Transcription - Science topic

I use the MEGAscript T7 Transcription Kit (Cat. no.: AMB13345, ThermoFisher) for in vitro transcription of linearized plasmids. However, I have measured a high concentration of DNA in my mRNA after in vitro transcription. I use 15-20 ng of plasmid for the reaction, and I have already incorporated a second DNase treatment step in my protocol, but it doesn't seem to remove the DNA. I use DeNovix for measurement of concentrations. Anyone who has experience with this? If yes, is your mRNA still functional even though DNA is present?

I would like to design a few couples of primers to amplify several define transcript region of IgG gene. With forward primers in the V or J region and reverse Primers in the constant region. However, I can not check the primer specificity using NCBI primer blast. Do you know which platform or sofware that I can do primer blast for IgG transcript? Thanks and regards.

Hi everyone,

I got an exon level counts matrix (obtained via the Bioconductor recount3 package) and I would like to transform the exon counts to an estimation of transcript abundance.

Does anyone knows a way of doing this?

Hello,

We have a gene that is modulated by the binding some transcription facors (TFs). We recently found that one of these TFs is mutated and we want to know if this TF can still bind to that gene. Is there any software or tool to figure this out?

Thank you in advance.

from where the transcription of the gene in the vector starts , is it always from 5 to 3 or it depends on the direction of the promoter .

I did a knockdown, after checking the level of protein expression with Western blot, I got some percentage let's say like 60 to 70 % of knockdown, but when i tried checking with qPCR to check the transcription level it was as if there was a complete knockout, what could have been the reasons, I am confused can some help me with an explanation? You help will be highly appreciated.

Analysis of qualitative data requires intensive reading of the transcripts, field reports, diaries, journals, and other documents. It is a continuous and to-and-fro process. What changes do you, as a qualitative researcher, face during data analysis and how do you overcome those challenges?

Dear colleagues,

I'm currently running some in-vitro transcriptions with the HiScribe T7 RNA Synthesis Kit by NEB. As Templates I'm using a purified PCR product as a run-off template. I properly thought about my Promoter sequence, bearing all the necessary bases not only for the binding but also for the initiation site. I'm expecting a ssRNA of roughly ~750-780 nt for my transcripts. However, my Urea-PAGE looks like displayed here. I can't really explain all the additional bands...

After the in-vitro transcription I'm using a RNA clean up kit and purify my transcript prior loading on the gel. I don't think it's unspecific degradation, the band look to sharp for that.

I'm looking forward to your suggestions and expertis

I know many websites have simple tools like transcription and translation available, but are there any analysis tools that researchers need that either do not exist or are not publicly available? It could be anything from algorithms to visuals. Thanks!

can a DMRT( Duncan's Multiple Range Test) result in 11 columns for which i get compact lettering till 'k' (starting from 'a')?

Software used : SPSS v25.0

significance values for few columns exceeds 0.05. and few are below 0.05.

I'm working on a qualitative study that will include 30 interviews conducted online in Arabic. Can you please recommend reliable transcription software that supports Arabic? It doesn't have to be free

Get more than 80% - 90% of transcription efficiency

Transana is a software for qualitative research that enables researchers to work on authentic data that is recorded or videotaped. If anyone has employed this tool, I would be interested in learning more about their experience with the tool and its effectiveness in managing and analyzing complex qualitative data in their studies. Furthermore, the software is with different versions, so I am confused about which one to use.

I want to produce 29kb mRNA using the in-vitro transcription method. It will be used for protein production in mammalian systems. I found RiboMAX large kit that can make a 27kb transcript. However, I did get any information about its application on protein production in the mammalian system. Could anyone suggest the best method or kit to produce this long-size mRNA transcript?

Hi all, I am trying to extract RNA from 12 well plate and so far the yield obtained from trizol/chloroform protocol is OK.

After that I tried to do DNAase step (using NEB DNAse I) but I found that it does not allow cDNA transcription.

I don't know if it was the inhibition step 70°C x 10min of DNAase activity or smth else.

Do you have any similar experience? if yes, any trick to share with me that can help to do the DNAase step without inhibiting the reaction downstream? Thanks a lot

Dear all,

Thanking you in advance for your attention, I would like to ask you two questions regarding an electrophoretic run on 2% agarose gel:

1) I did an electrophoretic run of the Real-time PCR products (with Sybr green). Although the band of my target product is evident, I notice some very slight sub-bands (indicated by the arrows) which, according to the molecular scale, could have a size of 500 bp. I designed the primers by myself, and making a blast they are specific for my gene of interest . What do those sub-bands represent? Can they affect the analysis of fluorescence?

2)The same primers gave me products of a different size (in the photo, the circled bands). The primer targets a gene that has 3 transcript variants. Each well has a different individual (animal). Could those two circled products be a transcript variant?

Thanks a lot for you precious help,

Best Regards

Matteo

In allotetraploid B.napus plant transcriptome, Based on pacBio 3rd generation sequencing, one gene has evidence of Alternative splicing (AS) in it. This gene has four exons and produces 2 distinct transcripts. The structural analysis of two transcripts shows that transcript 1 is produced by using only exon 1 and 2 of gene, whereas, the transcript 2 is produced from exon 3 and 4. Therefore, these two transcripts have no overlapping sequences between them. I have to verify the presence of these two transcripts. Is there any other other strategy  to amplify the these two transcripts at once and show the evidence that these two transcripts are definitely transcribed from the specific gene, except using the transcript specific primer for each transcript (using transcript specific primer will just help me detect that transcript but will not provide enough evidence that it is originating from this specific gene.)?

"during both the sample preparation and computational analysis phases, at which imperfections and biases may be introduced. These limitations may affect the ability of the experiment to address specific biological questions, such as correctly identifying and quantifying which of multiple isoforms are expressed from a gene8 . This example is particularly relevant to very long, or highly variable, transcript isoforms such as those found in the human transcriptome; 50% of transcripts are >2,500 bp long in humans26, with a range from 186 bp to 109 kb" the Author of the Artical

RNA sequencing: the teenage years - PubMed (nih.gov)

31341269

transcription and translation of eukaryotic and prokaryotic cells

Hello,

I am designing a plasmid with an SV40 promoter-driven antibiotic resistance. Does expression from an SV40 promoter require a TATA box upstream of the transcription start site? The original vector had a TATA box at -30, however this is lost in my cloning strategy. With my current plan, the transcription start site is just 8bp from the end of the SV40 promoter. Will this allow for expression, or is a TATA box needed?

Thanks!

I am working on the transcription of an RNA strand. More than knowing all the characteristics of my RNA, I would like to know if the transcription was successful or not. What methods can be used for this? My RNA strand should be 21nt long. Is it possible to use gel electrophoresis or spectroscopy?

Hi! I'm planning on using methyl-3-nitro-1-nitrosoguanidine (MMNG), for inducing transcriptional mutagenesis. From my understanding MNNG causes the formation of O6‐methyl guanine (O6MeG) inducing thymine mispairing during DNA replication. However, is it likely to for MMNG to to lead to other mispairing that may occur in low abundance? Or are there any disadvantages to be mindful of? I want to ensure that I can accurately quantify mutation patterns.

Thank you for your insight :)

Can anyone recommend a software that could be used to help in Arabic interviews transcription/ translation? I am currently using Trint, but unfortunately it is not accurate.

I'd like to know that what are the different ways to know/identify whether a particular Gene is expressed or not ?

Few points from my side are :

1) identifying it's corresponding m-RNA transcripts level.

2) identifying the protein that was produced by the expression of that particular Gene.

Any other points ?

I was reading a research article where I found this term but unable to understand. AK5 gene in 2009 was reported to have two transcript variants i.e. AK5p1 and AK5p2.

in transcription process why doesnt need primer for bulid mRNA

Hello everyone!

I have interesting question asked by my professor and I could not find relevant answer anywhere.

Why are we seeing up and down pattern on transcript abundance? Example RNA seq data for a gene from a rice transcriptome data base is attached. LOCUS ID is highlighted in yellow and transcript abundance is in below three samples after drought treatment.

The question is ,why the signal level is not uniform on Exons? is it low signal reads? Why there are gaps or sudden fall in signals? ( which are Marked in Red arrows) How to read and understand this? and I know this is the common pattern in RNA-seq data, but I don’t know why? It’s an interesting question asked by my professor! can any bioinformatician help me understand this? Thanks in advance.

Hello scientists, I was hesitant to ask such a question because it is somewhat simple, but in the end there is no shame in the learning process, so, What consumes more energy, the polymerization of coding region or its translation?

and how to calculate the energy required for transcription?

Thanks in advance.

I performed an RT-PCR on my gene of interest hoping to see which isoforms are present on the mRNA level. Literature suggested there should be 4. To my surprise, i see lots (too many to count) of transcripts of various sizes. I isolated about 50, sequenced them, and aligned them to the original gene cDNA. Majority of the transcripts I isolated have chunks of sequence missing at seemingly random places, with random chunks of exons would be missing here and there. some has majority of exons missing.

I am wondering if transcription often produce these aberrant transcripts or is something unique going on here?

I will be interviewing clergy members.

Why are mouse chromosome Y transcripts (avg) significantly shorter than its other chromosomes' transcripts? The calculation & comparison of the average lengths were done with t test according to the entire UCSC mouse genome. Any ideas?

Hi to all.

My question is how can I optimize my RTqPCR if the cDNA dilutions ended up in similar Cq?

I synthesized my cDNA from 350 ng total RNA, assuming 1:1 production I should have 350 ng cDNA in 20 ul right? Then I did a dilution of 1/2, 1/5, 1/10 and 1/20 (I know the first three are consider quite a lot to be used in the run) and used them in a 20 ul run. The gene is a ref. gene: GAPDH. Interestingly the Cq values aren't that different between the dilutions (~29, ~30, ~31 and ~30). Obviously these aren't good values but I don't know what can I do to optimize the run.

I’m going around in circles trying to find anything on APA (7th) recommendations for formatting supplementary materials such as an interview transcript. I am a student so one of the general recommendations for a student paper is double spacing for instance, but in an interview transcript, which is over 10 pages long with single spacing, I’m afraid the document will be unnecessarily long and hard to read. Are there specific rules regarding formatting an interview transcript?

While trimming the adaptor and low quality RNA-Seq illumina paired end reads in Trimmomatic, I have got more Forward only survive of about 40 to 50%. This study is for estimate the transcript abundance (DEG) at various condition. How is the possibility to continue further...

1. USE singleton reads (R1-For only)

or

2. Only use both paired (survive) high quality reads (50% of the reads)

Any suggestion, Thanks in Advance

by, Ellango R.

I am working with a non-model organism and we generated a complete genome that is annotated. How can you determine the transcriptions start sites in this genome? Is there any bioinformatic way to do it (software)? or Do I need to do an experiment to identify these sites in the genome? I know that CAGE seq and CHIP-seq are good techniques to do that. But I am not sure if there is a computational tool to identify these sites.

Hi there,

I'm trying to design primers to detect CRISPR-mediated KO using qPCR (as described in this paper: ).

I designed a few pairs of primers and neither of them show any signs of amplification.

As an example, this is a pair targeting the ITGA2 gene (exon 2):

Primer_FWD ("watching"): ATTGTTGTTTGGCCTACAATGTTG (target +/ 53026780)

Primer_REV: CTGCATAGCCAAACTGTTCACT (target -/ 53026816)

I used the following transcript for the design:

Imported from genome: GRCh38 (hg38, Homo sapiens)

Gene: ITGA2 (ENSG00000164171)

Location: chr5 52989326-53094779

Transcript: ITGA2-001 (ENST00000296585, CCDS3957)

This specific pair is a little low on GC%, but others have GC% within the recommended 40-60% range. However, neither primers seem to be working.

Apart from GC%, these primers comply with the recommendations for PCR primer design published on various websites. Yet, something isn't right - on qPCR amplification curves are dead flat after 40 cycles (I've tried a few template concentrations and annealing temperatures with no success).

Would anyone have some suggestions on what I do wrong? And what can I try?

Thank you in advance.

What are the best assistive software that you're using to facilitate the transcription of qualitative data? I use soundscriber (a free tool). I am looking for better options.

Thanks.

I conducted data collection (20 interviews in Sepedi Language) as part of my Ph.D. studies. All interviews were transcribed then translated to English.

So i would like to know that out of 20 transcripts how many should i back-translated to Sepedi to ensure/check accuracy?

Any literature recommendations will be appreciated

Can someone recommend a plasmid that carries two transcriptional terminators ? We'd like to insert two adjacent terminators into a construct we have made to prevent any transcriptional readthrough. We are currently using one lambda oop terminator, but we'd like to improve upon this, if possible.

Unfortunately, we are unable to synthesize tandem terminators by gblock due to their structural complexity (IDT won't make them) and we have had problems amplifying terminators by PCR likely for the same reasons.

Our ideal strategy would be to cut an clone a DNA fragment bearing two tandem terminators. Any recommendations?

Hi all,

I'm currently in the process of working on DIG-labeled mRNA probe transcription. I've done this successfully plenty of times, but the process never fails to create new ways to stump me, and I'm having trouble solving this one. I ligated my fragment into a PGEM T Easy vector and digested with SpeI for T7 and SphI for Sp6. I checked to make sure neither recognition sequence is in my fragment. I sequenced my plasmid after miniprep, and the sequences were perfect. The digest looked fine (photo attached) with the SpeI and SphI fragments both at the same, correct size. Only weird part is that the uncut plasmid ran slower that the cut plasmids, which has never happened. Issue persisted with replication. But that's aside the point. My PI told me to transcribe anyway since the cut plasmids were all the correct size.

I first transcribed last week, and the T7 looked perfect. Sp6 did not. I know that RNA can take multiple conformations, but I've never seen the bands look like this when that happens. Our T7 polymerase is pretty new, but Sp6 is a bit older, so my PI had me order a new tube. I tried again yesterday, re-transcribing both T7 and Sp6. T7 still looked perfect, but Sp6 did the same weird thing, just more intensely. It's hard to see on the gel because the second Sp6 transcription is so bright, but the bands are the same sizes for the Sp6 probe on both runs.

If it's a case of multiple conformations of RNA, I don't really understand why only Sp6 would be displaying it in both rounds of transcription. I have a feeling that my PI will suspect issues with the restriction enzyme and have me order more, but I want to explore any other avenues.

Any thoughts about what's going on here will be greatly appreciated.

We have a gene with two isoforms, one with a longer 5' UTR and one with a shorter 5' UTR. It's been demonstrated that which isoform is predominant changes over development.

We want to study how the UTR might influence the translational efficiency of the transcripts. In the past, we tried to create a luciferase fused construct that had our UTR, our gene, and luciferase. However, the results were somewhat messy and hard to interpret and we questioned whether the luciferase construct itself was affecting translation.

Does anyone have any experience with alternative methods of studying 5' UTR's effect on translation, or have better experience with luciferase constructs?

I recently did a transcriptome assembly using Trinity and I got one Fasta file. I want to do further analyses on unigenes only. My question is how do I identify the unigenes from the transcripts and have a Fasta file of unigenes only?

I have been trying to get RNA via in-vitro transcription of a G-rich DNA sequence after PCR amplification since 5-6 months. But i fail to observe any RNA bands under UV light after running the in-vitro transcription product in Urea PAGE. Sometimes I observe a faint or a smeared band after EtBr staining. Can I get any suggestions about the same?

Dear community,

does anybody have experience with cloning two genes in opposing reading direction so that the genes theoretically could share just one bGH polyA signal.

I think the inverted polyA signal for one of them should not make a problem, since the polyA has no "direction". I am just concerned that the polymerases might sterically "crash" when both genes are transcribed at the same time but wouldn't that also terminate the transcription? :D

prom->tDTomato->bGHpoly(A)<-PuroR<-prom

Best!

I am not able to visualize anything on agarose gel except primers and gene ladder.

Hi everyone,

Please correct me if the information mentioned here is incorrect. In the animal mitochondrial genome, there are no introns coding sequences.

I was wondering whether the primers designed for a mitochondrial gene (DNA sequence) work for the cDNA for its mitochondrial transcript?

Looking forward to a discussion!

Thanks in advance.

I have a big problem in my transcription. After taking my cDNA and PCR of my gene of interest, I did purification and miniprep. My results shown everything are great (nanodrop and agarose gel). But I can't have my RNA. In my agarose gel, I see a trail.

Why is there a bright smear below my RNA band from in vitro transcription?

I have only observed it for my longer transcript.

...

I want to publish the (qualitative) data that is associated with my research paper and have explored journals like Data in Brief and Scientific Data published by Elsevier and Springer respectively but they could not consider the data (descriptor) manuscript I submitted to them due to technical and situational reasons. Other journals I have seen are not suitable as many of them either consider other types of data or are based subjects different from mine. The data based on social research and consists of the interview transcript on pandemic policing and public (compliant) behaviour.

Are there any bioinformatics tools or software available that allow verifying if the processed transcript acts as a lncRNA?

It is about Molecular Biology. Please answer up. Thanks

The primers designed should be allele specific so as to amplify either my WT or Mutant transcript and not both.

I've been trying to do invitro transcription of 70 bp long DNA oligo using T7 RNA polymerase to figure out formation of G-quadruplex structure. The following components are added to the master mix for 20uL reaction volume:

1. 200nM ds DNA (prepared in 50mM tris and 10mM MgCl2),

2. Transcription buffer {trisCl (pH 8), 2mM spermidine, 50mM KCl, 10mM MgCl2, 10mM DTT} followed by

3. 40% PEG 200 and at last 2mM NTP .

I have successfully carried out transcription using this method earlier but now gradually the transcription seems to be having an issue.

The problem is when NTP is added to mixture having peg 200 , it immediately forms white precipitate. I tried repeating this in absence of peg and seen that there is no ppt formation. Not able to understand why is it happening. Is there any report of interaction of peg 200 with NTP?

After EDTA addition, the precipitate disappears. To check if DNA is precipitating due to Mg2+ chelation, I have also made the reaction mixture in absence of DNA , still I can see precipitate formation.

Can someone please help.

Note: I have assembled the reaction in room temperature.

Thanks in advance.

Hello,

We are currently evaluating software for the analysis of transcribed video recordings of dialogues. Coding units are episodes, and we want to quantify codings as duration of time. In previous studies, we successfully used Transana for similar analysis.

We are now evaluating to use MAXQDA instead, which does not assist reports of time duration of codings on transcripts, but only number of characters. For the export of duration data, coding has to be on the video, which does not meet standards for linguistic discourse analysis.

Does anybody know studies and/or have experiences with number of characters instead of duration as value for the quantification of transcript-based coding of dialogues?

Thank you for sharing your knowledge and experience!

Kind regards, Annelies Kreis

Im using mMESSAGE mMACHINE T7 ULTRA Transcription Kit to transcribe my DNA. It produced 30 ng/ul which is 750 ng although the kit promises to yield atleast 15-20 ug of RNA. Even the control DNA provided in the kit produced 6.2 ug RNA. I followed the protocol as it was instructed. Kindly share tips to increase the yield upto 10 ug atleast. TIA!

I am trying to express a short RNA sequences in the nucleus in Drosophila. Are there any UAS-based expression vectors in flies that do not have PAS in the 3'? Or on the other hand, is it possible to just express a transcription termination sequence at the 3' of my transcript so that my transcript terminates before reaching the PAS? I don't want to have to mess with the vector backbone itself (removing PAS...etc.). I am quite new to molecular work regarding vectors, so if I am missing something important, under a misunderstanding of sorts, or if you have good suggestions, please let me know. Thank you!

Hi, does anyone know of any post-transcriptional mechanisms that could explain no change of the transcript (mRNA) but still impact the protein?

so modifications that may show the protein's expression low in mRNA but the protein is still expressed in high amounts after translation?

I have in my RNA-seq quantification data from Arabidopsis obtained by mRNA-seq polyA enrichment library transcripts encoded by chloroplast and mitochondrial genes in significant DEG. How is it possible, if chloroplast and mitochondrial transcripts do not have poly-A tail? Are these data reliable or contaminants which should be ignored?

Hi guys,

I'm currently doing a research in BCR-ABL. I'm trying construct the Fusion transcripts that causes philadelphia chromosome. For example, presence of fusion transcript e1a2 leads to ALL. In order to create the fusion transcript, I designed primers to amplify the exonic regions of BCR and ABL individually and once amplified, to fuse the amplicons using BCR/Forward and ABL/Reverse primer.

Unfortunately, the individual gene amplifications hasn't worked and it just gives smeared appearance for a specific temperature. The template for the PCR is cDNA synthesized using MMLV.

Appreciate if anyone could help me with troubleshooting this issue.

The PCR cycle is,

Initial denaturation 95c/5min/1cycle

Denaturation 95c/30secs

Annealing 60c/64c/67c/ 30secs

Extension 72c/1minute

Final extension 72c/5minutes/1cycle

Hold 4c/infinity

Denaturation, annealing and extention went for 35 cycles in veriflex.

The gel image is attached for reference.

Hello! I have been trying to produce IVTs from gBlocks, starting amount is ca. 100/120 ng of DNA.

When the reaction is done, I do a DNAse step, purification on column and then go to Nanodrop. When I measured the samples, I had a concentration of 1000-2000 ng/ul and a A260/A280 of more than 2.20.

I found this very weird, so I repeated the DNAse step on the IVT sample and purification again, but the situation didn´t change. I then did a third DNAse step, with a different DNAse, and again purification but even so I always have similar results.

My question is, can it really be that I have this much RNA? How can I check whether in my sample there´s RNA, DNA or a mix of both?

Thank you!

I use some applications, but I seek more useful options. I wonder you're the applications that you are used to and your experiences with them. Thanks for your replies in advance.

I have ready collected several transcription data of tissues from patient(almost have metastatic region) with typical cancer . Is it OK for me to only compare the original cancer site v.s. metastatic sites for genes promoting metastasis? For that I have seen many researchers for similar purpose choose to compare original sites' data of patient with or without metastatic region, which is quite different from mine.

Hi all,

I'm working with an RNA-seq data set consisting of a large number of samples, sequenced at around 50-80M reads. There's a bit of uncertainty as to what the precise experimental workflow was for generating these data, but my best understanding at the moment is that the TruSeq RNA sample preparation kit was used (https://www.illumina.com/documents/products/datasheets/datasheet_truseq_sample_prep_kits.pdf).

This kit starts with total RNA, uses oligo-dT beads to bind polyA+ mRNA, then fragments the mRNA and carries out cDNA synthesis with random hexamer primers.

The data I've seen thus far show a very strong bias towards the 3' end of transcripts, in some cases so extreme that only the exons at the very 3' end are covered, with the rest of the regions having close to no reads at all. This bias is particularly pronounced in genes with long transcripts.

I'm aware that using oligo-dT priming is known to introduce a 3' bias into RNA-seq data as the reverse transcriptase will not always be processive enough to reverse transcribe in one go, but I'm at a loss to explain why the approach above might generate 3' bias if random hexamers were used.

Could anyone suggest any ideas as to what the possible causes of 3' bias in RNA-seq data might be? Are there any causes other than oligo-dT priming?

Would also really appreciate a link to a paper if one exists. Thank you!

In Sanger sequence, after having sequencer output (ab1 file), I would like to apply a free software to check the mutation on level of transcript. I was already working with “mutation Surveyor” software, but it is not freeL. Is there any free software? Thanks a lot.

I am doing an experiment where I have to treat the organoids with insulin, harvest RNA and then perform RNA-seq. But I am not sure how long should the insulin treatment be to see an effect on transcription? Any insights on this would be helpful. Thanks!

Can you please suggest what could be the possible reasons for the confirmation of only 4 out of 13 genes (by qPCR), not all 13? Have anyone observed the same ChIP-qPCR validation issues? Any PubMed suggestion would be great. Thank you for your help in advance.

Hello everyone,

I am creating transcriptional reporters by cloning a promotor to a modified GFP in a plasmid. The GFP is modified by the addition of 13 amino acids at the end of it to render it less stable (if interest, see paper DOI: 10.1128/AEM.64.6.2240-2246.1998 ). I get the plasmid with the insert (promotor + GFP), but, there are always nucleotides' substitution in the 13 amino-acids tail added to the GFP. The mutations vary within the clones sent for sequencing. I have send the PCR product of the modified GFP used before the cloning, it does not have any mutation.

Where do the nucleotides' substitutions come from ? Any idea ?

I performed a CTmax experiment on Broad Whitefish at two acclimation temperatures and harvested liver and muscle tissue to perform HSP70 quantification in addition to acquiring a full transcriptome dataset for each tissue sample. After RNA-seq analysis, I quantified the transcripts using Salmon with Rainbow Trout and Northern Pike cDNA as the target transcriptome (there is currently no transcriptome dataset for Broad Whitefish). My goal is to find HSP70 specific transcripts and determine if there is a significant difference in upregulation between the two acclimation temperatures. I'm currently on Ensmbl and I have the reference names for specific HSP70 transcripts from the northern pike and rainbow trout, and I'm filtering the Broad Whitefish transcripts to find these reference names in the files and what the respective TPM values are. I'm wondering if there is a better way to quantify the HSP70 transcripts? Thanks in advance for nay help!

Dear all, I have found white precipitate in my transcription buffer which is expired 6 months ago (Promega ribomax sp6 kit). I used the buffer to synthesis mRNA and run a luciferase assay. Unfortunately, I didn't get any luminescence signals.is it because of my transcription buffer or any other issues?

There are so many DNA polymerase and they have many activities like polymerase activity, gap filling, proof reading activity, and DNA repair activities. Which one DNA polymerase does not have DNA repair activity?

In a recent study, RLB (RICE LATERAL BRANCH) gene were demonstrated to control the plant height of rice. A loss-function mutation of the gene led to reduced stature. However, when the authors overexpressed the gene, the transgenic lines also showed reduced plant height. The authors further determined the expression levels of endogenous and transformed RLB copies, and found that both of them were decreased to very low levels.

Question: RLB gene was proofed to positively regulate the plant height of rice, we expected that overexpression of RLB may cause overaccumulation of the RLB gene transcription and increase to some extent, at least not reduce, the plant height. Why overexpression of RLB resulted in reduced transcription for both endogenous and transformed RLB copies and caused the similar phenotype with the mutant? Based on the knowledge we have learned about small RNA biogenesis and functions, please:

1) give the possible explanation of the phenomena;

2) describe the mechanism may cause the above phenomena;

I would like to study correlation between four transcripts (fold changes of mRNA expression) at different time intervals (5 time points). How can I perform this analysis?

I want to differentiate between mutant transcripts and WT that differ by one insertion.