgggtccccgtggggcgggggggtgtttttagcgggggggtgaaatttgga

from:

as shown in their nice figure:

Do you know how?

These authors describe a qPCR test: http://www.ncbi.nlm.nih.gov/pubmed/22651389

An end-point PCR is described in this paper: http://journal.isv.org.ir/files/site1/user_files_bc468b/admin-A-10-1-74-63c0d26.pdf

Hope it helps.

The general dogma is that HSV replicates in the TG whilst establishing latency early after infection and then stops replicating once viral genomes become episomal and chromatinzied. It is thought that after latency is established the only time the genome replicates is upon reactivation, which is typically a stress response. Each cell body within the ganglia may have a different genomic copy number.

Jing-Zhe, It is known for several well-studied virus groups that a single gene can deternine its host range (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC230224/; http://www.nature.com/nature/journal/v270/n5638/abs/270617a0.html; http://www.ncbi.nlm.nih.gov/pubmed/8009842)

But, if your virus/phage is from new class you will not be able to figure out its host organism until you find it by experimental way. Phenotype goes first, genomics - second!  Sure, you can find some host -related sequences in the viral genome, but this method will work only if host species have known complete genome sequence.

It depends on the kind of virus. Enveloped viruses borrow their membranes from the cell membrane of the cell they budded from, and are easily disrupted. Some enveloped viruses are a bit tougher than others. That extra stability they get because of the intra-membrane proteins and how connected those are to the internal capsid, as well as how regular it is. 56 C is more than enough for disrupting the envelope, and for enveloped viruses, the envelope is a critical part of their structure and entry mechanism. As an example of the very easily disrupted, HIV has its gp120 protein just floating around randomly in the membrane surface.

Enveloped viruses are also sensitive to osmotic pressure, since the fluid inside of the virus envelope is generally saltier (and because of that, more hygroscopic) than fresh water. The envelope can swell and burst, inactivating the virus. In air and on surfaces, that saltiness can help the virus stay stable, by helping the virus keep from desiccating as long as the humidity is not too high. Thus, distilled water will be a bit more effective at inactivating of enveloped viruses than tap water.

Non-enveloped viruses vary in how robust they are based on multiple factors, as discussed by Victor Weiss above. The capsid subunits are held together by hydrogen bonding. How strong those hydrogen bonds are will determine the temperature at which the capsids start coming apart. Essentially, what is happening at 56C is that the capsids are melting, and the subunits are denaturing somewhat. But at 56 C, when it cools down, the proteins should fold back into their normal conformation and reassemble into capsids, which will leave the nucleic acids outside, and in the case of ssRNA or ssDNA, the nucleotides will be floating around stuck to itself.

Hi Michel yes, A T7 promoter and poly (A) tail should be added to the 5’ and 3’ends, respectively 

Treat an aliquote of your viral stock with protease+ DNAse (Rnase-free preparations) and another with protease+ RNAse ( DNAase free preparations); purify or precipitate the expected RNA or DNA and run them on gel hoping to see intact RNA in your first sample or intact DNA in your second sample. There are options to inhibit RNA or DNA synthesis  too and ask the question if your virus propagates when DNA synthesis is inhibited ( Yes will suggest RNA genome). Probably it is most straightforward to do the experiment in the context of plaque assay.

I have never been working with viruses from water. In my short experience with plant virus.

But if you have purified viral particules, in my opinion a "Random PCR" approach will be useful for you, briefly consist in generate a random cDNA library from your encapsidated RNA using NNNNNN plus Universal primer and PCR with a reverse anchored.

I recomend you read this ones:

Uhttp://www.ncbi.nlm.nih.gov/pmc/articles/PMC336952/pdf/nar00085-0274.pdf

Once you have been generated the library, proceed to sequencing by sanger or maybe NGS technologies (Deep sequencing), in both cases biofinformatic assembly of sequences de novo assembly or mapping against sequences. This same methodology ramdon PCR work fine with dsRNA as an template, example: "dsRNA accumulation is strongly related to plant viruses"

Another methodology I want to suggest to read is siRNA deepsequencing, since few year has become in a very efficent apprach for virus discovery.

Good luck.!

The comet assay cannot provide any information about DNA fragment size, because the electrophoresis step is too short to allow for any real separation. Running the electrophoresis for too long will cause false positive tails on the control cells. It's better to perform a pulse field if you need to know specific fragment lengths. Here's an article that explains this and more about the comet assay: http://atm.skkumed.ac.kr/protocol/comet%20assay%202008%20nature%20protocols.pdf

I have experience sequencing viruses via NGS. The 5' and 3' ends are often under represented, and in many cases you may still miss a handful of nucleotides. As mentioned above, the TdT approach is likely your best best.

Uniprot has databases that are taxon-specific. Here's a link for their virus database: http://www.uniprot.org/uniprot/?query=taxonomy%3a10239&format=*