Science method

Titration - Science method

Explore the latest questions and answers in Titration, and find Titration experts.
Questions related to Titration
  • asked a question related to Titration
Question
1 answer
I am looking to run KF titrations by hand. At the moment we cannot justify buying a whole machine for the amount of tests we'll be running, but I also need to test out the process in order to justify using one in the future. I've heard of people just using traditional glassware but can't find any specifics on how to make your own KF Reagent or how that has worked out. I'm also not sure if anyone has successfully seen a color change or if I will need to/ can buy a probe just for the electrochemical aspect, and I am concerned about being able to determine the end point even if everything else is possible to do by hand.
Thanks for any help anyone can give!
Relevant answer
Answer
Not sure these will help you, but here are a couple of links to some documents that describe the process and apparatus. Unfortunately, I've not conducted this experiment. Good luck.
  • asked a question related to Titration
Question
1 answer
Currently I am doing a colorimetric method for lead titration, however, we have acquired an auto-titrator that will allow for a more seamless procedure. In order to perform this procedure I will need a method for potentiometric titration of lead. Any help will be greatly appreciated!
Relevant answer
Answer
The content of lead can be determined by EDTA titration in buffer solution using platinum electrode potentiometrically.
  • asked a question related to Titration
Question
1 answer
I am working on a qPCR with specific probes, however my standard titration does not display any titration down. The amplification plot shows high intensity of every point (including zero) with a Ct around 8-12 cycles. The amplification plot looks the same with SYBR green and probe system master mix. Not considering pipetting, centrifugation, nor mixing, does anyone have any suggestions?
Relevant answer
Answer
Maybe the machine needs cleaning/calibrating? You could try loading a plate of just water, or water and dye in some wells and see how that reads as a control.
  • asked a question related to Titration
Question
1 answer
Both drug and mucin are poorly soluble in buffer. I obtained alternating endothermic and exothermic peaks. Anyone knows why there are alternating peaks?
Relevant answer
Answer
ITC gives a signal from any chemical/physical phenomena causing heat flow. Thus, in your case, you probably see peaks from the interaction between drugs and mucin, and in some injections, you see overlaying signal from a dispersion/dissolution of a bunch of sticky molecules from injecting syringe. Because the latter is random and the concentrations of dissolved molecules during the experiment are not defined, you cannot use it for any calculation. Instead, you can either lower the concentrations to those below the solubility limit or find a co-solute to dissolve molecules of interest (e.g., a low percentage of DMSO).
  • asked a question related to Titration
Question
1 answer
Dear friends;
What is the titratable acidity of plasma in butter?
How can I measure?
Thanks in advance.
Relevant answer
Answer
First you should determine fat content in butter. The rest is butter plasma. Example: fat content is 80% (butter plasma is 20%) and total acidity is 0.05%. The acidity of butter plasma is 100*0.05/20 = 0.25%
  • asked a question related to Titration
Question
5 answers
Dear colleagues! I ask you for help! I deal with determination of hydroxyl value of organic mixture, which also compries up to 25 % mass. of water. I don't understand, how it can affect results of titration?
I do that in that way: boil both weighted sample and blank with 25 ml of phtalic anhydride solution in pyridine, than titrate them with standardized KOH water solution.
In any ASTM or ISO standards it says there must be not much water in phtalation agent (to prevent hydrolysis of phtalic anhydride to less reactive acid, as I see that). But there are nowhere notes about acceptable water content of sample. Does water have its own HV? Should I remove water from sample by vaccuum distillation before HV determination?
I appreciate you for any answer!
Relevant answer
Answer
Hello all,
I also assume that phthalic anhydride has the necessary strength for the esterification of the OH groups. The official DGF method uses acetic anhydride, so I personally would be interested if there is a special reason for using phthalic anhydride. It may be that it offers certain advantages with respect to certain classes of substances.
  • asked a question related to Titration
Question
1 answer
Virus titration. Detergents.
Relevant answer
Answer
When working with proteins, DNA, RNA, sodium dodecyl sulfate is usually used.
  • asked a question related to Titration
Question
1 answer
I worked on ligand -Nucleic acid (DNA) interaction for this I have done UV-Visible Spectroscopy of my synthetic chemical compound (Ligand) with the DNA. I did titration of the ligand with increasing concentration of DNA. Data shows (in attachment) the highest absorbance/Peak around 463 nm or 413 nm in the case of ligand only (A-0). In contrast, when the DNA was titrated with increasing concentration from A1 to A5, the intensity of peat at 463 nm and 413 nm decreased while the peak increased around 260 nm. However, no absorbing peak was found at 260 nm in the case of ligand only. What could be the significance of this blue shift and what could be the possibility of decreasing peak intensity at 463 and 413 nm? Does this shift indicate the ligand-DNA interaction?
In another experiment, I titrated different conformation of DNA with the same compound in which only the blue shift was observed, however, no change was found at 463 and 413 nm. Please explain this difference also. Does the ligand-DNA interaction happen in this condition also?
in all experiments, the baseline was subtracted and prior to the addition of DNA in increasing concentration I added a corresponding buffer to the ligand also and peak overlap to A-0 (ligand only peak)
Please find the attached graph for your kind reference.
Relevant answer
Answer
The peak at around 460 nm is due to the ligand only. When it is made to react with the DNA the peak showed a blue shift. The blue shift is due to the binding nature of the ligand to the DNA. The binding of the ligand-DNA causes the decrease in the conjugation in the ligand, resulting in the blue shift. This can be seen from the graph by the formation of an "isobestic point".
However, for the second case there is no blue shift. This implies that the binding has not taken place.
  • asked a question related to Titration
Question
1 answer
I need to conduct in vitro biochemical assays with a glutathione-conjugated cadmium in physiologically relevant pH. The assay permits 6.0 - 7.2 pH range, however, I've only been able to solubilize the compound at 6M HCl. When I tried to titrate the compound back to physiological pH, it begins to precipitate.
Relevant answer
Answer
Precipitation is likely to happen if carbonates are present or an excess of hydroxide is added. At high concentrations it should happen if certain anions are present (image)... check for the presence of those interferences.
Searching for contaminants and using a commercial reagent grade cadmium acetate should solve this problem.
  • asked a question related to Titration
Question
3 answers
I worked on ligand -Nucleic acid (DNA) interaction for this I have done UV-Visible Spectroscopy of my synthetic chemical compound (Ligand) with the DNA. I did titration of the ligand with increasing concentration of DNA. Data shows (in attachment) the highest absorbance/Peak around 463 nm or 413 nm in the case of ligand only (A-0). In contrast, when the DNA was titrated with increasing concentration from A1 to A5, the intensity of peat at 463 nm and 413 nm decreased while the peak increased around 260 nm. However, no absorbing peak was found at 260 nm in the case of ligand only. What could be the significance of this blue shift and what could be the possibility of decreasing peak intensity at 463 and 413 nm? Does this shift indicate the ligand-DNA interaction?
In another experiment, I titrated different conformation of DNA with the same compound in which only the blue shift was observed, however, no change was found at 463 and 413 nm. Please explain this difference also. Does the ligand-DNA interaction happen in this condition also?
in all experiments, the baseline was subtracted and prior to the addition of DNA in increasing concentration I added a corresponding buffer to the ligand also and peak overlap to A-0 (ligand only peak)
Please find the attached graph for your kind reference.
Relevant answer
Answer
@ priyanka munjal @ Abeer Salim Thank you for your suggestions. I will do according to your advice.
  • asked a question related to Titration
Question
3 answers
I performed a titration treatment on cells in 2 replicates and then detected an antibody in the supernatant using ELISA. I have my corrected measures and standards, sample concentrations and SD error bars, but I don't know how to decide how significant the average of each of my 2 repeats are. These are my readings. I calculated the coefficient of variation (CV), but I wouldn't know how significant this data is. I'm used to having p values dictate how accurate the data is, but should it be applied in my case?
Relevant answer
Answer
"These are my readings". Did you mean to include some data in your post ?
  • asked a question related to Titration
Question
2 answers
what is free ammonia in water? what is total ammonia? what are the correct methods to differentiate those two?
APHA 4500 NH: D ion selective electrode method and APHA 4500 NH3 : C titration method give free ammonia or total ammonia?
Relevant answer
Answer
In anaerobic digestion, total ammonia refers to the sum of ammonia gas and ammonium ion species. Free ammonia is the unionized form of ammonia, hence the term free.
FAN (free ammonia nitrogen) can be more toxic to the microorganisms in the anaerobic digestion process. Hence, it is an important parameter for process control.
  • asked a question related to Titration
Question
2 answers
I'm trying to use calcein as a detection dye for my LAMP assay but am having trouble. I am using 25 micromolar calcein and 500 micromolar of MnCl2. I've tried titrating it out against MnCl2 and tried adding it before and after amplification but have only achieved successful color change once. The colors appeared green in positive as well as negative reaction. I have ruled out contamination of the assay as a cause. Thanks.
Relevant answer
Answer
Cong Hu i am doing same.
  • asked a question related to Titration
Question
2 answers
I am searching for methods to determine the error in the determination of Sn by iodometric titration. The methodology used was reported by Wright (1982) and consists of alkaline melting of the sample, dissolution with HCL, reduction of the solution with Al and titration with KIO3 solution using a starch indicator solution.
  • asked a question related to Titration
Question
2 answers
Dear fellows,
I am trying to produce and titrate Adenovirus-2 (VR-846 form ATCC) specifically on Vero cells. I had tested several protocols for this but it is not perfectly working. If possible, please provide detailed protocols to do so.
Thanks for your future help.
Relevant answer
Answer
Dear Dr. Angel A. Rivera
I had already done some trials for plaque assay. However, it was not very successful. I guess I need more information about cell condition at seeding, and the composition of infection media/ solution and/or plaque media.
  • asked a question related to Titration
Question
7 answers
I packaged lentivirus and infected 293T cells for testing its titration. After 72 h of infection, I can see cell only 20% cells with positive mCherry (red color) under microscope, however, when I run it on flow, it was almost 98% of positive mCherry cells. I known Flow cytometry is more sensitive than fluorescent microscope, but is that so huge? If I sort cells late, should I trust all positive cells detected by Flow? Thanks for all any suggestion!
Relevant answer
Answer
what I will do is I will sort the positive cells and qPCR them to see if they are good enough. I will report here once I get something. Thank you all!
  • asked a question related to Titration
Question
9 answers
I have prepared quaternized PVA. I want to measure the degree of substitution of quaternized polymer by titration. In literature, potassium chromate is mentioned as an indicator but I have potassium dichromate in my lab. Can I use this salt instead potassium chromate? AgNO3 solution is used for the titration.
Thanks for your help.
Relevant answer
Answer
Yes but also FTIR (point 2.4), elemental analysis via chemical or spectroscopic techniques is another way. If you are close to a biology institute, you may find Kjeldahl analyzer. My Regards
  • asked a question related to Titration
Question
1 answer
Hello!
We would like to treat BMDM with the caspase-1 inhibitor Z-WEHD-FMK before bacterial infection. I only found two publications suggesting either 20 or 100 µM for primary macrophages. Of course, titrating the concetration is one option. However, I will be very grateful if someone would share their experience and would recommend a concetration that worked for them. Thank you!
Best regards, Katrin
Relevant answer
Answer
Maybe someone is interested in this question in the future, so I will share our experiences. We did a titration of 20, 50, and 100 µM Z-WEHD-FMK starting treatment 1 h prior infection of the BMDM. We see a dose dependent reduction in the IL-1beta meaured by ELISA 1 day post Salmonella infection. We will use 50 µM for our experiments.
  • asked a question related to Titration
Question
5 answers
0.1 N concentration solution of both was taken, with HCl as titrant abd HPh as indicator. After reaching the endpoint of colourless condition, the colour reappears after continous shaking for 5 mins. even sometimes after 15 mins. How to be sure of that this much time is enough, for shaking to confirm completion of titration?
Relevant answer
Answer
in case of titration, 0.1 N sodium carbonate solution the required hcl concentration is concentrated or 0.1 N solution used.
  • asked a question related to Titration
Question
2 answers
In case of practical analysis the blank titration value is important. It would be of great help if someone provides me an answer to this.
Relevant answer
Answer
You must calibrate using known amounts of a compound like sugar
  • asked a question related to Titration
Question
1 answer
As sodium sulfide is a reducing agent so we need an oxiding agent for redox titration. But which oxidizing agent is the most appropriate for that?
Relevant answer
Answer
The ACS Reagent Chemicals codex has an assay for sodium sulfide nonahydrate that you should be able to adapt for assay of your solution. The sulfide is reacted with an known excess of iodide, which is then back-titrated with thiosulfate.
  • asked a question related to Titration
Question
2 answers
Hello dear fellow researchers,
Titrisol is a standardized solution of Sodium Hydroxide which is used for titration purposes. I wanted to know what the nature of the solvent is. Many thanks in advance!
Relevant answer
Answer
  • asked a question related to Titration
Question
9 answers
I think this is a valid approach to determining Ki of competitive and non-competitive inhibition for mixed model inhibitors, but I would appreciate feedback.
On this graph, the Y-values are Kiapparent values determined from inhibitor titrations at varying [S], and then converting the IC50 to Kiapparent via Kiapparent = IC50 + 1/2 [E].
Relevant answer
Answer
I wondered how much your approach would change if, in addition to a mixed inhibition mechanism, we were faced with an enzyme that exhibits the phenomenon of substrate inhibition.
Thanks in advance!
  • asked a question related to Titration
Question
2 answers
I am titration protein in the RNA sample. Titration was performed in binding buffer, RNA in the cell was 2.5uM and protein in the syringe was 96uM, with 19 injections (2uL, 4s. I have attached the file below.
If anyone could help, that would be easier for me to proceed for optimization.
Thank you in advance.
Relevant answer
Answer
One reason for such signal may be aggregation/precipitation of the protein-RNA complex. If this process is time-dependent, shortening the titration time may help (probably, you can do it by shortening the time between injections by approx. 20%). Additionally, you can lower the concentrations (also by approx. 20%). Slowing down the mixing is another thing that comes to my mind (too fast mixing tends to denature proteins).
The second approach would be doing the reverse titration, i.e., RNA to protein.
The next reason for such signal may be a too big air bubble at the top of the syringe. Injection of the air instead of the sample solution would destroy the result.
I hope it helps.
  • asked a question related to Titration
Question
2 answers
I'm looking for a method to determine the concentration of free chlorine in a detergent solution (10-20 % NaOH and 3-10% NaOCl) at different temperatures. Can Iodometric tritation be used in this case?
Relevant answer
Answer
The determination of free chlorine might be made by potentiometry with a residual chlorine electrode which was used in this paper:
  • asked a question related to Titration
Question
6 answers
Hello everyone,
I got a new issue.
I run protein titrations with different concentrations (2-fold dilution each time) and I used isotype control as well, with a new ELISA protocole that was tried and used for the first time.
However, I get same ODs among all my microwells.
What do you think these resultats mean ?
What could they be my mistakes ?
Relevant answer
Answer
With so little detail, it could be almost anything. Here are some possibilities, which may or may not be relevant depending on the exact format of your assay.
1. Capture Ab or Ag has not bound to the plastic
2. Error on the dilution of antigen
3. Detection Ab does not recognise the native antigen
4. You forgot to add the substrate or left out a critical component
5. Your plate reader is set to the wrong wavelength
6. You have an inhibitor in the enzyme or used the wrong assay pH
7. You exported the wrong data
There are many other rare potential errors too, I suspect.
With any normal ELISA, your eyes tell you if the assay has worked. Can you see any differences across the plate?
If you can, you have an issue with the plate reader.
If not, you probably have an issue with your reagents.
The first check I would make is to add serial dilutions your detection Ab (e.g. Anti-rabbit HRP) to the plate and then add the substrate. You should see instant formation of the product. If not, your enzyme is dead or there is something wrong with your substrate mix.
Once you have the detection part of the assay working, you can then explore other parts of the assay to locate the problem.
  • asked a question related to Titration
Question
3 answers
Alklinity can be calculated by titration of acid on pH endpoint. I have a data set with bounches of water quality parameters, only without Alklinity. Is there a way to get Alklinity only by calculation from other parameters (pH, TIC, Dissolved CO2, temp, and cations, onions, ect.)
Relevant answer
Answer
The following H and OH ion calculation procedure may also be seen.
  • asked a question related to Titration
Question
2 answers
I am working on complement fixation test and having some trouble in sensitization of RBC's with amboceptors. I have to sensitized sheep erythrocytes in advance of performing titration of guinea pig complement. After sensitization there should be button formation in control well but lysis occur there.
Relevant answer
Answer
Incubate in a water bath at 36–38 °C with gentle shaking for 35 to 45 min. Place the flask in an ice bath for 30 to 45 minutes. Centrifuge the antibody sensitized sheep RBC suspension at 800 x g and 8 ± 3 °C for 10 min. Carefully remove the supernatant with a sterile pipette so that no cells are lost.
  • asked a question related to Titration
Question
1 answer
Hello everyone,
I'm trying to titrate different serotypes of dengue virus. I'm currently using VERO CCL81 cells in plaque assay and TCID50 assay, but only dengue serotype 2 virus showed good results. I'd like to know another affordable and simple assay to titrate dengue viruses.
  • asked a question related to Titration
Question
2 answers
I have a question regarding the use of Stern-Volmer equation to analyze fluorescence quenching in a displacement experiment. When the interaction of two molecules (one could be a macromolecule like a protein) leads to the decrease of fluorescence intensity of one of them, we use Stern-Volmer equation to analyze and study the mechanism of the quenching and interaction. For example, a ligand binds to a protein and quenches the fluorescence of protein (arising from fluorophore residues). Then we may calculate quenching constant and conclude based on the results that it is a dynamic or static quenching. Here the quencher and fluorophore interact with each other and everything is fine. But in situations like Hoechst-DNA complex, which leads to fluorescence emission, when we add a tired molecule which displaces Hoechst and leads to fluorescence quenching, how it is possible to use Stern-Volmer equation to get a quenching constant and then interpret the results and comment on dynamic/static quenching mechanisms. The tired molecule interacts with DNA, not with fluorophore which is Hoechst in this case. In such cases what we see (the intensity of fluorescence) is the result of interplay between binding constants for Hoechst-DNA complex and for tired molecule-DNA complex and the condition just apparently can be analyzed by Stern-Volmer equation. Unless, we accept that Hoechst-DNA complex is so stable that the quencher interact with the complex and quenching happens, and then displaces Hoechst. But, in fact, the quencher interacts with free DNA and shifts Hoechst-DNA interaction equilibrium towards more free Hoechst, which in this case there is no direct interaction between fluorophore and quencher. Of curse, the fluorescence intensity (as a detectable signal) for the titration can be used to get the binding constant of the tired molecule to DNA, like any other competitive binding experiment (where the spectroscopic or non-spectroscopic signals are monitored), but in my view, commenting on quenching and mechanism of quenching seems irrelevant in such cases.
I will appreciate it if you could kindly let me know if I am correct and what is the best way to explain this situation.
Relevant answer
Answer
The Stern-Volmer equation is not appropriate for a competitive binding situation. In this case, there are two competing, saturable binding equilibria, which should be described by two equilibrium dissociation constants, at a low ligand:DNA ratio. (At a high ratio, there could be interactions between binding sites on the DNA, making the analysis much more complicated.) One of the dissociation constants is for the Hoechst dye, which binds in the minor groove of the DNA. The other is for the competitor, which excludes binding of the Hoechst dye.
Since the fluorescence of Hoechst is dependent on DNA binding, you can measure the competition for binding by the decrease in Hoechst fluorescence due to its displacement from the DNA. Calculating the Kds of the two compounds when titrating both simultaneously is challenging because it involves solving a cubic equation, but there is a workaround. It is easy to measure the Kd of the Hoechst dye by a DNA titration at a fixed Hoechst concentration by measuring the increase in fluorescence. You can then set up a competition assay in which the DNA concentration is set equal to the Hoechst Kd and the Hoechst concentration is set far below its Kd. The concentration of competitor that reduces the Hoechst fluorescence by half (IC50) will then be twice the Kd of the competitor. This math assumes that the competitor Kd is substantially higher than the concentration of DNA binding sites.
The DNA concentration has to be stated in terms of molarity. The average molecular mass of a base pair is 660 g/mole, so you can convert mg/mL of DNA to molar concentration of base pairs.
I would not describe the competitor as a quencher unless it is found to actually quench the fluorescence of Hoechst when both are bound simultaneously. This could happen by resonance energy transfer, or by static quenching if they bind right next to each other, or by dynamic quenching if the competitor collides with DNA-bound Hoechst. Fluorescence lifetime measurements would be needed to explore these possibilities.
  • asked a question related to Titration
Question
2 answers
Hello everyone,
I'm working on setting up an Elisa assay and I would like to define optimum primary antidody and analyte concentrations.
I have planned to use a checkerboard with different antibody and analyte concentrations but I don't really know how to choose the best concentration for each parameters.
I've heard about cut-off and change-point analysis methods but they seem to be used to define the limit point between positive and negative ODs.
Do you think they could work for defining the highest titration for primary antibodies or analyte dilution ?
Are there other methods for defining antibody and analyte titrations ?
Relevant answer
Answer
It seems that you are planning to set up an ELISA and of course it's very important to determine the best concentration for antibodies and analyte in order to develop the ELISA for your interest.
I would suggest you to go through our publications (link given below) where we have given a detailed protocol for ELISA development:
1. Development of colorimetric enzyme-linked immunosorbent assay for human chorionic gonadotropin.J Immunoassay Immunochem 2006;27(1):15-30. doi: 10.1080/15321810500403649.
2. A novel enzyme-linked immunosorbent assay for cortisol using a long-chain biotinylated cortisol-3-CMO derivative. J Immunoassay Immunochem 2008;29(4):390-405. doi: 10.1080/15321810802329898.
Article A Novel Enzyme-Linked Immunosorbent Assay for Cortisol using...
3. INFLUENCE OF DIFFERENT LENGTH SPACERS CONTAINING
ENZYME CONJUGATE ON FUNCTIONAL PARAMETERS
OF PROGESTERONE ELISA.
Good luck
  • asked a question related to Titration
Question
3 answers
While determining the oxidation% of my PDA solution in my hydrogel project, I am suddenly curious why we do this, this way.
Relevant answer
Answer
Dear Biswarup Goswami, because it becomes inert instead of hydrophilic. This transformation allow it to be applied in many application as support in biocatalysis. Other benit is that cytotoxicity is reduced. Please have a look at the following documents. My Regards
  • asked a question related to Titration
Question
3 answers
I need titration method to check Total Fatty Materials in Soap or soap noodle, kindly help me. I will be very thankful to you for this kindness.
  • asked a question related to Titration
Question
2 answers
I wanted to measure the zeta potential of planar silica surface in contact with 100 mM calcium chloride solution with NaOH titration with streaming potential (Anton Paar Surpass A electrokinetic analyzer).
The issue is that I'm worrried that the high ionic strength might cause some problems to the instrument (precipitation), beside getting an unreliable measurements.
P.S. I already did the same measurement at 30 mM calcium chloride.
Any guide regarding that?
Relevant answer
Answer
Just try it. It's only 3 times higher than what you've already done.
  • asked a question related to Titration
Question
3 answers
I have digested 30mL of water in H2SO2 and the final volume is 100. After taking 5ml for distillation, the titration volume with HCL 0.01N for water sample was 1.7mL and for blank was 0.1mL.
Relevant answer
Answer
Kjeldahl nitrogen that method
  • asked a question related to Titration
Question
2 answers
To determine the content of H2O2 in PAA solution, I did the titration experiment of PAA with KMnO4 0.05M. Sample solution: 10mL PAA solution + 50mL deionized water+ 5mL H2SO4 1:5. Normally, the equivalence point is reached as soon as the color of the sample solution turns permanently light pink in the presence of excess of KMnO4. However, my sample changed to brown color (the titer of KMnO4 0.05M is 23mL) , that means there might be a side reaction happened or a large amount of MnO2 generated. Could you please explain this situation and advice me the solution for reducing the MnO2 amount? Thank you.
Relevant answer
Answer
Sorry dear, it is out of my field of study
  • asked a question related to Titration
Question
3 answers
can anyone help to me about which brand of puromycin (for seleation aftar transfectin cell line)
work better? for example solarbio, its working good? how about biobasic brand?
thanks a lot
Relevant answer
Answer
Do a kill curve on the parental cells with whichever lot of Puromycin you get.
  • asked a question related to Titration
Question
11 answers
Any accurate protocol or methodology for measuring Titratable acidity of tomato fruits.
Relevant answer
Answer
It is really kind of you dear Aref Wazwaz ,
I also wish you all the very best.
Regards,
  • asked a question related to Titration
Question
2 answers
I own this antibody from BD (https://www.bdbiosciences.com/en-tw/products/reagents/flow-cytometry-reagents/research-reagents/single-color-antibodies-ruo/pe-cf594-rat-anti-mouse-cd49d.564395) for the alpha 4 subunit of the alpha 4 beta 7 integrin and I want to use it on a flow cytometry assay in LSRFortessa X-20 (BD). The problem is that in the datasheet the company describes that "since applications vary, each investigator should titrate the reagent to obtain optimal results". Before I do the titration, I'd like to know which concentrations I should consider to test the antibody, since I can't find anything on Pubmed or Google Scholar.
Thanks
Relevant answer
Answer
I haven't used this particular antibody with this fluor, but a good general starting point for titration of most antibodies for flow is 0.1µg per million cells. If you make a 1:20 dilution of 0.2mg/ml stock (for instance, 25µl of stock + 475µl FACs buffer), you can take 10µl of that for 0.1µg. Then you can just titer up from there... 20µl, 30µl, etc. If you're using PE-CF594, you're likely using all your single molecule fluors too. Depending on the antibodies, there will be some 'unusual' compensation with PE, so you might want to do it manually vs auto-comp (which I prefer to do regardless).
It can be tricky when there is not a distinct positive and negative population (like a T cell gate), but creating a histogram like on BD's website, then gating on the the peak and watching the MFI, can help you determine the optimal titration versus just wasting antibody.
Good luck!
  • asked a question related to Titration
Question
3 answers
We have tried preparing Hydroxyapatite powder from bovine bones according to the works of literature. To characterize and see whether there is a Ca:P ratio of exactly 1.67 or not, titration can be one of the options. But, I can find the exact process for the experiment.
Relevant answer
Answer
Dear all, please refer to the attached file which gives details about EDTA/compleximetry/colorometry assay. My Regards
  • asked a question related to Titration
Question
3 answers
I needed to check pH during a lengthy titration, so I kept the pH probe dipped in the solution for several hours. Several colleagues have commented that it will damage the pH probe. But all I could find on the internet is that pH probe should not be kept in deionized water, but nothing for solutions. Is it really a thing that pH probe should not be constantly kept in a solution?
Relevant answer
Answer
A concern I would have is that the calibration might drift over several hours. It might be a good idea to recalibrate the electrode once in a while. Otherwise, as long as the solution does not contain any substance that could damage the electrode, it should be OK.
  • asked a question related to Titration
Question
6 answers
Looking for detailed Titration method for the quantitative determination of Assay of Ammonium Bicarbonate. I am having one titration method, which includes the heating of solution before titration, but variation in the results is observed.
Relevant answer
Answer
  • asked a question related to Titration
Question
1 answer
Doing UV-vis spectrophotometric titration for my compounds using CT-DNA, what is the recommended concentration of each aliquot of CT-DNA solution? I also read that the UV-vis machine will be less accurate if the absorbance is lower than 0.2 or larger than 1, does that make a huge difference when finding the [DNA] from the 260nm peak?
Relevant answer
Answer
Minimum sample volumes of at least 50 to 75 uL are common requirements for accurate instrument reading.
  • asked a question related to Titration
Question
3 answers
Hello!
I am titrating proteins into polystyrene nanoparticles, using ITC. Initially I get good heats evolved which gradually decrease upon nanoparticle saturation. However, just before saturation I see an endothermic 'hump'. However this is not seen for any heats of dilution. My buffer is 20 mM NaPi.
Thank you in advance!
Relevant answer
Answer
Hi Radha,
I think Adrian V-C's 2nd idea of a possible cause is a good one. If the in the interaction can take place involving different extents of the protein surface (involving coverage of different extents of nanoparticles surface area), it may well be the case that increasing protein concentration enough could favor interactions involving lees occluded surface per protein, enabling higher binding density of proteins on nanoparticle surfaces. Something that would not necessarily be endothermic, but in principle it could be (maybe compensated by an increase in entropy associated to higher mobility of parts of the protein).
Another possible explanation I can think of, which could be tested by light scattering measurements, is the following. *If the protein is able to bind multiple nanoparticles*, and if the affinity is high enough to see this at the concentrations you are using, I would expect to form at the beginning of the titration complexes with multiple nanoparticles per protein (2 np : 2 proteins?) and then, as protein concentration increases, lower number of nanoparticles per protein should be favored. To explain your data this idea would require the formation of crosslinked nanoparticles being more exothermic than binding of protein to single nanoparticles.
Good luck.
Best,
Jere
  • asked a question related to Titration
Question
14 answers
So another PCR problem. I have to amplify a 3 kbp construct with high GC content. Generally all the constrcut isaround 63%. My construct consists of the pcagpromoter with the cmv enchancer and a minimal chimeric intron and the gene of interest plus GFP and polyA at the end. I have my reverse primer 50 nucleotides outside of the SV40 polyA and the Forward the start of the promoter. I Have done many PCRs explained below. After many failed attempts I sequenced the plasmid, but everything checks out perfectly. Even the Forward primer anneals in the sequencing poorly (250bp of sequencing results).
In the end I just PCR with the Reverse Primer from the sv40 and many versions of sequencing primers I had, and obtained perfect bands all the way until the pCAG region, where again it failed again I got a perfect band from a combination of primers that had way bad kinetics( hairloops ΔG=-3 and primer dimer -10, oligoanalyzer IDT)
As for my PCRs i mainly use Dreamtaq (Thermofischer) and Phusion Hotstart Hf buffer. I have titrated DMSO 0-10 with steps of 2,5
I tried BSA and DMSO
As far as the PCR protocol I have done everything Normal , step , TD, SD with taq.
I think the problem lies in and around the CAG promoter. Any thoughts?
My primers
ATGCTCTAGGAAGAGTACCATTG fwd
CCCTGAACCTGAAACATAAAATG rev
Relevant answer
Answer
Also just to add - I dropped the annealing temperature to 6 degrees below recommended for best results. I believe it is the chicken beta actin promoter sequence within the CAG promoter that is the main problem
  • asked a question related to Titration
Question
2 answers
I am trying to assess the potential for a set of small molecules to bind to transition metals (Cu2+, Zn2+, Fe2+, etc.), and am wondering if there is an established protocol for assessing binding constants.
One of the closer examples I have is the following paper (https://pubs.rsc.org/en/content/articlepdf/2006/cc/b611031b), in which the researchers test the absorbance spectra of a small molecule probe against ATP using a standard spectrophotometer. Would I then construct a concentration-response curve from a selected wavelength that shifts with a titration of metal?
I appreciate any and all help! Why is it that Beer's Law is popping in my head?
Relevant answer
Answer
If there is a change in the absorbance spectrum when the metal binds to the small molecule, you can use that to measure the affinity.
You should be careful to keep the pH constant, since some metal solutions can affect the pH.
When keeping the small molecule concentration constant and titrating the metal, you should subtract the spectrum of the metal alone from the spectrum of the mixture at each metal concentration. Better still, if possible choose a wavelength to monitor at which the metal has no absorbance.
Make sure all the absorbances are in the linear range of the spectrophotometer.
The concentration of the small molecule being monitored should be well below the Kd of the complex in order to get a good fit of the data to a Langmuir isotherm, which assumes that the free and total concentrations of the binding partner are essentially equal.
  • asked a question related to Titration
Question
2 answers
Hi, we would like to measure the reduction potential of an enzyme. Can this be done via potentiometric titration? Our lab does not have cyclic voltammetry.
Relevant answer
Answer
Did you think to use ORP electrode for this purpose. it is a cheap and easy way that we use commonly in microbiology and food research to determine the oxidoreduction potential of the medium.
  • asked a question related to Titration
Question
3 answers
I have to measure water content in the ionic liquids, Karl fischer coulometric titration is a method to detect water < 1%. Can I use KF coulometric titration in glove box ? Are anolyte and catholyte dangerous inside glove box ? please let me know.
Relevant answer
Answer
From the sensitivity point of view, doing the measurement in a glove box is clearly very advantageous. You will not have any interference of moisture which you can have if you do it in air. If you want to measure water contents below 10 ppm, doing it in a glovebox will be helpful. For values above 100 ppm, it will probably not matter if you handle your sample fast enough.
However, what about the glovebox atmosphere and its effect on the copper which is used in the purifier to keep the atmosphere free from O2 and H2O: Is the alcohol, the base and the SO2 of the Karl Fischer method a problem? Do they poison the copper? You can find "Glovebox Use Guidelines", written by Karolina Osowska for the Department of Chemistry at the University of Huston. She writes: "The glovebox catalyst can be irreversibly damaged by thiols, amines, phosphines, alkyl halides, SO2, SO3, Hg, etc. You should avoid these materials in the glovebox at all cost." D. A. Vicic and G. D. Jones write in their chapter "Experimental Methods and Techniques: Basic Techniques": "Typically for gloveboxes employing copper-based catalysts, the following volatiles should be avoided: amines, halogenated solvents, alcohols, phosphines, and thiols." You cannot avoid the SO2 of the Karl Fischer method. Often, methanol is used as solvent, which is the most volatile alcohol. According to these sources, Karl Fischer inside a glovebox might be problematic for your box on the long rung. At least you should keep the titration vessel and the flasks with the reagents closed as good as possible. If possible, you might avoid the methanol and use alcohols with lower vapor pressure, e.g. ethanol, or even better: diethylene glycol monoethyl ether. If imidazole or pyridine is used as the base of the Karl Fischer solution, there is also a kind of amine which might be problematic. Clearly, imidazole has a higher boiling point (256 °C) than pyridine (115 °C), therefore, it is expected that it also has a lower vapour pressure. Therefore, avoid pyridine - I think imidazole is usual anyway, pyridine is hardly used any more in Karl Fischer' titration.
Although methanol, SO2 and base might be problemeatic and risky for your purifier unit if they get into it, I do not know: Is their evaporation rate small enough to avoid the copper poisoning of your purifier? Does anyone else have some experience with Karl Fischer in the glovebox? Karthik Bappudi, did you do the measurements in the glovebox? Do you have to regenerate quite often or is your purifier as good as before? Bellsabel Gebear-Eigzabher, what about your system?
  • asked a question related to Titration
Question
2 answers
Hello. For my DNA-protein binding studies (same protein and same DNA for both assays) I am using different methods to determine KD, EMSA and MST. For these two assays I always use the same buffer. The constant DNA concentration for EMSA is 100 nM and for MST 10 nM. The EMSA titration proceeds in a protein concentration range from 0.1 to 10 µM. The titration for MST started at a protein concentration of 224 µM. For both assays I use a total volume of 10 µL. Incubation as follows: EMSA à 70 min, RT; MST à 5 min, RT. At the end I get a KD of 1.71 µM for EMSA and 19,32 µM for MST. What could be the reasons for these diverging values? In view of the fact that the conditions are almost the same I am not sure what could be the reason for this difference. It is always said that differences between various types of assays are caused by variations in salt concentration, temperature and pH. But I can exclude this as I always use the same. I also read in literature that the KD is not concentration dependent. But is it really true for my approach?
Relevant answer
Answer
try to incubate the reactions with the same time.
I was facing the same issue, however when I run both assays with the same conditions ( incubation period, and same concentration of labeled protein or DNA) I obtianed almost same KD : EMSA 318 nM and MST 305 nM.
your KD is unknown, so it is better to keep the concentration of your substrate as low as possible to make sure your are in the binding regime not the titration regime.
for more information about defining the KD I recommend this review :
  • asked a question related to Titration
Question
3 answers
I dissolved the sample in formic acid(it is not soluble in glacial acetic acid), added glacial acetic acid, and titrated with perchloric acid solution 0.1M/0.1N in glacial acetic acid. The results were not clear. I don't know if 1 ml of perchloric acid corresponds to 15.76 mg of Tris-HCl.
Relevant answer
Answer
Hi Adrian,
if possible maybe you can try with potentiometer. If tris HCl not completely dissolve, you can stir the sample automatically. Hope it helps
  • asked a question related to Titration
Question
6 answers
1.Need a standard method , which proceed with removing of inorganic carbon.
2. I need titration based method due to facility issues.
I have a method but could not reference of that one, method is -
1) 1 g soil
2) then add 10 mL 6 N HCl to remove the inorganic carbon
3) Wash with water and dry it.
4) after that follow walkley and Black method.
Relevant answer
Answer
Dear Rajendra,
Please kindly find the attachment. This may be helpful to figure out your query.
All the best.
  • asked a question related to Titration
Question
5 answers
To detect iron(ii)gluconate, NaHCO3 is dissolved in diluted H2SO4 and H2O. After the bubbling stops 1g iron(ii)gluconate is dissolved. The solution is titrated with ceric ammonium nitrate till disaperance of the red color after ferroin is added.
Why is the NaHCO3 added?
How does NaSO4 influence the result?
Relevant answer
Answer
Sodium bicarbonate is a salt that breaks down to form sodium and bicarbonate in water. This breakdown makes a solution alkaline, meaning it is able to neutralize acid. Because of this, sodium bicarbonate is often used to treat conditions caused by high acidity in the body, https://www.webmd.com/vitamins/ai/ingredientmono-1470/sodium-bicarbonate
  • asked a question related to Titration
Question
16 answers
Dear all,
I have started performing an experiment to determine the Kd value of an exonuclease enzyme using 5'-FAM labelled Oligo substrates using Fluorescence polarization. As this enzyme uses Mg2+ as cofactor to execute the reaction, so for such binding experiment, I decided to use Ca2+ instead of it's real cofactor. I need your suggestions that would help designing my experiment to find the Kd values. People suggested that competitive titration with unlabeled substrate would be better than saturation titration with FAM labeled substrate. I first chose to titrate with increasing concentration FAM labeled substrate, but the result is not consistent. Sometime, I see nice saturation curve (as shown in the picture attached) and sometime decreasing polarization values with increasing substrate concentration. Therefore, it seems quite inconclusive to me. Any help will be highly appreciated.
Thank you
Sincerely,
Prem
Relevant answer
Answer
Yes, it is possible for two substrates to have the same Kd but different kinetics.
For a single-substrate enzyme reaction, the definition of the Kd is k-1/k+1.
The definition of the Michaelis constant for steady-state kinetics Km is
(k-1 + k+2)/k+1 and kcat is k+2.
E + S <=> ES (forward rate constant is k+1, reverse rate constant is k-1)
ES => E + P (forward rate constant is k+2=kcat)
In the special case where kcat is very slow compared to the rate of equilibration of the substrate with the enzyme (rapid equilibrium), then Kd = Km.
If kcat differs for the two substrates and the reaction is not a case of rapid equilibrium, then the kinetics will be different for the two substrates.
  • asked a question related to Titration
Question
5 answers
It is related to plant anti-nutrient analysis.
Method says:
The oxalate content was determined by the method of titration as described by Idris et al. (2019). A gram of the pulverized sample was weighed into a volumetric flask containing 75 mL of 3M H2SO4, and the mixture was stirred with a magnetic stirrer for an hour. The mixture was filtered, and 5 mL of the filtrate was transferred into a conical flask, and titrated against 0.05M KMnO4 until a reddish-brown color persists marking the endpoint. The oxalate content was calculated and expressed as 2.2 mg oxalate as an equivalent to 1 mL of 0.05 M KMnO4.
Relevant answer
Answer
It means that 1 ml of 0.05 M KMnO4 eq. to 2.2 mg of oxalate.
Calculate oxalate percentage in sample as below formula;
Volume of 0.05 M KMnO4 used multiplying 2.2 multiplying 100 divided by sample taken = answer
  • asked a question related to Titration
Question
4 answers
I have tried hydrolysis with KOH then titrating the Cyanide Ions liberated with Silver Nitrating but I am not getting results. Anyone with a better method please help. I'll be very grateful since I don't have access to a HPLC.
  • asked a question related to Titration
Question
4 answers
I was preparing a phosphate buffer and adjusting its pH to 7.2 from 9.0 by adding monobasic phosphate. In the beginning, it started to decrease fast but then, it went slowly (it was about pH=7.6). Even though I added too much monobasic solution, its pH was not increased easily. Then, it went to pH=7.3 easily but it stopped at pH=7.3 again. I wonder why it happened. I know it is related to its titration and the titration graph is fine to understand but I need a comprehensive explanation for it.
Relevant answer
Answer
Dear all, one point should be considered, buffers in the alkaline part of the pH are unstable because of the ambiant CO2 (having acid character), so better to work under an inert atmosphere. My Regards
  • asked a question related to Titration
Question
3 answers
I want to inoculate viral proteins in a experimental animal, and I need to know the correlation between the titration reported of viral effectiveness with the amount of protein that I want to test.
Relevant answer
  • asked a question related to Titration
Question
6 answers
There is a seawater sample which COD=12 mg/l and chloride interference Cl- = 23000 mg/l
I want to measure the COD value with Hach spectrophotometer 0-40 mg/l vials. I know first I have to remove the chloride interference and I have tried using Silver Nitrate titration (1ml seawater + Silver Nitrate). All of the existing Chloride in sample reacted with silver nitrate and after that the sample was filtered. But the photometer showed an unexpected result COD=60 mg/l.
What do you think the problem is that I got a wrong result?
I really appreciate your help.
Relevant answer
Answer
Chloride interference is an important problem of COD measurement for wastewaters containing low organic matter and high chloride concentrations. In case of chloride concentrations up to 2,000 mg/L, mercury sulphate addition at a ratio of 10:1 (HgSO(4):Cl(-)) can adequately mask the interference.
  • asked a question related to Titration
Question
6 answers
say, when we take a simple titration of any compound to induce some change and study the change what we can see the change if it is faster change in the optical parameter or change in absorption or energy change or when we do its electro chemical analysis the changed species will be faster response as its electron transfer, what will be faster ? or both the methodologies will be different in kinetics due to different technical aspects and parameters? optical corresponds to the technique spectrophotometric methods . and more elaboratively from which technique we can get better electron transfer kinetics or the accurate degree of minimal observable change.
Relevant answer
Answer
Optical changes are faster
  • asked a question related to Titration
Question
3 answers
Hi all,
I am trying to enrich some lower molecular weight proteins with a C8 Bond Elut SPE cartridge and the recommended elution buffer is acetonitrile in triethylammonium formate (TEAF). Can I make that by titrating FA into TEA or do I need to buy a pre-made mixture? I see protocols for how to make the acetate version but not the formate.
your suggestions are greatly appreciated!
Relevant answer
Answer
Dear Dr Jane Nagel,
I found the same question in another forum, so their question was ''How to prepare 0.25M Triethylamine Formate solution (pH 3.0)?''
The best answer given in that time was:
Mw Triethylamine= 101.19
Density Triethylamine (99%) = 0.726 g/ml
Density Formic acid (95-97%) = 1.22 g/ml
0.25(M)= 0.25 (mol/lit)
0.25 mol Triethylamine (99%) = 25.55 (g) = 35.19 (ml)
Volume of Formic acid (95-97%) = 1000(ml)- 35.19 (ml)= 964.8 (ml)
Add 964.8 (ml) formic acid to 35.19 (ml) Triethylamine solution to prepare 1000 (ml) solution 0.25 (M)
Best wishes,
Sabri
  • asked a question related to Titration
Question
7 answers
I measured different kinds of catalysts which were dispersed in DI water.I firstly added certain amount of HCl and then used NaOH to titrate and measure the pH value. What does this result mean?
Relevant answer
Answer
The point of zero charge (PZC) determination via Mass titration method and adsorption mechanism.
  • asked a question related to Titration
Question
1 answer
The Boehm titration method is often used to identify oxygen surface groups on carbon materials. Whether it can be used to determine the acidic oxygen-containing functional group in biomass and its by-product(for example: biochar from torrefaction) or not?
Relevant answer
Answer
Due to the high ash content in biochar, pretreatment is needed to remove ash/carbonates and prevent interference from DOC when using Boehm titration. You can find information here:
  • asked a question related to Titration
Question
3 answers
I tried to produce TNB [5-thio-2-nitrobenzoic acid] from DTNB [5,5′-dithiobis(2- nitrobenzoic acid)] by alkaline hydrolysis following instructions of some studies : 10 mM DTNB solution made up to pH>12 by adding NaOH and then titrated back to pH 7 with HCl but I can't stabilize the pH at 7 and I have a poor product performance.
Relevant answer
Answer
Dear Nathan Nicolau-Guillaumet a good description of the preparation of 5-thio-2-nitrobenzoic acid from its oxidation product DTNB [5,5′-dithiobis(2- nitrobenzoic acid)] can be found in the following article:
Oxidation of 5-thio-2-nitrobenzoic acid, by the biologically-relevant oxidants peroxynitrite anion, hydrogen peroxide and hypochlorous acid
Reference 17 in this paper refers to the following original research article:
A Spectrophotometric Assay for Allicin and Alliinase (Alliin lyase) Activity: Reaction of 2-Nitro-5-thiobenzoate with Thiosulfinates
Fortunately this paper has been posted by te authors as public full text on RG. Thus you can freely download it as pdf file. The synthetic is preety much the same in both references.
By the way: I don't think that you can prepare 5-thio-2-nitrobenzoic acid simply by alkaline hydrolysis of DTNB. Please keep in mind that DTNB is the oxidation product of 5-thio-2-nitrobenzoic acid. Thus you formally need to reduce the S–S bond in DTNB and then e.g. HCl to generate the free acid.
Good luck with your experiments and best wishes!
  • asked a question related to Titration
Question
6 answers
We have performed ITC to analyze the peptide-polymer interaction focusing mainly on the peptide's stability and biomolecular interaction pattern. My peptide (Molecular weight: 1,209.4 g/mol) in the sample cell has been titrated against a solution containing polymer (70kDa) and an osmolyte (125.15 g/ mol) (both in the same injection). All the compounds are soluble in Milli Q water. The concentration of the peptide and polymer is 1:1 ratio. I'm not sure how to interpret the data (image attached). Kindly help.
Thanks in advance!
Relevant answer
Answer
Hello Krubha - I am not sure of the experiment you are trying to do with the ITC. You have the peptide (in water) in the ITC cell - what is the peptide's molar concentration? Are you looking at the peptide binding to the polymer in the ITC syringe - what is the molar concentration of the polymer in the syringe? Do you expect 1 polymer binding per protein, or another type of binding? If you are expecting 1 polymer binding per peptide, then you want the initial polymer concentration in the syringe to be 10 x higher (in M) compared to the molar concentration of the peptide in the ITC cell.
What is the purpose of the osmolyte, and why is it only in the ITC syringe?
Just looking at the data you presented, it looks like whatever heat changes that are occurring the the titration of polymer/osmolyte into the peptide is essentially over after the 3rd injection.
The fit you got is not appropriate, also I assume you got some sort of error message during the fitting to the 2 sets of sites model?
I need to see the unprocessed raw data - you show the "final figure." I suspect that your 1st 10 injections have a larger injection volume that the remaining injections - due to the lack of heat change after the 10th injection. What does the control titration look like - peptide/osmolyte in water, titrated into water.
As a note, I typically do not recommend using water for ITC, because of its poor control of pH during an experiment.
  • asked a question related to Titration
Question
1 answer
1. Kindly share formula to find out the catalase activity in the soil samples
2. I followed the procedure of volumetric titration method by using potassium permanganate.
Given below is the procedure followed by me:
Take 2 g of soil and add 40 ml of distilled water. Then add 5 ml of 30% hydrogen peroxide and shake it for 20 min. After that add 5 ml of 3 N sulphuric acid. Then filter it through whatsman filter paper. Collect 25 ml aliquot and titrate it with 0.001 M potassium permanganate. (Kuprevich, 1951 ; Johnson and Temple, 1964)
Relevant answer
Answer
How is it possible , unless you narrate all necessary steps with dilution details...?
  • asked a question related to Titration
Question
1 answer
However, when present in multicopy plasmids, lac promoters suffers from the disadvantage of sometimes having unacceptably high levels of expression in the absence of inducer (a.k.a. “leakiness”) due to titration of the low levels of the lac promoter repressor protein LacI from the single chromosomal copy of its gene (about 10 molecules per cell. Please Explain, what does it mean?
Relevant answer
Answer
you normally have 1 copy of the lac promoter and 1 copy of the lac repressor (lacI) on the chromosome. The amount of repressor in enough to control the expression from the 1 copy you have on the chromosome, however, when you have a the lac promoter on a plasmid then suddenly there is much more promoter than the repressor can bind to. Think about it this way, assume you have 10 molecules of lacI which are sufficient to suppress 1 lac promoter. Now you have 20 lac promoters hence you require 200 molecules of lac to control it but the chromosomal copy only produces 10 and these will bind to the excess of promoter hence "titrated" when the lacI molecules bind 1 or 2 promoters the rest of the promoters that do not have lacI bound to them become active in absence of the inducer (IPTG or lactose). To overcome this many plasmid encode a copy of lacI, in this case when the lac promoter copy increase so does the copy number of the repressor (see pet16b for an example plasmid). Alternatively a single copy of chromosomal lacI can be sufficient to control expression from a multi copy vector if the promoter of lacI is mutated to produce higher than normal amounts of the protein (see lacIq1 promoter, with ref added below).
ref:
  • asked a question related to Titration
Question
3 answers
Say you have an enzyme with 3 ligands: a substrate, a cofactor, and an inhibitor. They all interact and effect one another. If one was to conduct a 3-dimensional titration of these ligands, are there any ways to analyze that data to learn about the interaction between all the ligands?
Relevant answer
Answer
It would be helpful to know a bit more about the system in question. What is the nature of the cofactor? Does the reaction happen without the cofactor, or is it essential? What type of inhibition is happening? What do you know about the binding sites of the substrate, inhibitor, and cofactor?
  • asked a question related to Titration
Question
3 answers
If i m Having 3 soil sample than the blank titration value will be same in finding the organic carbon content for all the soil sample.
Relevant answer
Answer
Yes , blank value will not change...
  • asked a question related to Titration
Question
2 answers
how can I calculate the Veq of iodine and the end point in the redox titration of ascorbic acid experiment?
Im performing the experiment with :
0.1350 - 0.1650 g powder
10ml of 1M sulfuric acid
80ml of water
0.05 M iodine (titrate)
1ml starch solution
I need to get to the point which Vt = Veq - 1ml
Relevant answer
Answer
What is the goal of your investigation?
  • asked a question related to Titration
Question
5 answers
How would you determine the Kd in the following situation (by 1D NMR):
You have solution of protein alone to which you add increasing amounts another solution of protein (same concentration as the first) + highly concentrated ligand. In each titration point the concentration of ligand increases, but the concentration of protein remains the same.
If you them plot the variation in the chemical shift of the ligand vs its concentration, taking as a reference the chemical shift of the ligand alone, you end up with a curve where this difference decreases as the concentration of ligand increases (see attach)... I have no idea of the bound fraction, so how can I calculate the Kd?
I hope I'm making myself clear... I have the feeling that this should be easy and I'm missing something simple...
Relevant answer
Answer
Dear Bence Kutus thank you so much for your answer! Actually I do have the chem. shift of the ligand alone. That's what I used as reference to calculate the peaks' shifts. I then normalised all variations in chemical shift against the one that changed the most. I plotted this against the ligand concentration and used the above equation to calculate Kd. The results are consistent with others I have, so I'm guessing this approach should be correct.
  • asked a question related to Titration
Question
3 answers
I want to perform serial battery cell testing namely Cyclic Voltammetry (CV), Galvanostatic Charge/Discharge (GCD), Electrochemical Impedance Spectroscopy (EIS), and Galvanostatic Intermittent Titration Technique (GITT). What is the safest order of serial testing should I take in order to prevent cell damage?.
I ask this because some of these tests are damaging for battery cells. That is why I want to put the most damaging test at the last.
Relevant answer
Answer
Hello Benediktus - Ma'dika. Electrochemical Impedance Spectroscopy (EIS) don, damage the cells, As Electrochemical impedance is the response of an electrochemical system (cell) to an applied potential. While all other techniques damaged the cells so after using for Galvanostatic Charge/Discharge (GCD) first you cant use it for other measurements. But for high C- rate testing you can use the Cyclic Voltammetry (CV) run cell.
  • asked a question related to Titration
Question
2 answers
I carried out a laurdan titration to test different solvent polarity. I was testing new filters in the lab. I added laurdan to water, and carried out a titration. The same was done with ethanol and isopropanol. I worked out the generalised polarisation. For water I obtained +0.099; for ethanol I obtained -0.742 and for isopropanol I obtained -0.617. My question is: how does laurdan behaves in the solvents to obtain these results? Am I getting these results, because laurdan forms micelles in water, and inverted micelles in ethanol and isopropanol? So the tail is exposed to the solvent? but how do I explain the GP values?
Relevant answer
Answer
Yuri Mirgorod thank you very much for help, I really appreciate it. I will look at the thermal phase transition.
  • asked a question related to Titration
Question
4 answers
Dear researcher determination of reducing sugar from titration or any other method which is environmental friendly, cheap in cost less timing consuming and accurate method to determination of sorbitol analysis.
  • asked a question related to Titration
Question
6 answers
Water-Water titrations are a good way to check for possible problems, especially the cleanliness of the ITC and your skills in cell filling. If a water-water titration works well the instrument is in good working order and your cell filling procedure is correct.
During this process, a small amount of water is added to the water-filled cell in several steps and the resulting heat effect is recorded. However, by increasing the amount of water injected (increasing its volume to ten times the usual 1-2 μm), a significantly larger heat effect can be recorded.
I would like to know what effects, presumably resulting from the design of the equipment, are responsible for the abrupt increase in the amount of detected heat.
Relevant answer
Answer
The heat change detected for the water-into-water injections for the ITC (I assume you are using the MicroCal VP-ITC) will depend on injection volume, speed of injection, stirring speed, the cell temperature, and other settings for the ITC experiment. The results can also depend on how clean the ITC cell and syringe are, if the ITC cells are filled properly, the reference cell is also clean and correctly filled, etc.
Adrian Velazquez-Campoy makes an excellent point about the larger injection volumes using the same injection time, resulting in larger heat changes due to turbulence. I recommend an injection speed of 0.5 sec/uL
Another consideration is when you use injection volumes larger than 15 uL with the VP-ITC: 15 uL is the approximate volume that is in the needle of the ITC injection syringe, and this part of the needle is in the ITC cell and filling stem, so this 15 uL of water in the syringe is able to become the same temperature of the sample of the water in the ITC cell prior to the injection. If you have the ITC cell set to 25 deg C and your lab temperature is NOT 25 deg C, you will see a heat change simply due to the difference in temperature with the larger injection volumes. This heat change becomes larger with increasing difference in the lab temperature and cell temperature.
The Malvern Panalytical service team supporting MicroCal ITCs have specific experimental parameters for water-water injections for their testing. They look for reproducible heat changes/injection (within a certain range) as well as measuring the noise between injections. The service team has diagnostic programs that evaluate and "debug" the results (you don't have that program). If the specified test "fails" (non-reproducible heat changes/injection, heat changes much larger than expected, and/or high noise) that suggests one or more issues: the ITC cells and/or syringe could be contaminated, the injection syringe is bent, a possible issue with the injection pipette, or other issues the the ITC system. They can recommend further steps and tests to evaluate your ITC system.