Transcribing - Science topic

I am optimizing a protocol to inject dsRNA (in vitro transcribed) into juveniles of a marine worm. I synthetized dsRNA by using the HiScribe kit; the reaction contained an amplicon (a PCR product) with the forward and reverse primers having the T7 promoter at both ends. I have stored the in vitro transcribed dsRNA in the freezer (-80 C) and it is diluted with nuclease free water. Do I have to do an annealing step for the dsRNA (after thawing it) before injecting it? or is it possible to inject the dsRNA without the annealing step? I read many protocols and there are different opinions about it.

As someone engaging in ethnographic research, are we expected to disclose transcribed data to the journal where we would like publish an article?

I am soon to begin writing my thesis as the culmination of my master's studies in Clinical Nursing. I would like to explore nurses' experiences and, therefore, plan to conduct interviews. I aim to take a phenomenological-hermeneutic approach but use Braun and Clarke's Thematic Analysis as a method of finding themes in then transcribed text. However, I find it a bit challenging to determine whether this is feasible, as phenomenology and hermeneutics have their own methods for analyzing transcribed text. For instance, is it possible to employ Heidegger's philosophy as a theoretical framework, but use Thematic Analysis as the method to identify the themes in the transcribed text?

I hope some one can help to clarify.

How would you go about transcribing and coding data collection done in Arabic (Lebanese) if analysis is to be done in French or English?

would you transcribe 1st to Arabic and code in Arabic then analyse in French or English ? Or would it be feasible and scientifically acceptable to transcribe directly in one of the 2 languages, code in French or English and then analyze in one of these languages?

It is important to note that when interviewing in Lebanese, most respondents will use in their and some times mix in one sentence Arabic, French and English. Moreover, no qualitative software (NVivo, Atlas-ti...) can be used in these conditions.

We have been debating on this issue for a long time trying to find a scientific valid option.

My initial study used literature review along with semi-structured interviews as research methods and involved the following main steps:

(i) Gathering information by reviewing the relevant literature;

(ii) Gathering information through a series of in-depth semi-structured interviews;

(iii) Transcribing, checking and cross-checking the answers received during the interviews;

(iv) Analysing the answers received during the interviews and the information collected through the literature review;

(v) Summarizing the information gathered and drawing conclusions.

I have published the results received in conference proceedings and am now thinking of converting them into a journal article. For this purpose I would like to expand the research through converting qualitative data into quantitative values. Who could advise on what are the best ways to achieve this objective. Thank you!

I am trying to transfect HEK293 cells with dCas9-KRAB-DNMT3A carrying plasmid and multiple IVT sgRNAs. RNAi max invitrogen and Hiperfect Qiagen are only good for small RNAs but not plasmids. Does anyone have experience with a reagent that allows uptake of both plasmid and RNA?

Good morning everyone.

Does anyone know a free program to transcribe interviews to text while it's recording in real time in a simultaneous way?

Thank you so much.

A polymerase enzyme must be needed to transcribe a RNA or replicate a DNA sequence a. But how the 1st polymerase was produced from the genetic material when the ancient cell was born?

When I attempted to identify Sclerotium rolfsii var. delphinii, the ITS (Internal Transcribed Spacer) primer sequence did not provide sufficient specificity. Morphology characterization alone was not accurate to differentiate between S. rolfsii and S. rolfsii var. delphinii.

I am now wondering if there are any researchers currently studying these pathogens.

I am in the process of transcribing audio from YouTube videos as part of my PhD dissertation. Meanwhile I have faced several obstacles on the way among which are noise, double speakers, muffled speech, unidentified words, and more. I will be very grateful, if you be kind and suggest the best ways I can overcome those obstacles and continue my work.

I am in the process of transcribing several videos on You Tube to text. Meanwhile, I have faced several problems among which are vague sounds, interruptions, double speakers, muffled sounds, and unidentified words. I will be very grateful, If you be kind and suggest the best ways I can overcome those obstacles and continue my work smoothly.

To perform a two-step RT-qPCR (starting material is RNA, then reversed transcribed to cDNA followed by cDNA amplification), do we have to design the sequence-specific primers for cDNA amplification in the 2nd step with reference to the mRNA sequence or the cDNA sequence?

Conversely, in the one-step method, as the primers should be gene-specific, should they be designed with reference to the exons in the mRNA sequence. Can anybody please help me with these two questions??

Hi!

I am actually start working with HERVs and other endogenous viruses and try to verify them on qPCR bases (depending on what part is transcribed in defined setting e.g.). Therefore i need the genomic sequences of different HERVs and other TE- elements with annotations (e.g. LTR-gag-pol-env-LTR), so I am able to design primers for different parts. Only thing i found is giri repbase, sadly our university does not have a subscription. Does someone of you has ideas, where i can get annotated consensus sequences for TE- elements and HERVs?

Thank you!

I read papers about in vitro transcribed RNA. What is the difference between in vitro transcribed RNA and commercially purchased RNA?

Thanks

I am doing the researcher and need to know if there is transcribing program that I can download and use it easily.

Both the English and Korean language are in the same voice-file and I need to transcribe both of these languages.

Is there any program I can use for my research?

I will be interviewing clergy members.

Hi,

I am trying to study a splice site mutation using Mini gene assay following the paper attached here. I am trying to synthesize my mini gene using the set of commands mentioned in the paper. But in my output sequence, my mutation is lying before the start codon and hence won't be transcribed. I checked the author's output sequence, their mutation was after the start codon. can anybody please help me in rectifying it.

My commands:

R --slave --vanilla --args -refdirectory D:/Vanya/SplicingVariants_Beta-master/ssfiles -mutfile D:/Vanya/SplicingVariants_Beta-master/mutfile_Vanya.txt -output D:/Vanya/SplicingVariants_Beta-master/Vanya_output.txt -gblocksubmit D:/Vanya/SplicingVariants_Beta-master/Vanya_gBlock_output.txt -ss3 -barcode AA,AT,AG,AC,TA,TT,TG,TC,GA,GT,GG,GC,CA,CT,CG,CC -seq5 TTACGCCAAGTTATTTAGGTGACA -seq3 XXATCTAGATAACTGATCATAATCAGCCATACCACATTTGT -id 6,2 -limitintron 100000 -limit2ndexon 10000 -limit1stexon 10000 -usehg19 D:/Vanya/SplicingVariants_Beta-master/usehg19 <D:/Vanya/SplicingVariants_Beta-master/ConstructDesigner.v.0.95.R

I conducted data collection (20 interviews in Sepedi Language) as part of my Ph.D. studies. All interviews were transcribed then translated to English.

So i would like to know that out of 20 transcripts how many should i back-translated to Sepedi to ensure/check accuracy?

Any literature recommendations will be appreciated

Hi all,

I'm currently in the process of working on DIG-labeled mRNA probe transcription. I've done this successfully plenty of times, but the process never fails to create new ways to stump me, and I'm having trouble solving this one. I ligated my fragment into a PGEM T Easy vector and digested with SpeI for T7 and SphI for Sp6. I checked to make sure neither recognition sequence is in my fragment. I sequenced my plasmid after miniprep, and the sequences were perfect. The digest looked fine (photo attached) with the SpeI and SphI fragments both at the same, correct size. Only weird part is that the uncut plasmid ran slower that the cut plasmids, which has never happened. Issue persisted with replication. But that's aside the point. My PI told me to transcribe anyway since the cut plasmids were all the correct size.

I first transcribed last week, and the T7 looked perfect. Sp6 did not. I know that RNA can take multiple conformations, but I've never seen the bands look like this when that happens. Our T7 polymerase is pretty new, but Sp6 is a bit older, so my PI had me order a new tube. I tried again yesterday, re-transcribing both T7 and Sp6. T7 still looked perfect, but Sp6 did the same weird thing, just more intensely. It's hard to see on the gel because the second Sp6 transcription is so bright, but the bands are the same sizes for the Sp6 probe on both runs.

If it's a case of multiple conformations of RNA, I don't really understand why only Sp6 would be displaying it in both rounds of transcription. I have a feeling that my PI will suspect issues with the restriction enzyme and have me order more, but I want to explore any other avenues.

Any thoughts about what's going on here will be greatly appreciated.

I am building some plasmids with the goal to drive expression of a fairly long operon with a tetracycline-on system in bacteria. The plasmid looks correct, but it is not driving the expected phenotype. I am currently working through troubleshooting why this may be the case. One possibility I am considering is that the entire operon may not be getting transcribed. I have been attempting to search the literature for information on how long of a transcript a TRE can produce, without luck. Can anyone with experience working with tetracycline inducible systems provide some insight into this question?

Many of the interview software packages, like Dragon Speak, will record and transcribe the interview and seem to work all right with a one-on-one interviews but seem to break down when there is a focus group with multiple speakers.

Does anyone have any suggestions on software that will work well with recording and transcribing a focus group?

Does anyone know any real free online tool, software, or application for the purpose of transcribing recorded conversation and audio files?

I'm conducting conversational analysis research based on a corpus collected from EFL learners. I'm beginning to wonder if there is any free online tool for the transcription of audio files?

I'll be grateful if anybody can help

My supervisor retired, but I am confused about the current method I have used to analyse data, I am wondering if anybody can help?

I have transcribed the interviews, followed by manually coding them paragraph by paragraph to create codes. Then organised the codes into higher-order categories, eventually into 5 themes.

Which method is this? Thanks!

best,

Nicole

The internal transcribed spacer is a molecular identification method used to identify fungi, my question is:

Can I use this method to identify Fusarium oxysporum species complex?

Im using mMESSAGE mMACHINE T7 ULTRA Transcription Kit to transcribe my DNA. It produced 30 ng/ul which is 750 ng although the kit promises to yield atleast 15-20 ug of RNA. Even the control DNA provided in the kit produced 6.2 ug RNA. I followed the protocol as it was instructed. Kindly share tips to increase the yield upto 10 ug atleast. TIA!

Hi,

Has anyone tried commercial kits for polyA tailing of in vitro transcribed mRNA (e.g. NEB E.coli polymerase kit)? I keep getting inconsistent results, some mRNAs were tailed but some are not, despite the reactions being set up in parallel. Is this a common problem for polyA tailing using E. coli polymerase? thanks!

Hi all,

I'm working with an RNA-seq data set consisting of a large number of samples, sequenced at around 50-80M reads. There's a bit of uncertainty as to what the precise experimental workflow was for generating these data, but my best understanding at the moment is that the TruSeq RNA sample preparation kit was used (https://www.illumina.com/documents/products/datasheets/datasheet_truseq_sample_prep_kits.pdf).

This kit starts with total RNA, uses oligo-dT beads to bind polyA+ mRNA, then fragments the mRNA and carries out cDNA synthesis with random hexamer primers.

The data I've seen thus far show a very strong bias towards the 3' end of transcripts, in some cases so extreme that only the exons at the very 3' end are covered, with the rest of the regions having close to no reads at all. This bias is particularly pronounced in genes with long transcripts.

I'm aware that using oligo-dT priming is known to introduce a 3' bias into RNA-seq data as the reverse transcriptase will not always be processive enough to reverse transcribe in one go, but I'm at a loss to explain why the approach above might generate 3' bias if random hexamers were used.

Could anyone suggest any ideas as to what the possible causes of 3' bias in RNA-seq data might be? Are there any causes other than oligo-dT priming?

Would also really appreciate a link to a paper if one exists. Thank you!

Hi everybody,

I am using the mMESSAGE mMACHINE Kit (Ambion) to generate capped mRNAs in vitro, but since I also want to add a polyA tail to those transcripts, I decided to use the Poly(A) Tailing Kit  (Applied Biosystems) which is the recommended one for capped mRNAs generated with the mMessage kit.

The polyA tailing kit suggests to use 'a completed, DNase-treated mMESSAGE mMACHINE reaction (20ul) at room temperature'. My question is if that RNA needs to be previously cleaned-up from unincorporated nucleotides and enzymes or if it can just be use straight after the DNase treatment step.

I have previously used a different kit for polyadenylating which required 10ug of a cleaned-up capped RNA as input material for the polyadenylation step, and this is why I am concerned about including (or not) this extra clean-up step (I know for sure I will need to clean up after I have my polyadenylated products...my concern is if I also need to do it before).

I would appreciate any suggestion on this matter.

Thanks!

Hello! I´m looking for programs to transcribe (maybe F4?) and evaluate my qualitative interviews with the Grounded Theory. I would be very grateful if someone had a tip for me. What programs do you work with? Best regards Carmen M.

Hello everybody,

a colleague of mine is doing multiple case study research using narrative semi-interviews. She is aiming to conduct between 20 and 30 interviews and she has already interviewed a number of participants. The interview duration ranged between one hour and a half to three hours. The nature of her research question necessitates interviewing some of her participants in their native language ( dialectal Arabic ) . She wants to know if it is compulsory that she first transcribes the data in Arabic before translating it to English ?. Considering the number of interviews and their duration, transcribing them before the translation will be very tedious and time consuming and she does not have much time left for the analysis; she was wondering whether it is permissible to directly translate the general meaning of the interview data to English without transcribing it in Arabic and if that is possible are there any trustful resources that she can cite to justify her choice.

Thank you in advance

Dear Researchers,

For the molecular identification of fungus,

why usually use the three regions internal transcribed spacers (ITS), Small subunit (SSU), and large subunit (LSU)?

My gene of interest is 6900bp, and I have successfully cloned it to the PGMET vector (promega), after linearization, using the kit (thermo scientific K0441) to do in vitro transcription, but I got bands in the attachment. My question is:

1. why I got many bands smaller than the actual size. I have added with RNAase inhibitor, and make the whole process without RNAase contamination.

2. Is it uncompleted linearization causing this? I do the transformation after linearization, I got about 10 clones on the plates, this uncut plasmid could cause this problem?

3. Is it because this gene is too large? but I have seen some examples transcribing more than 9000bp.

4. Could pre-termination of transcription explain this? but I have used both T7 and SP6 RNA polymerase (will transcribe sense and antisense if it works ) to do the transcription. Both I got bands like this.

So frustrating to do this repeatedly. But I still can not find the reason. Hopefully, someone can help me solve it. Thank you.

I have transcribed one type of structural RNA (~500 nt long). For the downstream experiment, I need to confirm its proper folding. In literature, I have found people just heat the RNA at 95 C and chill it in ice for refolding. Do you have any idea, how to check the difference in the folding of these two types of RNAs (just in vitro transcribed and heat treatment after transcription)?

Considering that I am in the middle of transcribing/translating audio files, can I make use of ATLAS.ti or NVivo (or any other) to organize my data? I used unstructured interviews and some of them were deep, lengthy conversations. Which is a better software for managing ethnographic data and analyzing narratives? Thanks

Hi all,

I would like to fluorescently label mRNA that we will be delivering to MoDCs. I'm going to perform microscopy (Axios Imager D2 if that's relevant) to see localization of the specific mRNA within the cells. This mRNA is from a vendor so I can't transcribe it myself. Any thoughts?

I conducted a semi structured interview to parents about their experiences as modular facilitators during the pandemic. I would like to ask that when transcribing the recorded interview, is there a need to also include the follow up questions in the transcript along with their answers, or I will just include their answers to the follow up questions in the original set of questions validated by the evaluators?

Thank you in advance!

I am working with a plant with multiple sequences of rRNA genes as determined by rRNA-gene PCR, cloning, and Sanger sequencing from a single plant. We are now doing reverse transcription, cloning, and Sanger sequencing to see if these multiple sequences are actually transcribed. I was also looking for a company that does RNAseq to answer this questions, but all I am finding is how the companies can eliminate all rRNAs (since they are super-abundant) before doing RNAseq. Are there companies that will skip the rRNA elimination step, since all I really want is those sequences along with an indication their relative abundances? I have a question in with GeneWiz but thought I would also has here. Thanks!

Hi all, I have been trying to look to understand which promoters are recognized by e.coli and which are not. I have difficult in finding the list of promoters. Currently I am using 5xUAS-E1B promoter but not sure can the protein be expressed in E.coli during the transformation.

I have a set of experimental RNA samples at low concentrations (55ul each, at 10-25ng/ul concentration range). My end goal is to prepare enough cDNA from these samples to be able to run several Taqman assays to measure expression of a variety of genes. I intend to use Invitrogen SuperScript IV.

Typically, I would use 11ul of RNA at 200ng/ul (i.e. 2.2 ug total RNA) in a 20ul RT reaction; and after the RT add 200ul of water, thus resulting in 220ul of cDNA at 10ng/ul... enough to run over 40 Taqman reactions if 5ul (50ng) is used per reaction.

Given the lower concentration of my current RNA samples, I would like to reverse transcribe all 55ul of my starting RNA, in a larger 5-fold scaled-up RT reaction (100ul total reaction volume). I obviously would have to proportionally scale up my buffer components, but is it necessary to also scale up my Superscript (in order to maintain its final concentration, so that it does not become too dilute in the reaction tube), or is it sufficient to use the same quantity of Superscript, given that the ratio of Superscript:RNA would still be well within the unit-capacity?

In short, which is the more important factor: superscript reaction concentration, or Superscript:RNA ratio? Thanks!

Frank

Does anyone have suggestions on software that has been particularly helpful in transcribing and analyzing data recorded during focus groups? We have some money from a grant that can be used to purchase licenses. Any insight would be helpful. Thank you.

Hi, I wish to perform ddPCR for miRNAs in plasma. I have total RNA which needs to be reverse transcribed and ddPCR amplified. What platform do you recommend for the RT (except for Taqman) considering that RNA levels in plasma are <10ng? Also what PCR probe/primer can work?

I have been studying an expression of a gene that I called DET1, which involved in cyanide detoxification. This gene has a transposable element (TE) inserted into the gene. As a result, its transcript was truncated.

I removed the TE from the gene (DET1_NoTE) and overexpressing it in arabidopsis. For a control, I found an orthologous gene from arabidopsis, AtDET1. As expected, overexpression of DET1_NoTE was comparable to AtDET1 as shown in a cyanide detoxification assay.

However, when DET1_NoTE and AtDET1 were expressed under either DET1 promoter or AtDET1 promoter, the AtDET1 plants appeared to have a significantly stronger cyanide detoxification ability when compared to DET1_NoTE plants.

This makes me wonder if, after the TE insertion that alters the transcriptional start site of DET1, mutations could have been accumulated in the regions that no longer got transcribed and hence breaking down the relationship between the gene and its promoter, and this could be viewed from DET1 promoter and DET1 is no longer working efficiently.

Is there any similar observation that you might know of?

EDIT: The problem turned out to not be with my isolated RNA, my synthesised cDNA, or any of the other components. Instead, I missed that the setting for the reference dye was set to "ROX" instead of "None".

I isolated RNA from cells and transcribed it into cDNA which I then used for a qPCR. In the first run, only a few wells yielded a CT, for most I received an "undefined". I re-ran the experiment with the same result, and I'm not sure what the problem could be, because:

- Both runs resulted in 10 primer-sample combinations for which I had a CT. However, those were not the same combinations both times

- All primers have at least one result with a CT

- All samples have at least one result with a CT

- The primers have worked before

- All are using the same master mix with SYBR Green (with different primers in each mix, of course) which has also worked very recently

- I'm using a template for the run parameters that has worked before

Technically, it should not be the primers, not the samples, and not the master mix. But what else could it be? I consider re-synthesising my cDNA and repeating the experiment, but I'm unsure this will fix anything.

I am considering using automated transcription software to transcribe highly sensitive interviews. Would appreciate any advice.

Regards

Catherine

What do you think, is it legit to campare focus groups that were conducted online with focus groups conducted "face-to-face"? Both online and face-to-face focus groups were held by same moderator using the same guidline (or a similar set of questions), all groups were transcribed vebatim and then categorized by means of a "narration analysis". Additional "field notes" for non-verbal sings were taken. However, I do have some concers, because face-to-face focus groups allowed more insights into non-verbal communication and interactions of participants, compared to online FGs. Thank you for your answers.

I have a 700bp ITS PCR product. What can I interpret?

I have been trying to find a research collaborator, but haven't been successful due to the cross-disciplinary nature of the research. Below is the description of the research project.

The project was a Mitacs (https://www.mitacs.ca/en) sponsored research project which aims to uncover challenges and issues in inter-government collaboration pertaining to innovation under the Canadian contexts. Seventeen interviews with government officials from various levels were conducted and transcribed. As our lead researcher has decided to move on with her entrepreneurial pursuit, we are looking for a researcher who is an expert in innovation ecosystems and Canadian public policies on innovation to take on and publish the project results.

Any tips/pointers would be greatly appreciated!

Lin

I'm trying to study the interplay of NOX5 and osteopontin in regulating ROS levels in microglia. In theory, NOX5 activity should eventually lead to the transcription and production of iNOS and OPN, the latter of which then suppresses iNOS transcription. With that said, I'm not sure exactly how fast this process occurs, so I'm using an Incucyte system to monitor the cells over time.

The problem is that I want to see not just an increase in ROS, but also an eventual decrease once OPN is transcribed. All the kits I've found rely on oxidizing the reagent, creating a permanent signal. Has anyone used a kit where the fluorescence could drop off as ROS are eliminated?

I recently tried an artificial-intelligence software program, otter.ai, on several transcribing tasks. I was very impressed with the job that it did on single person speaking clearly, so I suspect it would be a good tool for individual individual interviews.

At other extreme, however, I gave it a low to moderate quality recording of a six person focus group and the results were essentially junk.

That makes me curious about what kinds of experiences others have been having with this latest generation of transcription software.

Hi all,

I am conducting oral history interviews in Spanish. From the interviews I have conducted so far, I have found transcribing them to be an impossibly slow process. Even with transcription software, it is taking me about an hour to transcribe 3 minutes of audio, not helped at all by the fact that Spanish is not my first language.

Can anybody recommend any audio transcription SOFTWARE which could help to transcribe my already-recorded audio files (interviews)? I say software because I have a budget to ask for software but not for paying somebody to transcribe. A few people have recommended Dragon (by Nuance).

Any help greatly appreciated.

Tom

We are working on a qualitative project that uses telephonic interviews. Most of the interviews have been transcribed so we want to start the coding process. We cannot afford Atlas.ti or NVivo, but many open source software programs either do not cater to multiple collaborators or are limiting. For example, we found Taguette really easy to use however it does not support nested/hierarchical coding or the visually pleasing multiple coloured highlighting.

Could you tell us about any other open source softwares that would overcome the above-mentioned shortcomings? We're open to using Google Docs and Sheets, however, to be honest we are still figuring out how to go about it without causing issues in the later stages.

Note: We're really new to qualitative data analysis

I attempted to perform qPCR using primers for 4 genes that I had previously validated without any problems. I am using PowerUp SYBR Green mix with 5 pmol primers in 25 uL total volume. This is my first time using these particular samples--cDNA was transcribed from diluted samples of RNA that had been treated with DNAse III. 2.5 uL of cDNA equaling 2.0 ng was added to each well.

There are three shapes present in the amplification plot, which appear like early plateauing, an upside down sort of plateau in the middle of the curve, and the normal noise seen at the start of successful qPCR attempts. I have never seen anything like this before, and I typically use very low concentrations of cDNA like those I used here. I have read that these shapes are typically seen when overabundant template is used, but I really can't see how that would be the case here. There is no pattern in terms of these three shapes in the plate--samples in duplicate frequently display distinct shapes, some registering cT values and some appearing undetected.

If anyone could help explain potential causes of the error in this protocol I would be extremely grateful.

Thank you!

I have many interviews to transcribe and doing so manually would take a significant amount of time.

I also do not have money to pay for a transcription service.

Are there any free programs that will automatically transcribe an audio recording?

**EDIT**: To be clear and address some of the answers to this question, this question is not an attempt to get other researchers to find this information for me. Prior to posting this question, I looked around at previous questions on ResearchGate and recommendations on other websites. Most of the free software I've found either doesn't work very well (e.g., only records one person's voice, misunderstands a significant amount of audio) or required a level of software development experience that is beyond me.

Hello,

I am struggling with the following:

I have asked how and what questions regarding student experience of exams.

I have used participant-observation (students), semi-structured interviews (students) diary & focus groups (staff).

I have generated some theories from the limited research about their experiences/parental pressure/securing 1st place university choice.

I am struggling to analyse the data captured. I am not sure whether I use IPA or thematic analysis to transcribe, code & interpret.

I research plant use, and indigenous medicine, especially related to Ireland. Irish indigenous medicine was influenced by Greek medicine between the 14- 16th centuries as the European herbals were transcribed into Irish for use in Irish medical schools during this period. After the collapse of the Gaelic order in the early 17th century some of this knowledge seems to have blended with the Gaelic oral tradition, remnants of which we still have today.

Regards

Rosari Kingston PhD, MSc (Herbal medicine)

Hi everyone. I need to conduct some interviews for a project. I've never done this before and would like to ask for advice on the best (a) equipment - encrypted voice recorder, and (b) transcription software which ideally performs voice recognition. Also, having never done interviews before, would anyone know a rough estimate of the number of lines I would need to transcribe for a 20 minute semi-structured interview? Thanks in advance! Karen.

Should postgraduate students be required to transcribe research interviews or can they be allowed to analyse their aural (recorded) data? I have a postgraduate student who wants to analyse her aural data and not transcribe it. I would prefer if she transcribed the data and then analysed the transcripts as I believe this is good practice. Which approach is preferable or are both acceptable?

Any good resources here would be helpful, I am specifically wondering about fungal ITS copy number within ascomycetes. I keep reading that ITS has a high copy number however ranges of the copy numbers seems to be left out.

Does anyone know any good app/program that could transcribe audio files in different languages (interview recordings) to text files? Cheers!

I ran a PCR of reverse transcribed RNA samples using a primer combination that should amplify two splice variants of a gene.

One of the splice variants should be 399bp in size, while the other should be 220bp.

But when I ran the gel, I found a third band had also been amplified, around the 100bp region (see image attached).

I do not think it is primer dimers because I used a dH2O control (mastermix+primers+water instead of sample) to detect contamination in the mastermix and primer dimers, and there is no band on this lane.

Does anyone know what this band could be?

Or at least, does anyone know if this could be a genuine mRNA and not just an artifact?

Hi,

I am working with a gene that transcribes both a sense and antisense transcript. I want to determine their expression relative to each other in one sample, i.e. sense transcript is expressed higher than antisense transcript at one condition.

I did qPCR and have Ct values for sense, antisense and GAPDH. For example:

Sense Ct - 25

Antisense Ct - 20

GAPDH Ct - 19

I can see just from values that antisense expression is higher but how can I display this data to present?

Do I use a standard curve using GAPDH? I'm pretty sure I cannot use the 2^-ddCt method since I'm comparing between transcripts in only one sample.

Thanks for any help!

I am investigating the expression of one particular gene in a mouse and am interested in determining the exact mRNA sequence. Is there anyway I can sequence the mRNA transcript of this gene?

For example is it possible to isolate the RNA, reverse transcribe, then use sanger sequencing?

I can't see any examples of this being done and RNA-seq seems like overkill if I am just interested in a single gene.

Any suggestions welcome!

I am planning to conduct a focus group study for a preliminary data collection exercise. I am planning to record (audio) the session as well for later transcribing. I have few questions;

1. How do you identify individual person’s discussion in the recording (audio)? In a focus group study, it is potential that more than one person speaks at a time. So how do you identify individuals? Are there any software or tools which identify the individual voices?

2. How do you minimise the outside noise (noises other than the participants discussions) during the focus group? I am more interested in software or tools in this question again.

Hello!

I am currently sifting through a large amount of data including interview transcripts and photo-documentation of elementary student artwork and writing. As of right now, the coding system I‘ve developed doesn’t unite the image and text data sources, instead I find that most images are coded with one set of codes, and text is coded with another. The images are all photos of student journals which include writing and drawing. Some examples of codes I’ve used on many images are : “representational demonstration of comprehension” or “4 sectioned layout demonstrating comprehension”. These codes do not apply to any of the transcribed interviews. When I look at the data as a whole, I find that the images and text are separated by the codes rather than informing each other. I’d love any information or article/book suggestions about how to develop a coding system that creates a dialogue between image and text, so that the two inform the other. Or perhaps I’m wrong in thinking that the coding is where this interaction will occur? If that is the case, what suggestions do you have to look at and interpret two different types of data both describing the same event?

Transcribing can be time consuming. Under some circumstances, I think it is not necessary to transcribe the whole video data (let's say, interviews) or some part of them for qualitative analysis only if the participants can be clearly tagged in operating the data collection.

I was wondering if it is a must to transcribe all video data?

Many thanks.

I am currently developing RPAs for the detection of flaviviruses, however I am struggling a bit with determining the minimum detection limits of my assays. I performed ten-fold dilutions on transcribed RNA (Starting concentration of 8.24 ng/microliter), and performed RPA for dilution 10⁴ , 10³, 10² and 10¹. I followed the guidelines given in the package insert of the PCRD detector sticks, and I was able to only detect 10⁴ (6 microliter amplicon with 84 microliter buffer). According to other articles, my assay is suppose to detect at least till 10². What is a suitable dilution for the lower concentrations?

Any help would be much appreciated!

I need something inexpensive that works in Portuguese.

I am PCR amplifying the ITS region of Fusarium oxysporium f.sp. zingebri fungi using primers ITSF1/ITS4 . I know the amplicon length is highly variable. I am doing the phylogeny of those fungal strains. I need a reference sequence for ITS and EF-1. I cannot find this information in the literature. Can anyone provide any assistance?

While explaining DNA transcription diagrammatically, we show two strands, the non-coding strand drawn as the upper strand running 5' to 3' and the coding strand or template strand, drawn below the non-coding one and running from 3' to 5' direction. Does this orientation remain the same for every gene transcribed or does the upper strand sometimes become the template and vice versa depending on the gene transcribed?

I am considering the merits and drawback of using the service as opposed to self transcribing and//or paying someone else to do it

I am transcribing interviews and I encounter some curse words that I would like to avoid in transcriptions. I do not find them important in the context of further analysis. I would keep them in my materials, but I would like to avoid them in the thesis quotations and the publication... How shoudl I proceed? Can I write e.g. "This is ... crazy!" or what should I write?

The EM image of E.coli mRNA being transcribed by polysomes by Miller et al. in 1970 became iconic The sample preparation, however, seems particularly involved.

I want to know what options I have today if I want to image transcription (from a plasmid) and/or translation in E. coli?

Thank you very much

I've been told not to transcribe my data due to time constraints of my research, But I don't know how to 'code' my data, I just seem to be transcribing sections that I think could be important??

Self transcribing is slow but helps the the researcher to identify the ideas from the start. Using a paid service is faster but may not be ethical since the data may be sensitive to share. Software is fast but inaccurate.

So, what is the best way to transcribe the interview data for any qualitative research?

I need a 2nd and 3rd coder. To generate codes. Categories and themes. Use Atlas.ti. 14 transcribed interviews on health services and the importance of cultural competence in the delivery of services. Do I have an will participants happy to assis and publish together if time permits

I m doing RTs with a gene-directed primer on 1ug of RNA and it works great (I use quantitect from Qiagen). Last time , after my Reverse transcription with this gene-specific primer, I added by curiosity to my QPCR mix (in plus of my gene of interest primers/probe) the primers/probe used for the reference gene I used in my regular QPCR. While I used a gene directed primer that is not targeting my reference gene RNA, I see a consistent amplification of my reference gene in my QPCR wells (Ct 22). I reverse transcribe 1ug of total RNA, and the Ct of my reference gene is the same everywhere showing the quantity is the same in every wells (at leats, it s the case for my standard curve). I have 2 questions: Does anybody knows why I amplify cDNA from my reference gene while I use a primer directed against another gene in the RT before? Secondly, since the detection of my reference gene in QPCR shows great consistency (even if I can rt explain why I see it), could I use it as a way to double check the quantity of RNA I have at the beggining?

Thanks you guys!

Hello colleagues!

I have been to trying to express a human gene but after encountering many challenges, i took a pause to revaluate my strategies. For mammalian genes particularly those that code for enzymes, i know their resulting transcribed mRNA come with a bunch of introns. Do i need to clone cds instead of cloning an entire gene into the plasmid?

There are 3 blood samples which is donated by the healthy human. Firstly, we collected the macrophage using the kit to filter it from serum. After that, We transfected our target gene plasmid into the macrophage. Then we extracted the mRNA and protein, also we re-transcribed mRNA into cDNA. However, in the qPCR, there is no difference between experimental group and ctrl in fold change. But in the western blot, it's clearly that overexpression groups are darker than the ctrl which it's should be.

My problem is, if we didn't successfully transcribe the plasmid, there can't be distinctive difference between each other in WB. The evidence may proved that we did transcribe the target gene. The trouble is, no difference in qPCR, nearly same CT. We have redo