Science topic

Reverse Transcription - Science topic

The biosynthesis of DNA carried out on a template of RNA.
Questions related to Reverse Transcription
  • asked a question related to Reverse Transcription
Question
8 answers
Hi to all.
My question is how can I optimize my RTqPCR if the cDNA dilutions ended up in similar Cq?
I synthesized my cDNA from 350 ng total RNA, assuming 1:1 production I should have 350 ng cDNA in 20 ul right? Then I did a dilution of 1/2, 1/5, 1/10 and 1/20 (I know the first three are consider quite a lot to be used in the run) and used them in a 20 ul run. The gene is a ref. gene: GAPDH. Interestingly the Cq values aren't that different between the dilutions (~29, ~30, ~31 and ~30). Obviously these aren't good values but I don't know what can I do to optimize the run.
Relevant answer
Answer
Thanks for the additional detail. Regarding RIN, yes! A low RIN is indicative of RNA degradation, and fragmented RNA isn't good for downstream applications.
Clean, degraded RNA will give near identical 260/280 and 260/230 ratios to clean, non-degraded RNA, but only the latter is likely to provide viable cDNA.
  • asked a question related to Reverse Transcription
Question
4 answers
Hello everyone,
I have just started working on a microRNA project. The 260/230 and 260/280 ratio of the miRNA was in the range of 1.8-2.1. I did a reverse transcription of miRNA using a stem-loop primer starting from 500 ng of miRNA. I used a superscript II kit as well as a pulsed reverse transcription for this process. However, the cDNA 260/230 ratio was low (around 1) and there was only ten times amplification (5000 ng of cDNA in total). Is this a common phenomenon using this kit?
May I proceed with the qPCR using this cDNA?
Any insights would be helpful.
Thank you.
Relevant answer
Answer
Thank you very much Ehsan Razeghian for the information.
  • asked a question related to Reverse Transcription
Question
2 answers
Hello, I'd like to ask whether it is necessary to add primers or oligo(dt) to Reverse transcription mastermix (MMLV RT)? Is it possible to mix Primer independent RT reaction? If you have any experience with reaction conditions for MMLV I would be grateful for All advices. Thank you.
Bohuš
Relevant answer
Answer
Hi, as Laura said, you need a primer(s) for good quality reverse transcription.
If you want to RT a range of transcripts then you can use random hexamers or random decamers. This has worked well for me when preparing cDNA for gene expression analysis. SuperScript (https://www.thermofisher.com/order/catalog/product/11754050) is MMLV based and may be helpful.
Alternatively you can make the reaction more targeted by using a feature- or gene-specific primer:
- For example, templates for 3' RACE can be generated using a primer with an oligo-dT region to target the polyA tail of mRNAs.
- Or you can use a gene-specific primer to target a specific gene/transcript.
In my experience, the latter is best for lowly abundant transcripts and depending on the gene of interest you may need to try many different primers.
  • asked a question related to Reverse Transcription
Question
5 answers
Can Taq DNA polymerase uses RNA as its substrate? I mixed RT reaction with: dNTPs, RNA of GFP gene, Reverse transcriptase and water and incubated 30 min at 45 °C. Then I mixed PCR with Taq DNA polymerase and as a templat I used 1,5 ul from previous RT reaction. I Saw bands I need but I'm afraid Taq DNA pol could amplify it from residual RNA. I just want to test Reverse transcriptase activity.
Thanks for your responses
Bohuš
Relevant answer
Answer
No, DNA polymerases don't use RNA as a template. If you want to convince yourself, use the RNA (before RT reaction) as a PCR template.
It sounds like you are concerned if your RT enzyme is working, those kits and enzymes do expire.
Now, it is possible to have DNA carryover into your RNA prep. If your no RT reaction gives a band in PCR it's due to residual DNA (not due to DNA pol using RNA as a template)
Does this help?
  • asked a question related to Reverse Transcription
Question
5 answers
Has anyone tried reverse transcription from a DNA template? How well does it work compared to an RNA template?
Relevant answer
Answer
Hello Ela Elyada
I have not tried reverse transcription from a DNA template. Nevertheless, I could refer you to the references below. Maybe these could be helpful.
Gerard G. F., and D' Alessio J. M., Chapter 6 (73-93) From: Methods in Molecular Biology, Vol.16: Enzymes of Molecular Biology Edited by: M. M. Burell 1993 Humana Press Inc. Totowa, NJ.
Best.
  • asked a question related to Reverse Transcription
Question
1 answer
Hi, I'd like to ask whether it is necessary to precipitate MMLV Reverse transcriptase before affinity chromatography purification (Äkta)? My colleague must do this step with his Taq DNA polymerase. He use (NH4)2SO4 or Na2SO4 + PEG. Without this precipitation is polymerase inactive.
Thank you for your responses.
Bohuš
Relevant answer
Answer
the so called Pluthero method to purify Taq is quite old (1993) and while simple it can result in low yields and DNA contaminants (see "A simple and efficient method for extraction of Taq DNA polymerase" 2015)
I don't think the ammonium sulphate precipitation is required for activity (please correct me if I' wrong) but it may be worth a try on MMLV RT, as they are very different proteins. Yields are sometimes not very important and Am sulph precipitation can be a very useful method to isolate/purify and concentrate protein preps. I might just use a modern MMLV RT prep like this https://www.protocols.io/view/recombinant-protein-expression-of-mmlv-rt-h-yxmvmxmw9l3p/v1?version_warning=no
iff your constructs are similar, good luck!
  • asked a question related to Reverse Transcription
Question
2 answers
Can someone help me by solving this issue?
I have a cell culture of THP1 cells and I need to extract RNA but the cells are frozen and they have been washed by PBS and 0.1 M BSA is added. The RNA is used for reverse transcription and then qPCR is going to be performed.
What is the best way to deal with the frozen cells before we start extracting?
Should the BSA be removed? Or should I just scrape the cells and pipette the mixture out?
Relevant answer
Answer
Frozen cells when you are trying to harvest them for RNA, it is always advisable to take the cells out either from liquid N2 or -80 and thaw them in a water bath (37 degrees) for 4-5 min. 2 steps you can follow:
1. culture them minimum for 1-2 passages by adding the entire thaw mixture to 3 ml of respective media in a 60mm dish. once the cells attain morphology and are confluent enough.
2. If you would like to harvest the cells immediately, thaw the cells and collect them in a 15ml conical flask, centrifuge them. Then you definitely need to wash with PBS (Not BSA in PBS). This washing step is necessary to remove the DMSO in freeing media as well as FBS which is present in culture medium. After the PBS wash, centrifuge them, remove the supernatant and add 1ml of trizol solution and proceed with RNA extraction steps.
  • asked a question related to Reverse Transcription
Question
4 answers
I am trying to set an experiment on molecular detection of miRNAS in MDS, using RT-PCR. I have chosen the poly T adaptor method.
I am starting with total RNA and I want to proceed with polyadenylation, reverse transcription for miRNAs, and real time pcr with SYBR green method, all custom made.
I decided to use specific primers pairs from previous publications.
But, I am dealing the gap of poly T adapter.
Could you please explain me, how to design this and the universal primer that I need to complete the setting of my research?
Thank you, in advance
Relevant answer
Answer
Hi Christina,
If you have chosen the poly T adaptor method, first you have to add the poly A tails to all transcripts within a sample, then reverse transcribe using a set of 12 modified oligo(dT) primers containing a unique sequence tag at the 5′ end and two bases at the 3′ end. To see this in a figure - that is more simple - look fig 1 of this protocol: Fiedler S.D., Carletti M.Z., Christenson L.K. (2010) Quantitative RT-PCR Methods for Mature microRNA Expression Analysis. In: King N. (eds) RT-PCR Protocols. Methods in Molecular Biology (Methods and Protocols), vol 630. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-60761-629-0_4 (as described in Fig. 1 and Subheading 3.2.3; (16)).
Amplification is then achieved using a PCR primer specific to the miRNA of interest (the F primer) and a R primer specific to the tag.
Best of luck!
  • asked a question related to Reverse Transcription
Question
5 answers
Hello everyone,
Greetings!
Hope everyone is fine and in good health in the current Covid19 pandemic.I would like to know the difference between the Reverse Transcriptase-qPCR and normal realtime qPCR.If we can extract DNA directly from the cells and then prepare the samples for qPCR then why do we go for Reverse Transcription step to prepare cDNA and then qPCR?Kindly explain in detail.
Thank you,
Relevant answer
Answer
Hello Abdul Rouf
RT-PCR, also known as Reverse Transcriptase PCR, typically measures RNA expression levels. In RT-PCR, complementary DNA (cDNA) is made by reverse transcribing of the RNA template with the enzyme reverse transcriptase.
This technique is used to qualitatively study gene expression and can be combined with real time PCR (qPCR) to quantify RNA levels. RT-PCR is used in research laboratories to study gene expression, for example in experiments to distinguish exons from introns, and can be used clinically to diagnose genetic diseases and monitor drug therapy.
Also, RT-PCR is commonly used in the diagnosis and quantification of RNA virus infections (e.g., human immunodeficiency virus, hepatitis C virus, corona virus) and the analysis of mRNA transcripts such as those produced by translocations commonly associated with non-Hodgkin's lymphomas, leukemias, and sarcomas.
Gene expression profiling is likely to have a major impact on molecular diagnostics and will depend on RNA analysis using RT-PCR and possibly high-density arrays.
So, it is not always extracting DNA directly from the cells and then preparing the samples for qPCR. Sometimes, we have to go for reverse transcription step to prepare cDNA and then do qPCR.
Hope this information helps!
Best Wishes.
  • asked a question related to Reverse Transcription
Question
7 answers
I am trying to check expression of hsp-70 by reverse transcriptase PCR in human sperm. But I am not getting anything. However I checked the quality of cDNA by internal control (GAPDH expression), and the cDNA was fine. When I use the same primers for other sperm/somatic cell samples, the primers are working fine.
Can someone please suggest how to overcome this problem?
Thanks
Relevant answer
Answer
Before and after exercises would be an amazing topic to search
  • asked a question related to Reverse Transcription
Question
5 answers
I want to do a toeprinting assay to map translation start sites. Typically, these experiments are carried out with radioactively labeled oligos that are extended using reverse transcriptase. However, working with radioactivity is difficult in my institution, and I would like to avoid it.
I am thinking of an alternative. Specifically, what I am planning to do is to use 5'-biotinylated primers, then employ reverse transcriptase as in the standard protocol, then run the primer extension products on a PAGE gel, then transfer it onto nitrocellulose membrane just as if it were a Western blot (I would use the exact same protocol, just leaving out the SDS), and finally stain the membrane with streptavidin-HRP.
To my surprise, I nowhere found a protocol like this in the literature. Instead everybody keeps working with radioactively labeled primers. This suggests to me that my plan is probably a bad idea, because somebody must have tried this, right?
If anyone would like to way in, I would appreciate an opinion. I'd be happy about any support for my experimental layout, any concerns why this might/will not work, or suggestions on how I could optimize the plan ...
Relevant answer
Answer
I understand. That makes sense. Thanks for the clarification. This is very helpful!
  • asked a question related to Reverse Transcription
Question
3 answers
I would like to know the lentiviral titre before i proceed with my transductions. Reverse transcription RT-PCR can be used for knowing the viral titre however i need to isolate genomic RNA (shRNA) from the lentiviruses for doing that . Though commercial kits are available for isolating RNA from viruses , i would prefer a lab protocol rather than a kit as it would be more economical..
Relevant answer
Answer
Filter the supernatant/medium containing lentivirus. Use TRIZOL (virus solution: TRIZOL, 1:9) directly for viral RNA extraction (follow the manufacturer's protocol).
  • asked a question related to Reverse Transcription
Question
4 answers
I'm trying to clone some cDNA, but when I PCR the cDNA with my primers, I get no product on the gel. So I checked around and found out that I might be missing the second strand synthesis step, could this be the reason for the lack of product? My cDNA is fine, and appears on agarose gel, and I have also used this for qPCR, amplicons look fine on the bioanalyser.
Also the second strand kits are too expensive to purchase, does anyone have a protocol that has worked for them? I can purchase the second strand buffer from NEB, they used to sell this with the second strand enzyme mix (RNAse H, E coli polymerase and E coli ligase) but have discontinued it.
My second issue is that the e coli ligase in the quantity on the NEB protocol is a lot and also too much to purchase, does anyone have any protocol without e coli ligase? Will be very grateful for your help, been stuck on this process for too long. Thanks
Relevant answer
Answer
As Didier Poncet pointed out, you should be able to do PCR with only one cDNA strand. And if your qPCR is working, then that confirms it. I would double check the PCR conditions, are your primers really correct and expected to be present on the cDNA? Do you have the right conditons?
  • asked a question related to Reverse Transcription
Question
5 answers
Hi!
I am using a reverse transcriptase called "Maxima H minus" (Thermo#EP0753). Its protocol recommend using the Thermo Scientific™ RiboLock™ RNase Inhibitor (#EO0381). However, our lab are rich in stock of Takara recombinant Rnase inhibitor (2313A) and it takes too long to wait for the EO0381. What is the difference between the two inhibitor and can I just simply replace the Thermo Scientific™ RiboLock™ RNase Inhibitor with Takara recombinant Rnase inhibitor?
Thanks!
  • asked a question related to Reverse Transcription
Question
3 answers
Can I use 'quantitect reverse transcription kit' storaged in refrigeration temperature for 20 days?
Originally, it should be stored at -20 celsius temperature scale.
Relevant answer
Answer
Shin Jieun Have you tried it out? Is the enzyme working fine? My lab freezer is faulty. All the reagents in -20 melted. I think this lasted for 12 hours.
  • asked a question related to Reverse Transcription
Question
5 answers
Hi!
I am having some DNA probe conjugated on gel surface (polyacrylamide) and I want to perform reverse transcription and PCR after the DNA probe capture target RNA. Yet the volume of water absorbed in the gel cause a problem. How should I calculate and decide the amount of reaction mix to use? should I directly add same volume, 2X concentration onto the gel (20ul gel in a well)?
Thanks!
Relevant answer
  • asked a question related to Reverse Transcription
Question
8 answers
Hi!
It is commonly used of silica membrae membrane in DNA extraction column to bind and release DNA. Yet I wonder can I simply use extraction tube to filter and collect ~20um beads (conjugated with DNA), then take out the whole membrane for the downstream reverse transcription, exonuclease and PCR. Will the membrane block or impede the enzyme to access the DNA on spheres? The membrane will be fully immersed in the reaction mix.
Thanks!
Relevant answer
Answer
  • asked a question related to Reverse Transcription
Question
11 answers
Hi!
I am trying to perform a drop seq from Macosko's protocol. Yet I found a very interesting point that 40ul 20% Ficoll PM 400 is added to the reaction mix. What does this do?
Thanks!
ps: here is the full reverse transcription recipe in Macosko's protocol. The mRNA has already bound to the poly T primer on the surface
75ul H2O
40ul Maxima 5x RTBuffer
40ul 20% Ficoll PM 400
20ul 10mM dNTPs(Clontech)
5ul RNase Inhibitor(Lucigen)
10ul 50uM Template Switch Oligo
10ul MaximaH-­‐RTase (add after you’ve begun the breakage portion of the protocol
Relevant answer
Answer
Welcome, you can find the answer after reading the research sent to you.
  • asked a question related to Reverse Transcription
Question
4 answers
Hi!
I am doing a screening of cell phenotype. Because of the high throughput and few cell number (500-1000 cells in 6-10ul) in each well, it may be better to just process cell lysate to reverse transcription without RNA extraction (directly add reaction mix to lysate). Are there any optimised and commonly-accepted recipe for this purpose?
Thanks!
-----------------------------------------------------------------------------------------------------------------------------------
also how should I design the volume ratio of cell suspension : lysing buffer : RT reaction mix, to minimise the cost of RT reaction mix (it accumulate fast considering well number)? Heat complementary lysing is possible in this system as well (heat up to 65 or even 80 ℃ to break cells).
  • asked a question related to Reverse Transcription
Question
5 answers
Hi!
We are trying to perform RT-PCR on a conjugated functional surface. However because of the conjugation either heat or SDS deactivation is not possible and the current way is simple wash. How will the residual Reverse transcriptase influence the downstream PCR? Is there another way to eliminate or deactivate Reverse transcriptase?
Thanks!
Relevant answer
Answer
Zonghan Gan , I also wouldn't expect that the reverse transcriptase is causing trouble, as there should be no substrate left. If it still does, removing it with immobilized antibodies against it might do the trick.
If there is residual mRNA left and interferes, adding a little RNAse A after the RT step should help.
  • asked a question related to Reverse Transcription
Question
3 answers
I accidently found out cDNA can be generated in the absence of RT primers, in other words self-primed cDNA. This happened due to the first strand synthesis kit I am using at the moment which has only one tube that contains everything except DMSO and primers. I wanted to include RT minus as negative control but since it was not possible with this kit, I omited RT primers instead expecting not to produce any cDNA. Well, it was not the case... The Ct values from primed and unprimed cDNA samples are exactly the same. I got suspicious since I did not know this could be possible, I searched in the literature. I came across several papers which adressed the problem and claimed that it could be due to secondary structures of RNA (folding on itself) and unspecific feature of reverse transcriptase enzyme. The RT enzymes also have reduced activity of RNAseH which could also contribute to this observation. The increased RT temperature also increased the RT specificty in publications, which was not the case in my experiments since I observed at 37 and 55C RT primed and unprimed cDNA showed almost exactly the same cT values. I want to ask now, are you aware of this self-primed cDNA issue? Should we ignore eventhough cDNA was not made by RT primers but somehowelse. I also included RT- sample (using another cDNA kit) which did not give any signal; this tells there is no gDNA contamination in my samples or qPCR primers are not picking gDNA but only cDNA .
I know none of us include such negative controls apart from RT(-). I guess RT enzyme is efficienctly reverse transcribing RNA to cDNA regardless of RT primers. If this is the case why we even bother ourselves adding RT primers? :)
/Sibel
Experimental details:
I converted 2ug of total RNA (in 20 uL rxn mix) using first strand cDNA synthesis. No DNAse I treatment. I compared both random primers and oligo dT primers.
Diluted cDNA samples 20x to get 5ng/uL and took 2uL (10ng) for qPCR reaction in total volume of 20 uL. Used SYBR green power track.
P.S: the melting curves from unprimed and primed cDNA samples were the same.
Relevant answer
Answer
I have two extra comments to add to the above.
First - The purpose of an RT-minus control (no reverse transcriptase) is to test your sample for the presence of DNA contamination. In the absence of this control and without DNase treatment, how sure are you that residual gDNA is not contributing to these results?
Second - widespread self-priming is much more likely when there is a considerable amount of degraded RNA present. Small fragments of RNA (~6-25nt) arising from degradation of larger RNAs can act like primers in the reverse transcription, and the more of this material is present, the more self random priming is possible. In routine randomly primed cDNA synthesis, this isn't really a problem because the material produced (short randomly primed cDNA fragments) is essentially the same thing you were trying to produce anyway. But in certain assays where gene-specific priming is used, the presence of off-target cDNA can be a big problem for the assay.
There are two strategies you can use to reduce this effect when important for your experiment. Firstly, because more RNA degradation means more short RNA fragments available to act as primers, take all possible steps to maximise the quality of your RNA samples and check their integrity on a BioAnalyzer before proceeding with reverse transcription. Secondly, keep in mind that the smaller the fragments are, the lower their dissociation temperature. This is why RT reactions primed with random hexamers must include a primer extension step (a brief incubation at 25C) before the reaction temperature is raised to ~42-50C for reverse transcription. If you are performing targeted reverse transcription using a ~20-30nt primer with a melt temp of 50C or higher, you can set up your RT reactions on ice and then transfer them directly to a preheated thermal cycler. By avoiding exposure of the sample to any temperature between ~4C and ~42C, you remove the opportunity for these small random fragments to be extended and maximise the amount of cDNA which is derived from your primer.
  • asked a question related to Reverse Transcription
Question
3 answers
Hi,
I'm doing RNA Extraction, Reverse Transcription and qPCR on synovium samples from mice that are dissected in half. I use Thermo-fisher RNAqueous Micro Kit for the RNA Extraction.
During RNA Extraction, I first remove the sample from -80 and immerse it in 100μL of lysis solution. then I homogenize the sample using the following mixture;
1. 10 ml PBS (without Calcium chloride and Magnesium chloride)
2. 1 tablet of protease inhibitor
3. 500μL Tween 20
then I add 1000μL of this mixture to my sample and use manual homogenizer to homogenize my tissue.
after that, I add 50μL of 100% ethanol to my samples and apply it to silica-based filter. then I centrifuge it at max speed for 30 sec.
then I wash it 3 times with 180μL wash solution 1 and 2 and centrifuge it for 10 sec after each wash. at the end, I centrifuge it for 1 min.
Then I replace the filter cartridge with new one and elute the sample in 7.5μL of elution buffer that is pre-heated to 75C. Incubate it for 1 min and spin-down for 30 sec. Then I repeat this step with another 7.5μL of elution buffer.
For Reverse transcription, I take 14.8μL of sample with 1μL of Oligo dT and 1μL of 10mM dNTP (16.8μL final volume)
then I place it in thermo-cycler for 5 min.
After that, I add 0.2μL of RNAase inhibitor, 1μL of M-MuLV Reverse Transcriptase and 2μL of 10x reverse transcriptase buffer to the sample and place it in thermocycler (37C for 50 min, 72C for 15 min, 4C infinite hold),
for qPCR, I dulcet the cDNA using 1:5 RNAse and DNAse free water, then further dilute it in RNAse and DNAse free water to get 1:50 dilution.
Then I add 4μL of diluted cDNA and 6μL of mixture including 0.6μL of forward and reverse RPLP0 primer (10mM concentration) and 5.5μL of 2x SYBR GREEN PCR Master Mix. and load my sample in 384-well plate and run it.
I tried changing my dilution to 1:25 instead of 1:50 but still don't have the result.
When I use cells (THP1) around 450,000 cells, Cq value is around 27.3 but for synovium is around 34. Still, both values are high for RPLP0 gene.
Relevant answer
Answer
Hi,
As I found out your Ct value is high, right?
There are many possibilities for the delay in Ct, the following solutions can be helpful:
1. Suitable concentration is 100 ng cDNA per 20 µL reaction. So, have you checked the quality and integrity of your extracted RNA using NanoDrops and agarose gel electrophoresis? Because you need to know your RNA concentration so that you can estimate your cDNA concentration in the next step.
Note: If the cDNA concentration is high, the concentration of inhibitors also increases and can result in a delay in Ct.
2. Suitable concentration of primers is 0.2 µM
If you tried these two and did not get the result, I suggest you change your materials. For example: using new master mix, sample re-extraction and ethanol percipitation, using RNA extraction kit and cDNA synthesis kit from other companies, using new master mix (from another company), etc
  • asked a question related to Reverse Transcription
Question
9 answers
I will sequence viral nucleic acids using Nextera XT library prep. I was informed by Illumina that the input must be dsDNA, at least 300-bp. I am wondering how to get it. I have a commercial kit to prepare the first strand using the viral RNA as template. My problem is synthetizing the second strand. I have seen a strategy where you must use a number of enzymes (RNAse H, ligase, polymerase), but I understand that this is more adequate when you work with long eukaryotic mRNA. For constructing the first strand, I will use random primes. Could I synthetize the second strand using random primers and only a polymerase (Klenow fragment)? In this case, how I would break the RNA/cDNA duplex? Is it possible (and necessary), to validate each step (first strand, second strand) with a qubit fluorometer?
Also, should I eliminate the viral DNA before the reverse transcription? Or may I keep it, get the cDNA for the viral RNA, and use the same reaction tube, with DNA and cDNA, to prepare a single Nextera XT library?
I know that there are commercial kits that prepare both strands at once, however I just found very expensive options (such as SuperScript™ Double-Stranded cDNA Synthesis Kit). If anyone knows a less expensive alternative, I would appreciate the advice.
Relevant answer
Answer
We are using a protocol for viral ds-cDNA synthesis, and it works well. see this article:
  • asked a question related to Reverse Transcription
Question
2 answers
Hi!
In single cell droplet sequencing, 2 cell lysis buffer are often chosen: 0.5%CA-630, or 0.2% sarkosyl 160 + 6 % of the Ficoll PM 400. What is the difference of these 2 choice in RNA yielding, mRNA completence and etc.?
Thanks!
Relevant answer
Answer
Hello Zonghan Gan based on my understanding both are used for protein isolation. Igepal or CA630 is nonionic detergent usually used for membrane proteins, the latter is a modified gradient lysis buffer that is milder than SDS in denaturing proteins mixed with ficoll it allows for size separation and inhibiting protein aggregates or cell clumping. I would think both would give variable RNA yield based on their use. Igepal usually gives a higher yield as it disrupts membranes efficiently but it depends on the concentration you use. As for sarkosyl I expect RNA yield to be much lower and contaminated with RNA binding proteins. If I had to choose I would choose CA630. check ref (PMID: 26242641) for CA630 efficiency in RNA yield / efficiency. Good luck.
  • asked a question related to Reverse Transcription
Question
5 answers
I have been reading several publications where reverse transcription was performed and I have seen that in many cases RNase H is used after reverse transcription and during second strand synthesis, and in many others RNase H is not used. Trying to understand why, I have read in Superscript III (Invitrogen) manual that amplification of some PCR targets (>1 kb) may require the removal of RNA complementary to the cDNA and RNase H should be used. In my personal case, I just want to reverse transcribe my RNA, make double stranded cDNA and build Illumina libraries. Do I need to treat with RNase H after RT? Thanks in advance for any help with this.
Best wishes
Niccolò
Relevant answer
Answer
Thank you for the information regarding RNase h.
Can someone help me with the 3'RACE experiment? I am facing hurdles while performing 3'RACE to find out 3'UTR from an unknown genome sequence. It would be very helpful. Thank you
  • asked a question related to Reverse Transcription
Question
2 answers
Dear all,
I am currently working on a reverse-transcription protocol (otal RNA extracted from CHO cells, then reverse-transcribed to be used in qPCR) with QuantiNova Reverse Transcription kit supplied by Qiagen.
When performing a negative control (ie., no template RNA), I obtain approx. 2 µg/µL DNA. I measured out the RT mix alone (containing oligo-dT, random primers and dNTPs), diluted 1:5 (4 µL in a total reaction volume of 20 µL when performing RT reaction), and obtained 3 µg/µL DNA.
I would like to know how to determine the cDNA concentration of my samples, as far as components of the RT mix are also absorbing (without performing a blank with RT mix each time).
Many thank for your help,
Lucie
Relevant answer
Answer
Hi,
I am wondering why you might need to know the concentration?
It's fairly well accepted that trying to measure cDNA concentration after the RT is massively inaccurate as you've also found. It is generally assumed that you get roughly 1:1 conversion of RNA to cDNA (although this is also highly variable).
As this is the case, it's more usual to normalise the amount of RNA being used in the RT reaction rather than attempting to measure afterwards.
However, this is not actually required either. If you are using multiple endogenous controls (housekeepers) in your qPCR experiments, these should allow for normalisation of input RNA/cDNA (in the Delta Ct step of analysis) and so there should be no real advantage in knowing your input cDNA concentration.
I usually advise a minimum of 3 housekeepers in any experiment since more HKs = less variability and you can drop any that are not stable across your sample set.
Hope that helps.
Ben.
  • asked a question related to Reverse Transcription
Question
3 answers
Hi!
A special primer has to be used with only 19 bp poly dT (Tm 44.9) instead of 30 bp in original study (Tm 55.2). Will this induce failure of mRNA capture? Will this cause RNA detachment in Reverse transcription using Superscript II (@42 ℃)? If this is a problem, how about start reverse transcription @ 37℃ or 40℃ for 20min, then rise it to 42℃? Will superscript II be completely block at lower temperature?
Relevant answer
Answer
19T-V is better than 19T in targeting the beginning of the polyA site, yes. I believe 19T-VN just gives a slightly tighter clamp.
As to the reaction conditions, yes: heat your RNA + oligodT to 65 for 5 mins, crash cool on ice, then add the buffer/dNTPs/enzyme, mix well, spin down briefly, leave at RT for 10mins, then over to 42 for 25mins.
  • asked a question related to Reverse Transcription
Question
5 answers
For some reason, we need to have sodium chloride (NaCl, 0.05-0.1M) in our system. Will this affect the reverse transcriptase and block the SMART reverse transcript?
Thanks
Relevant answer
  • asked a question related to Reverse Transcription
Question
4 answers
Hi everyone. For my project I have to reduce the time for reverse transcription of mRNA.
We are using High Capacity cDNA Reverse Transcription Kit from Applied Biosystems.
It's recommended there to use the the extension time of 120 minutes.
The same time I see the general recommendation for MMLV RT 60 min.
Where came this 120 min from?
Could anyone suggest where I can read something about it?
Thanks in advance!
Relevant answer
Answer
  • asked a question related to Reverse Transcription
Question
6 answers
When targeting long fragments (2 k bp) by rt-PCR from double stranded RNA template, should we opt for one step (same primers) or for two steps (random hexamers for rt, and specific primers for pcr)?
Relevant answer
Answer
"One step": higher sentitivity, but you can onlyquantify this one sequence
"Two step": lower sensitivity, but it' spossible to quantify other sequences as well
  • asked a question related to Reverse Transcription
Question
3 answers
I am looking for synthesizing cDNA from total RNA, isolated from wheat leaf. I have GoScipt Reverse Transcription Kit. After some searching, I have found that this MMLV reverse transcriptase does not have RNaseH activity nor the kit has any separate RNaseH enzyme.
Can I use this kit for synthesizing full length cDNA for cloning purposes? Or I have to use separate kit/ RNaseH?
N.B. My target gene is 1.6Kb in length
Relevant answer
Answer
The RNase H activity of reverse transcriptase acts as an endonuclease that hydrolyzes the RNA strand in an RNA/DNA hybrid to generate 5′ phosphate and 3′ hydroxyl ends. Please see the attached document for detailed description.
  • asked a question related to Reverse Transcription
Question
18 answers
Hello, I am not too clear with protocols I get on choice of Reverse Transcription primers for cDNA synthesis. I know that random primers are used for prokaryote samples and oligodt primer for eukaryote. Also I have come across protocols that uses both random and oligodt primers for eukaryotes cDNA synthesis. I have once used both and reverse transcription was fine but after amplifying my gene of interest I got polyA tail noise in my chromatogram abi file (70% of bP). I want to know if it's possible to use only random primers for eukaryote mRNA Reverse Transcription, if I got no oligodt primers for reverse transportation.
Relevant answer
Answer
Yes, it's possible to use only random primers for eukaryote mRNA Reverse Transcription. For example, the ABI high capacity kit uses random decamers only, no oligo(dTs).
  • asked a question related to Reverse Transcription
Question
3 answers
I would like to evaluate the amount of reverse transcription (cDNA) on a 20um fixed mouse brain section. I am using random primers with RevertAid H Minus M-MuLV (reverse transcriptase).
and would like an estimation of the reaction efficacy on different protocols.
Relevant answer
Answer
You could use reverse transcription quantitative PCR and may have to combine with immunochemistry procedures.
  • asked a question related to Reverse Transcription
Question
3 answers
I've been wondering if removing the random primers from the reverse transcription reaction either with a column or precipitation before using it as a qPCR template reduces the background a bit in later cycles.
Notes:
1. I am working with bacteria so some amount of genomic DNA amplification is inevitable no matter how much I DNase treat it.
2. I am using the BioRad iScript kit for reverse transcription.
3. I am quantifying cycle thresholds with a real time PCR machine using Sybr Green.
Relevant answer
Answer
Theoretically, if you remove the non-target cDNA, it could possibly improve the sensitivity of the reaction, but I think that improvement will be negligible.
In practice, if you eliminate non-target cDNA (after RT), either by column, magnetic beads, or by precipitation, you will lose concentration of the total cDNA. This can worsen the sensitivity of PCR.
An alternative option is to do the RT with specific primers instead of random primers. That would make your total cDNA correspond only to the target of your PCR, and no purification of the cDNA would be necessary. Also mention that it is very important to treat the total RNA extracted from the bacteria with DNAse.
if my answer has been useful, please recommend it.
:) :)
Good luck and Merry Christmas Alex!
  • asked a question related to Reverse Transcription
Question
1 answer
Hello everyone,
I would like to know how cell growth and proliferation can impact the expression of some proteins. In other terms if a fixed amount of cells was seeded in 12 well plate in Day0 and then each day a Well was lysed. RNA extraction is performed for all samples and then reverse transcription then PCR. Knowing that for reverse transcription the same quantity of RNA is used for all samples, how can we explain the variation in the expression of the target ?
Relevant answer
Answer
That is a complex topic. Cell state is dependent on multiple factors including: growth factors, nutritional needs, osmotic pressure, CO2 content, temperature,... which are dependent on your incubator and growth medium. Next, cell will slow down proliferation after they hit 70-80% confluence which will affect expression profile. I have noticed differences in expression within triplicates located on the same plate started from the same cell stock.
  • asked a question related to Reverse Transcription
Question
6 answers
The FFPE tissues are relatively difficult to extract the RNA from so, how one can use reverse transcription based PCR
Relevant answer
Answer
No..
  • asked a question related to Reverse Transcription
Question
2 answers
I wonder if the positive control primers and probes authorized by the US CDC for amplifying human RNAse P are specific to the RNAse P chromosomal DNA. My thought process is that if primers are created that are specific to cDNA for RNAse P (i.e. the primer crosses a region between two exons, eliminating it's ability to bind to the chormosomal gene) then those primers could be used to validate the reverse transcription step in RT-PCR.
#covid19 #RT-qPCR #diagnostics
Relevant answer
Answer
it appears that RNAse P is all one exon, which to me makes it seem like a poor candidate for discriminating between gDNA and cDNA products from a PCR reaction...
This has led me to the idea of designing primers that amplify cDNA, but not gDNA in order to control for the the reverse transcription step in diagnostic RT-PCR including those for detecting COVID. I found this paper that outlines a list of human housekeeping genes (that have similar expression levels across cell types) and that have similar isoforms expressed across cell types (i.e. the mature mRNA transcripts are made up of the same exons)
My new idea is to design PCR primers that will only anneal to the cDNA template, and not gDNA template. The way that I would do this is to design primers that anneal to a region that includes an exon junction, and empirically test whether those primers work to successfully discriminate between cDNA and gDNA of those human genes.
Does this seem like a good approach?
Why or why not?
  • asked a question related to Reverse Transcription
Question
17 answers
So far, RT-PCR testing has been the frontline response to the COVID-19. PCR testing is considered as the gold standard for detecting COVID-19 and was designed by WHO, soon after the virus was identified. The PCR test employs reverse transcription of the viral RNA and loop-mediated amplification for the detection of the viral RNA.
The lateral flow immunoassay detects antibodies IgM and IgG and provides historic information about viral exposure of the individual. In comparison, PCR tests are highly accurate but the requirement of shipment of clinical samples takes about 24 hours at best. On the other hand, immunoassays provide results in 20–60 minutes but are less accurate since antibody response takes time to characterize. Several kits with SARS-CoV-2 antigens: the N protein and the S1 and S2 domains of the S protein have been developed with sensitivity over 90%. However, the difference of 10% can initiate the spread of the virus. In early-stage i.e. between 4–10 days, the test provides a sensitivity of just 70% (IgM detection). The sensitivity between 11 and 24 is about 92%. Further, the detection of IgG offers a sensitivity of 98%. Given the circumstances, the integration of PCR testing for a negative result might be useful for battling the COVID-19 outbreak.
Relevant answer
Answer
We can go for both and then decide accordingly. In India, if the immunoassay is coming positive, the patient is labelled as positive whereas if he is negative, it has to be confirmed by RT-PCR.
  • asked a question related to Reverse Transcription
Question
5 answers
I have performed a reverse transcription using the High Capacity cDNA RT Kit but due to an error in programming the thermocycler instead of one cycle (25C-10min, 37C-120min, 85C-5min) the last step continue for 29 mins, so the cDNA samples have been at high temperatures (85C) during half an hour aprox. I want to do rt-PCRs with those samples, do you think I can use them? I will be doing a test with some samples anyway but I would like to know what can be the consequences to have cDNA at high temperatures.
Relevant answer
Answer
It should not be a problem, cDNA is thermostable. I would suggest you try them once by PCR. If you want, you can just repeat reverse transcription for one of your samples and have it as a kind of control along with the rest of the samples.
Good luck
  • asked a question related to Reverse Transcription
Question
1 answer
I've tried a couple of methods, including Qubit and Fragment analyzer. They all didn't work. Is there a well-established way to measure DNA-RNA complex concentration? Thanks.
Relevant answer
Answer
We create cDNA libraries for Next-Gen Sequencing in our lab, and we measure concentrations at the end of our process using Qubit, or qPCR. This might not be similar enough to your RT reaction - our samples go from Total RNA to fragmentation, ligation and amplification, and so maybe our measurements are only successful because we amplify cDNA?
I would recommend looking into a qPCR method for quantitation, since it's a lot more sensitive; our cDNA libraries get diluted down to 1:10,000 and compared to a 4-point standard curve for quantification; we see a typical range of 10-50ng/uL of final cDNA library.
Best of luck!
  • asked a question related to Reverse Transcription
Question
10 answers
GAGTTCCAGGTCACTGTCACTGGCTCAGGGA
Relevant answer
Answer
It's Tm is 66.9°C, so a couple degrees less then that should be your annealing temperature. To be absolutely sure you should perform a "temperature gradient" on a couple of samples since it will also slightly depend on your PCR kit and your thermocycler. However, 31bp can potentially be too long for a primer - it can anneal to itself. Ideally, try to design specific primers between the size of 18-22bp.
  • asked a question related to Reverse Transcription
Question
23 answers
Im using a Nucleic Acid Detection Kit for Multiplex Real Time RT-PCR. Its content is:
- PCR Reaction Mix (Transcript II Multi probe one-step qRT-PCR SuperMix 1 UDG)
- PCR Reverse Transcriptase (RT plus RNase inhibitor)
- PCR Primer/Probe Mix (Primers and probes for ORF1ab and N genes; primers and probes for the control-RNase P gene)
- Positive Control (In vitro transcribed RNA with ORF1ab and N gene sequences; In vitro transcribed RNA with the control-RP gene sequence)
- Negative Control (Water)
Regarding I do not own a qPCR termocycler. Im performing a regular PCR and then run a electrohpresis gel. The product length for RP primers is 65pb and the product length for ORF1ab's primers is 129pb.
The protocol specified by the manufacturer is a one-step RT-PCR program:
1 cycle at 50°C for 5 min (Reverse Transcription)
1 cycle at 95°C for 30s (Pre-denaturation)
45 cycles of:
95°C for 5s (Denaturation)
60°C for 30s (PCR cycling)
The problem is that my positive control is not showing a positive result (I do not see a band in 129pb)
But the PCR works fine because I see bands in 65pb (RP gen) in the Samples wells.
I do not perform a DNA clean up in the extraction process. Should I do it? (Im using a ARN/ADN extraction kit with spin colunms, proteinase K, etc). So my sample has DNA and ARN.
My question is: Is it possible that the bands I see in 65pb in samples are produced by the primers bining to the original ADN (from the extraction) and not produced by primers binding to the cDNA? (which should be product of the Reverse Transcriptase transcribing the mARN to cDNA, and the syntetic ARN to cDNA too)
My assuption is that there is no cDNA then there is no bands in 126pb. Why there is no cDNA? Posible causes:
1) Reverse transcriptase is not working. Why? how to verify?
2) Positive Control ARN is degraded. Why? how verify?
3) Other issue? any ideas?
Thank you in advance!
Relevant answer
Answer
Hi, Donato.
You're more than welcome and I'm more than happy to know I could give some help.
Last but not least, If our support helped you, let us know if you got good results and share your final protocol. If it is not a problem. Ok?
All the best.
  • asked a question related to Reverse Transcription
Question
4 answers
what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?
Relevant answer
Answer
Dear Mohamed,
If I am right what you are looking for, then this is my reply.
The formula for the annealing temp (Ta) is = Melting temp(Tm)-50C
there are four formula for calculating the Tm are,
1. Wallace equation,
2. Marmur and Doty equation,
3. Salt-adjusted method,
4. Neared-neighbor method.
For calculating Ta for your 31bp primer you must calculate first Tm, and for that, you have to check the ATCG content in your primer. there are different online software to calculate the TM and Ta, if you do manually you will learn more.
Make sure you must have Tm between 50-650C.
Elongating temperature is used for the extension after the annealing of the primer, and it depends on the Taq polymerase, which works great around 720C.
Hope you will find this helpful.
Thank You.
  • asked a question related to Reverse Transcription
Question
2 answers
We have done a survey to confirm the occurrence of NDV and H7N3 in one province. We have performed Rapid HA, Agar gel precipitation test (AGPT) and Reverse transcription polymerase chain reaction (RT-PCR). Along with all above tests we want to perform Phylogenetic Tree test on ND and H7 genes but i am confused whether we add this test or not? What is the worth of phylogenetic tree test in this research project?
Relevant answer
Answer
Le virus involved should be sequenced then analysed through ohylogeny study, which is necessary to know the nature of the circulatibng virus and its relationship allowing you to adapt your control means..
  • asked a question related to Reverse Transcription
Question
13 answers
I use around 1 microgram of RNA for the reverse transcription. So far I've been using 2 microliters of the 25 microliters reaction that I obtain from the reverse transcription. I'm using two reference genes, 18S rRNA and actin. For the former, Cts ~6-7 and for the latter around 16-17. My genes of interests present Cts ~ 25-27.
Thank you in advance.
Relevant answer
Answer
Thank you all for your very constructive responses. I think I will follow Abhijeet Singh advice, I will try different dilutions.
  • asked a question related to Reverse Transcription
Question
5 answers
I'm preparing to do reverse transcription reactions, but would like each molecule of RNA to be represented once in the cDNA. I was looking for RTs that have RNaseH, but it looks like most RTs have reduced or eliminated RNaseH activity. So, my question is: do RTs generate cDNAs over and over again from the same RNA strand?
Or, does anyone have a recommendation for an RT with RNase H activity?
Relevant answer
Answer
Hi Molly, that's a good question. In theory, it should be one mRNA/one copy. Once the mRNA is paired with RT primer and reverse transcribed to mRNA:cDNA hybrid, the hybrid can not be denatured at the extension temperature like 50C. So there is no chance for another round of rt.
  • asked a question related to Reverse Transcription
Question
5 answers
Guys, I have a High capacity cDNA reverse transcription kit, but it has been expired for 5 months. I would like to konw if the enzime is working yet. Should I buy a new kit?
Thank you.
Relevant answer
Answer
I'd say it also depends on how hard it was to get your starting materials. If your samples are very limited/expensive/precious to create, just buy a new kit.
  • asked a question related to Reverse Transcription
Question
3 answers
Dear colleagues,
I have a bucket of carrot's inflorescence buds that were fixed with FAA, dehydrated and stored in methanol at -20°C for ca. 3 months. I did ISH with some of them that worked fine (so I assume RNA is there) but I decided to synthesize additional probes and I am running out of RNA stock. Could I rehydrate the samples, grind them in LN2 and proceed with Trizol isolation? Do you have any experience on that field?
I found some paper in which authors managed to extract good quality RNA from aquatic insects even from ethanol or acetone after prolonged to storage but plants are not exactly the same I suppose.
Best wishes
Jakub
Relevant answer
Answer
Hi, Jakub Baczyński , I met a similar challenge. I just fixed my plant materials (maize kernels) in FAA without doing any further processing, and I want to extract RNA from them... I was wondering if you have tried
David Farringdon Spencer
's method and how that works?
  • asked a question related to Reverse Transcription
Question
3 answers
I'm using the Qiagen Quantitect reverse transcription kit to convert RNA into cDNA. I want to quantify the cDNA product. The kit recommends using qPCR afterwards, but I don't want to buy more kits if I don't need to. Using a nanodrop (ssDNA), the dNTPs are causing interference, so I'm unsure whether I can trust those concentrations.
1) Can I have blank samples in my nanodrop (master mix of reagents with no RNA) and simply subtract it from the 260/280 of my samples to achieve a relative concentration of cDNA? (cDNA260/280 - blankMasterMix260/280)
2. Is there a column cleanup I can do to cleanup the cDNA to then quantify with nanodrop?
3. Someone mentioned a Qbit has something that binds to DNA, so the excess dNTPs shouldn't matter, but I'm unsure whether that is true.
Relevant answer
Answer
Dear Ali, all three of your options listed above are almost in a right direction.
Although, to quantify cDNA is not much necessary, but it is always to have something firm in hands than doing blind dilutions of your concentrated cDNA and perform excessive tedious optimizations on endogenous (HKG) genes to achieve that desired dilution of cDNA, which can be subjected to qPCR with confidence. I always prefer to quantify cDNA, as it makes life easy and I have found that the results are also more reliable and consistent in measuring it.
So, if you have nanodrop or any other UV-based system, it is better to first column purify your cDNA samples including a cDNA blank (mastermix components of RT kit+ water only) as you have already mentioned through some commercial kits like the following one, which is very good;
Then first use that treated blank to zero your nanodrop and then take readings of your cDNA samples and finally perform the subtraction of blank values from your observed readings of all samples. This method is not as sensitive and specific than Qubit (fluorometric), but I have used it in past when we had no Qubit with quite good success and satisfaction.
If you have Qubit then adopt the following kit for cDNA;
Remember, here in Qubit you also need to measure first with a blank cDNA (same you did for nanodrop case)(and based on my entire experience I recommend to do so). It will give you some low-range readings no matter how specific is the dye of this Qubit kit and usually such readings are in between 2-6 ng / ul or around. Then measure your cDNA samples and subtract that blank value from all of the samples. In this way, whatever readings you get for your concentrated cDNA, you can prepare throughout similar working dilutions you want, like 10 ng / ul, 25 ng / ul etc., and very good near-to-perfection qPCR results.
I have even tested those cDNA dilutions again through Qubit and I have found really amazing results, but only if your calculation work is perfect for your required dilution. For example, if I have 100 ng / ul cDNA and I diluted it to 25 ng / ul, so when I checked this diluted cDNA on qubit using the same kit, I have seen results like exactly 25 ng / ul or 21, 22, 23 ng / ul. The only problem here that upon longer storage at -20 C, cDNA won't remain much intact as the time passes and you may face low readings later after some time when you remeasure it and may possibly observe a certain delay in amplification Cts by using this cDNA.
Regards....
  • asked a question related to Reverse Transcription
Question
5 answers
Please, I would like to know, if I did RNA extraction one year before and stored it at -80oC without use of RNase Out, will it be possible now to do reverse transcription reaction and receive good quality cDNA from it.
Thank you in advance.
Relevant answer
Answer
mostly use RNase free water and DEPC treated water is enough I agree with Marco Pietrella and Laurence
  • asked a question related to Reverse Transcription
Question
3 answers
I am looking for literature related to self-cleavage sites in RNAs which are involved in the reverse transcription. I mostly find the literature related to ribozymes in some viroids i.e. hammerhead structures, but i want to find some other structures undergoing self cleavage.
Relevant answer
Answer
Thanks Ron Geller for sharing link and especially Meriem Sabir your shared paper is really helpful for me..
  • asked a question related to Reverse Transcription
Question
1 answer
I am using the Ion Total RNA-Seq kit v2 to construct sequencing libraries from total RNA, with rRNA depletion. However, I've come across a potential issue with the reverse transcription.
After fragmentation, my fragmented RNA looks of a good size distribution (Bioanalyzer). However, when I check the cDNA on the Bioanalyzer after reverse transcription, the vast majority (>60%) of the fragments are less than 50bp in size.
This is using a brand new kit.
Has anyone come across any similar issues?
Thanks
Relevant answer
Answer
Conclusion is that the fragments seen on the bioanalyzer were adapter-adapter dimers, and that therefore the RNA ligase was non-functional. This was put down to mishandling of the kit during transit, leading to denaturing of the enzyme.
  • asked a question related to Reverse Transcription
Question
3 answers
Greetings,
I am performing a reverse transcription using the taqman microRNA assay protocol.
Parameters of thermocycler for this step are as follows: 30 min/16°C, then 30 min/42°C, then 5 min/85°C.
The program was only running for about 8 minutes, then the power failed for about 5 minutes before returning, and the program was restarted again.
How would that affect my reverse transcription product?
What would be the best course of action if such event occurred again?
Thank you.
Relevant answer
Answer
Hello Nada
It happened to me a lot! I always do continue the program from where it stopped if the power failure was short as 5-10 min. My PCR machine is also a good one, it starts automatically from where the power failed.
Regards
  • asked a question related to Reverse Transcription
Question
4 answers
I am currently working on tea miRNAs. For RT-qPCR analysis i need to use the U6 as control. I have worked out the primers for miRNAs, and also have forward and reverse primer for all. But how can i design the RT primer for U6snRNA?
Relevant answer
Answer
As others told you, I'd say you to buy from one of the major companies around the corner on miRNA technology. It's that much expensive. But, If you really need to do it, check a few softwares like this one:
About controls, really, don't work without a few ones. If you're aware about the miqe Guidelines for qPCR and qRT-PCR it will be clear to you. If not, give it a chance!
The best thing would be to check literature on your specific field and then try 4 - 10 miRNAs. As much as possible for your budget.
Take a look at this example:
QIAGEN's list of controls:
Anyway, data about U6 can be seen here:
Last, remind yourself some published works may give you wrong info ... Do your best evaluation and contact whoever you think may help you. Check a chance to contact the leaders in this field (qPCR, qRT-PCR) such as Drs. Vandesompele, Kubista, etc. They are probably around here.
Hope it helps you.
  • asked a question related to Reverse Transcription
Question
3 answers
Dear Sir/ Madam,
I am designing a primer for microRNA reverse transcription. But some microRNAs like hsp-mir-21-5p has a strong secondary structure. It forms a stable hairpin.
Can anyone please tell me whether the secondary structure of the microRNA(especially stable hairpin structure) will influence the reverse transcription?
If possible, please recommend some good RTase applicable in reverse transcription with severe secondary structure!
Thanks!
Binbin
Relevant answer
Answer
Even if secondary structure of some miRNAs have low MFEI or high stability, but a mature miRNA to get formed i think precursors will surely be processed. You need not worry about stability of miRNA precursors and should go ahead with stem loop RT primer designing.
  • asked a question related to Reverse Transcription
Question
5 answers
I'm doing RLM-RACE of a beta-defensin gene, I have amplified 5' & 3' UTR regions and then I have designed overlapping (UTR+gene) forward and reverse primers using UTR sequences. But I'm not getting full length amplification while primers showing 100% BLAST identity with my gene. one thing is that I'm always getting only single band of RNA (at 1% agarose gel after RNA extraction with TRIzol, and I'm using epididymis tissue for RNA isolation).
and for reverse transcription I'm using my gene specific primers.
and also, I'm using touch-down PCR
please suggest me solutions.
Relevant answer
Answer
I guess you did not get any suggestions since your approach is not that clear. The idea of RLM-RACE is mainly to get sequence information on the full length transcript in epididymis. For the 5'RACE you should use a nested antisense primer pair from the coding region. Starting in the 5'-UTR may result in very short products and you can not exclude alternative transcriptional start sites.
For the 3'-RACE you should use oligo-DT for RT and not a gene specific primer.
Concerning the RNA you should detect 28s RNA, 18s RNA and a smear of mRNA ...
  • asked a question related to Reverse Transcription
Question
55 answers
Good Morning,
I have a problem with qPCR measurements and I hope you can help me with that. We would like to implement a probe (TaqMan) assay.
For receiving our samples, we isolated neutrophils from buffy coat. RNA was isolated by ‘RNeasy® Midi Kit’ (Qiagen) and on-column digested with DNase I according to the manufacturer’s recommendations. Afterwards, the isolated RNA was digested with DNase I for a second time (peqGOLD DNase I, VWR) to eliminate genomic DNA. The ‘High Capacity cDNA Reverse Transcription Kit’ (Applied Biosystems) was used to convert RNA into cDNA and afterwards, ‘PrimePCR™ Probe Assay’ (Bio-Rad) or ‘Dual Labeled Probes’ and primer pairs (Eurofins Genomics) were used for quantification of transcript levels by RT-qPCR.
For the probe assay we used 12.5 ng cDNA per 10 µl per well. We performed qPCR according to that protocol: enzyme activation, 95 °C, 2 min; denaturation, 95 °C, 15 s; annealing, 60 °C, 30 s. We used the ‘GoTaq® Probe qPCR Master Mix, 2X’ (Promega) and did duplex RT-qPCR studies.
Unfortunately, our curves are very crazy (see photo). This leads to falsified values and large standard deviations. When you change the settings of the cycles to be analyzed from 3 to 40, the previously bad Cq values get better, but some Cq values that used to be good deteriorated.
We implemented several tests, including either the use of different template amounts, or different primer/probe concentrations, or different master mixes. We also performed a gradient qPCR and changed the volume per well to 20 µl. We also used non DNAse I digested samples.
But we received always more or less the same curves.
We do not have this problem using a Sybr assay with our primers that we also used in the probe assay. So maybe our probes are the problem. But what can we do to solve the problem without buying new probes?
Attached you will find our graph.
Many thanks
Tamara
Relevant answer
Answer
Adriano Costa de Alcantara
Catarina Figueiredo Mota
Many thanks for your answers.
We had samples from blood bags for testing our probe assay. From that we had enough but we want that our assay work as well as with low amounts of RNA of the patients.
We had used a high capacity kit from Applied Biosystems and for that we used around 500 ng RNA per reaction, in average. Therefore, we had more reactions to do per RNA of each sample.
Eurofins will re-synthesize our probes and we will receive a new device from Bio-Rad for testing our probe assay. We hope that we can do that in the next two weeks. Then I will report the results, here.
  • asked a question related to Reverse Transcription
Question
7 answers
I am attempting to perform a qPCR standard curve using viral DNA (Adenovirus and MCMV) and cDNA (Influenza A) to be used to determine relative abundance of these viruses in primary samples. Viral DNA and RNA was extracted from viral stock using the QIAmp MinElute Virus Spink kit and vRNA was converted to cDNA using the ImPromII Reverse Transcription System. 6 point 10x dilutions were performed using this viral DNA and cDNA (undiluted-1:100,000) and a negative water control was included. For the qPCR, I am using TaqMan Universal qPCR Master Mix along with virus specific primers (forward and reverse) and probes whose sequences were provided from literature review or provided by neighboring labs but have not previously been used by our lab with this particular master mix. I believe that all of the input DNA/cDNA concentrations are fine (ranging from 17-180 ng/rxn note: master mix prefers concentrations <250 ng) and being that I have repeated these experiments a number of times with great care, I do not believe that it was a pipetting error with the dilutions. The amplifications curves, especially for Adenovirus, do not follow the natural curve progression seen in most standard curves and for all of the viruses the points do not fall on the slope of the standard curve line. I have attached photos for reference. I have tried repeating these experiments many times and adjusting the input concentrations of the viral DNA and cDNA. All experiments were for each virus was done separately, there was no multiplexing. I am wondering if it is possible that the primer efficiency may be the problem. The annealing temperatures for these primers are slightly higher (~3-6 degrees) than recommended by the master mix but a representative from Fisher seemed to believe that the reaction should still work. Also the target regions for these primers seem very short (all <150nt). Is it possible that I need to design new primers or is there possibly another obvious issue. If anyone could provide any feedback on what they believe the possible problem is or has further questions, please let me know.
Relevant answer
Answer
Did you try to quantify your cDNA? Ferralita Madere
  • asked a question related to Reverse Transcription
Question
4 answers
Can anybody have the correct primer sequences to amplify APRIL gene (TNF-family) for reverse transcription of m-RNA as different articles use different primer sequences as well as the primers for GAPDH gene (used as a control).
Why does this difference happens in primers used?
Your answers are highly appreciated.
Relevant answer
Answer
Well,
it depends on the lab how they do their primers. You can either make up your own primers or take published sequences. Since you have usually a huge amount of mRNA present (the length of the mRNA), varieties of sequences for primers are given.
i prefer to make my own primers since you can actually decide, at what temperature they are annealing in a PCR, how big your products are (359 is at the upper threshold for real time PCR), how your GC amount is Etc. If you just Order published ones without checking them, you sometimes can run into problems.
I suggest you try to make your own primers (pubmed primer-blast for example), so you understand a little bit more what primers are And how they are developed.
Dont forget; the April in publication 2 is the soluble version so they were looking for this specific version, not for the general version.
I am pretty sure there are videos around wich explain how you develop your own primers.
Best,
Teresa
  • asked a question related to Reverse Transcription
Question
11 answers
I was making cDNA yesterday and accidentally left the kit master mix in room temp for close to 24 hours and I will need to make more cDNA in a few days. Is this master mix still usable?
Relevant answer
Answer
I would propose to use a new kit to avoid discrepancies regarding kit efficacy (in transcription RNA to cDNA) compared to samples prepared before.
Storage at RT for uop to 24 h will surely affect efficacy of your transcription kit.
  • asked a question related to Reverse Transcription
Question
1 answer
I injected carrageenan on mice hindpaw to evaluate neuropathic pain and inflammatory response. After RNA extraction (by Trizol), reverse transcription and real time PCR, only the control group (saline injected, without carrageenan) had positive amplification.
Since carrageenan is interfering with my reactions, is there a safe way to get rid of it?
Relevant answer
Answer
Dear Lucas,
I know my answer comes quite late. I have seen that RNA extraction is performed in Chondrus crispus with RNeasy Plant Mini Kit from QUIAGEN (Kowalczyk N, Rousvoal S, Herve C, Boyen C, Collen J (2014) RT-qPCR Normalization Genes in the Red Alga Chondrus crispus. PLoS ONE 9(2): e86574. doi:10.1371/journal.pone.0086574). As this is the algae from which carrageenan is mainly extracted, it may worth to give it a try. I will like to ask you if you managed to find any solution for cleaning up your RNA from carrageenan as I may be experiencing a similar issue.
Kind regards,
Adrian
  • asked a question related to Reverse Transcription
Question
5 answers
I have total RNA extracted from samples which are rather precious. I am trying to perform cDNA synthesis then qPCR. The RNA appears to be intact and reasonably pure, but I only have between 20 and 100 ng per samples. The reverse transcription kit claims that it can work with as little as 100 pg of RNA. However I have always done qPCR with at least 250 ng RNA, and usually 1000 ng.
Has anyone actually performed RT and qPCR starting with so little material? Would starting with a low amount of RNA potentially skew the results of the eventual qPCR?
Thanks in advance.
Relevant answer
Answer
Hello, we are performing RT and qPCR for very low amounts of RNA and it works fine. After the extraction, we usually have something like 5 ng/ul RNA. For the cDNA, we use 10 ul of RNA and dilute it up to 110 ul after the RT. And we use 2 ul of that cDNA per each qPCR well. It works fine for us. The RT kit we use is iScript from BioRad and we use SYBR detection.
  • asked a question related to Reverse Transcription
Question
4 answers
Hi,
I am running standard dilutions (1:5) of some cDNA template to check the efficiency of primers. I found to have apparently PCR inhibition, as the efficiencies that I am getting for all the targets are over 110 % (all are around 130-140 %), with R2 >0.98.  However, I can't understand where I can be getting  PCR inhibitors.
I measured the purity ratios of the RNA after isolation, and they are 260/280=2.09 , 260/230=2.23. I also measured the purity of the cDNA  after the reverse transcription , and the values are 260/280=1.77 , 260/230=2.22. Although the 260/280 ratio drops ( I guess because of the reverse transcriptase), I don't think is too dramatic.
I even dilute the template for the first dilution point, to put no more than 50 ng per reaction. If I am introducing inhibitors I think it can only be during the real time qPCR. I am using  the LightCycler 480 SYBR Green I Master kit from Roche, but it is brand new.
I analyzed the data with the ThermoFisher Cloud, and I am getting Amp scores over 2 for all reactions, so the quality of amplification is good.  I only see one peak of melting curve  for each reaction. For all these reasons I don't understand how I have PCR inhibition.
Can it be an issue of the set up?  I thought that  working out of optimal temperatures and cycle times will decrease the efficiency below 90%, but not increase it over 110%.
Does someone has any clue of what can be happening?
Relevant answer
Answer
DNA purity ratios do not always make sense. I would try to dilute my sample at least 1:3 prior to running qPCR. If there is an inhibitor, it is in your sample.
  • asked a question related to Reverse Transcription
Question
2 answers
Hi! I'm doing RT for 45 reactions and I don´t have too much Transcriptase. I was thinking to put more sample (more than 1000ng) per reaction, adjusting dT oligos and run the reaction more time.
¿Does anybody have make it or know if that could work?
Relevant answer
Answer
Thank you very much for the advice Laurence
Regards
  • asked a question related to Reverse Transcription
Question
3 answers
I will be using blood samples from leukemia patients to study gene expression for three different genes. I'll be getting my first blood sample next week but I still don't have the RNA extraction and reverse transcription kits. Can I keep the blood in -80°C and still get a good quality RNA extract? For how long? Is there something I could add to the sample to better preserve the RNA?
Relevant answer
Answer
Yes, I agree. The best way is not storing whole blood. However, if you want to freeze it use adequate anticoagulation and RNA degradation tools (PAXgene tubes, Calcium scavengers, RNase inhibitors etc.
  • asked a question related to Reverse Transcription
Question
4 answers
I would like to ask if there is any difference between an oligo intended to be use in PCR from a DNA template and the one that is going to be used for gene specific reverse transcription from RNA template. I guess that the only difference is the sequence as reverse transcription primer should target RNAm region, but I am not completely sure
Relevant answer
Answer
Hi
You can design your required primer in Primer-BLAST or Primer3/Primer3 Plus.
Thanks
  • asked a question related to Reverse Transcription
Question
4 answers
Hello everyone,
I am currently trying to set up at a new lab in order to begin experiments on osteoclasts. Before starting anything, I wanted to make sure that BMMs have indeed differentiated into osteoclasts by using TRAP staining and PCR.
In our lab, we harvest bone marrow-derived macrophages (BMM) from the tibia of 5 week-old female ICR mice for osteoclast differentiation. For BMM differentiation, I seeded 2 x 10^5 cells per well with full alpha MEM and M-CSF (30ng/ml). I used 3 6-well plates in order to retrieve cells on Day0, Day2, and Day4 of differentiation. On the next day, I retrieved the Day0 plate using 1ml of Tri-RNA reagent and changed the media (containing M-CSF and RANKLE (1:1000)) for the other two plates. I retrieved the rest of the plates on appropriate days.
After retrieving all cells, I performed RNA isolation followed by RNA quantification (ND-1000), reverse transcription, PCR, and gel electrophoresis. My problem here is that I'm getting nothing on gel for Day0 with actin, GAPDH, and HPRT primers. I triple-checked all my steps for gel, PCR, and reverse transcription using other cells and the technique does not seem to be the problem. I performed RNA and DNA quantification using Nd-1000 (I know they are not super accurate) and I've attached the results as image files.
Please help me figure out what made the Day0 bands disappear! Thank you in advance:)
Relevant answer
Answer
How many hours after plated you have harvested your cells for assays on day 0 ?
Whether your cells were healthy on day 0 ? may be the genes were not expressed.
  • asked a question related to Reverse Transcription
Question
4 answers
I am trying to extract cell free RNA from mouse plasma samples. For this I used to spike-in total RNA into 50 microlitre plasma samples using Trizol, followed by PCI phenol:chloroform isoamyl alcohol (1:1) and precipitating with sodium acetate and ethanol.
After extraction, I use 1 microlitre for reverse transcription reaction and again 1 microlitre for qRT-PCR. The Cq value comes to 18.
The problem is when I used to spike-in total RNA into water samples, the Cq and followed all the above mentioned procedure, the Cq value comes to 7.
I wonder how the Cq value of RNA isolation procedure from plasma samples can be improved?
Any suggestions will be highly appreciated.
Thanks in advance
Relevant answer
Answer
Thank you very mcuh. I'll try your suggestions. We wanted to isolate with manual methods using Trizol.
Thanks again
  • asked a question related to Reverse Transcription
Question
3 answers
Hello, I wanted to do a reverse transcript for the subsequent realization of a sybr green qPCR. Classically I prepared my samples by mixing them with water, dNTPs, Random primers and the RNA of interest and finally at the time of denaturing them I realized that the thermocycler was out of order. My question is: can the samples be kept at -20 ° C until the thermocycler is operational, or do I have to start again for better RT? Thank you
Relevant answer
Answer
Hi Fatou,
it's nor recommended but you can perfectly store the reaction mixture at -20°C for some times. you just need to be sure to respect time and temperature just to be sure the enzymes are not activated and in good shape. I've already done that for sequencing, it was fine.
fred
  • asked a question related to Reverse Transcription
Question
2 answers
I need the primer sequence for reverse transcription of 18S rRNA gene, to be used as internal standard while working with plants.
Relevant answer
Answer
18s rRNA-F GCTTAATTTGACTCAACACGGGA
18s rRNA-R AGCTATCAATCTGTCAATCCTGTC
  • asked a question related to Reverse Transcription
Question
5 answers
Hello,
I am running qPCR on cDNA and I keep getting these unusual curves. Could someone please explain to me what they mean or point me to a good paper? Here's more information:
I used a gene specific primer to perform reverse transcription on viral RNA samples. I then did PCR and gel electrophoresis and the results were positive (nice band, correct base pair). I am now performing qPCR on the same cDNA with primers suitable for qPCR. I'm using TaqMan universal primer master mix with UNG and optimized primer/probe concentrations.
At first I thought this was a result of the master mix, or primers/probe. I then used different qPCR master mix along with different primers and probe and got the same type of curves! The only thing that didn’t change was my cDNA (so this must be the issue). I then diluted my cDNA 1:10, 1:100, 1:1,000, 1:10,000 ran all dilutions and there was no signal.
Any help would probably save my life. Thanks!
Relevant answer
Answer
Dear Camille, to me it looks either you have lost your cDNA by somehow, or primer-probe mix has degraded (may be by some improper storage or light exposure) or your qPCR machine has some dye calibration issues. Redo the entire calibrations and see. Usually, probe degradation is judged by having a huge baseline drift in the plot, which is not here in your provided image, so may be it is not your probe, which is not functioning. If your qPCR primers are not much specific then UNG always degrade any misprimed or non-specific products hence you will see declined plots.
Regards....
  • asked a question related to Reverse Transcription
Question
9 answers
I have strictly followed the company's protocol but still no luck. Can anyone guide me what could be the issue?
Relevant answer
Answer
Hi Sitara Nasar,
I have good experience (roughly 100 samples) with dengue RNA extraction from human serum. First, check the NS1 antigen (ELISA) and IgG (ELISA) status of the serum. If NS1 ag is positive with high OD value, then the probability of isolating dengue RNA virus is higher. For cDNA synthesis and serotyping I used Qiagen one step RT PCR kit only, random primers provided in the kit can be used or you can have you own primers for cDNA synthesis. I have successful attempts with conventional Lanciotti et al method also.
I observed that the quality of the specimen (serum/plasma) plays majority of role in isolation of viral RNA. Refrigerated centrifugation at initial serum separation and at required places is mandatory. If possible check the OD using Nanodrop or denovix or similar equipments or simply run electrophoresis...
all the best
Kalyanaraman