Reverse Transcription - Science topic

There is some debate about whether RNA concentrations should be equalized before converting it into cDNA. Some scientists say this step improves the consistency of gene expression analysis using qPCR. Others argue that it may change the natural levels of mRNA, leading to inaccurate results.

I believe that equalizing RNA concentrations could introduce bias by altering the relative amounts of mRNA compared to total RNA. This may not be ideal, especially when studying gene expression differences.

What are the best practices for this step? How can we ensure accurate and reliable results?

Hello everyone!

I am new to reverse transcription and I would like some help! We want to make a quantified RNA stock to use as an external control for real-time RT-PCR and all we have is a DNA positive control (from a kit) and a ssRNA (bought it for different reasons). Is it possible e use ssRNA transcribed to cDNA and then back to RNA with the proper kits? Or we can only use DNA? Are there any recommendations?

Thank you

I isolated RNA then transferred into cDNA by using High Capacity cDNA Reverse Transcription Kit . But I forgot to measure the RNA by nanodrop .

How can I know the quantity or concentration of cDNA to perform qPCR array ?

I am using the High Capacity cDNA Reverse Transcription Kit from Thermo Fisher and the GeneAmp® PCR System 9700 thermocycler to synthesise cDNA. The method specifies the following protocol:

but does not mention the number of cycles. What number of cycles should I set on the thermocycler, considering it only accepts values between 2 and 99?

I'm very embarrassed to admit this, but I don't understand how random hexamer primers (RHP) work in reverse transcription. I made RT with gene-specific or oligo-dT oligos hundreds of times, the whole idea is absolutely clear. But when we come to RHP...

Okay, let's say we have set of random hexamers, the most downstream one (green on the upper picture) anneals to our RNA template and serves as a primer for reverse transcriptase. But what about others, annealing somewhere upstream (purple on the picture)? What happens then RT enzyme reaches them, why don’t they (especially GC-rich ones) interfere with revertase movement? At least in case of PCR such oligos annealing inside the amplified region effectively block the amplification.

On the other hand, if all of these random hexamers are capable of priming reverse transcription, in the end we will have a whole bunch of short cDNA fragments, barely usable for subsequent PCR amplification.

I’m afraid I miss something very important (and simple). I would greatly appreciate any clarification!

Stan

Hi!

I notice that reverse transcriptases can be used for both cDNA library construction with template switching (eg. surescript II etc.), and downstream qPCR. To quality-control my library construction, I would like to do a qPCR of focused gene with the first strand cDNA, but reverse transcripted with template switching. However, even with the same reverse transcriptase, will the activation of template switching, as well as the addition of adaptor-UMI before poly T in primer?

Thank you!

Hello everyone,

I am try to amplify reverse transcription product (cDNA) from totalRNA. I can only obtain short sequences (as shown in gel image attached). The peak is around 400-500 bp. However, other people get a higher peak (around 1 kb).

Does anyone have any recommendations/tips on how to improve this?

Thank you,

Shuo Yin

Hi, I am using VASA-seq for RNA sequencing. The last two steps of the protocol are cDNA synthesis (via reverse transcription) and PCR. I had been using Superscript III for cDNA synthesis and was getting a lower PCR yield. Then I switched to Maxima H Minus Reverse Transcriptase. The PCR yield increased dramatically, but I am getting this weird around 1200 bp long fragments (see the attached figure). My expected peak is around 300 bp. I have attached a figure of the fragment size distribution of the PCR DNA (analyzed on fragment analyzer).

#fragment_analyzer #PCR #VASA_seq #Maxima H Minus Reverse Transcriptase #SuperscriptIII

I want to isolate RNA from bacillus subtilis using the QuickRNA Fungal Bacterial Miniprep Kit from Zymo Research and further reverse transcriptase to cDNA using the ReverTra Ace qPCR RT Master Mix from Toyobo, the protocol for RT suggests doing DNase I treatment to eliminate any genomic DNA contamination from the purified RNA sample, however I only have DNase I (not RNase Free), is it necessary to use the RNAse free DNase I or is it okay if i only use the regular DNase I? also is the result from QuickRNA kit purely free from genomic DNA or no? Thank you!

The amount of total RNA used by each group was different during reverse transcription. Can it be compensated by adjusting the same CT value during PCR?

I am synthesizing CDNA using the BioRad iscript CDNA synthesis kit. The protocol says to 1. heat the samples to 25⁰C 5min (Priming)

2. 46 ⁰C for 20 min (Reverse transcription)

3. 95 ⁰C for 1min (RT inactivation)

4. hold the samples in 4 ⁰C

During the synthesis process, first step and the second step was done but my PCR machine failed at the 3rd step, so it did not heat samples to 95⁰C 1min. I immediately moved the samples to 4⁰C (on ice) and had to store the samples in -20⁰C, but can this CDNA samples be saved without the RT inactivation step? Will it be ok if I re-run them for the last step?

Hi all

earlier I have seen in some papers people go for DNA extraction and normal PCR using 16S rRNA primers for the identification of bacteria. However recently I have seen few papers particularly dealing with Uncultured “Candidatus” bacteria, researchers go for RNA extraction, reverse transcription RT-PCR and real-time RT-PCR ? Molecular biology experts can you please tell me …..

1. what’s the key advantage between the two ? is there any particular advantage of RT PCR for the identification of Uncultured “Candidatus” bacteria ?

2. Is it because of the possibility of “relative quantification” of the bacterium by real-time RT-PCR by targeting the 16S rRNA gene of the bacterium?

3. Is there any advantage when (RT PCR) used for uncultivable bacteria?

4. what is this Cycle threshold ? what is the significance of this in the above reaction ?

5. Also “The eukaryotic elongation factor 1 alpha from the host was used as a control of the RNA amount, and a good extraction was expected to give a Ct-value around 15 (the cycle threshold was set to 0.1). ? all results with Ct-values above 45 were considered negative !, what does it all mean?

My aim is just to identify the unculturable bacteria from tissues! Can I go for just normal PCR (16s rDNA) and sequencing the PCR products? Please

thank you

regards,

Hi :)

How should I design primers for (-)ssRNA samples from Influenza A and hRSV viruses?

I need to select the protein, locate the gene sequence, and then use it to design primers. Should I retrieve the cDNA sequence from NCBI to work with?

The term 'cds' in FASTA means that it is the sequence without introns. Is it okay to use this type?

if you have any guides, videos or documents you would like to share with me, I would be very grateful.

Thanks

I recently conducted cDNA synthesis followed by conventional PCR for quality assessment. In the course of this experiment, I observed some unexpected results that have raised questions about the reliability of my cDNA and its potential impact on real-time PCR experiments.

Specifically, here are the key observations:

My primary concern is whether these observations in the cDNA synthesis and conventional PCR could potentially impact the outcomes of my real-time PCR experiments. Real-time PCR requires high precision, and any issues with cDNA quality or PCR variability could affect the accuracy of gene expression quantification.

I would greatly appreciate insights from the research community regarding the possible reasons for these observations and their potential implications for downstream real-time PCR experiments. Your expertise and suggestions on troubleshooting or optimizing this process would be invaluable.

In particular, can you explain why a gene is more highly expressed in PCR without reverse transcriptase than in RT-PCR? I have performed a PCR with reverse transcription (RT-PCR) and a negative control (without reverse transcriptase) for TBP. However, my negative control shows a higher expression of another gene. Please see attached.

I am performing siRNA transfection to inhibit a certain matrix RNA. Does it make sense in this case to determine the reduction of this RNA by reverse transcription on PCR?

Gene around 5000bp

Dear all,

I am planning an experiment to perform qRT-PCR, I was thinking about seeding 300,000 cells per well in a 6-well plate, leave it 24 hours to adhere, then add treatments for another 48 hours. The goal is to harvest about 2 million cells, but the question is what about treatments‘ group, will they yield the same amount of cells as the control group? Or, more accurately a good amount of mRNA to be reverse transcriped into cDNA?

N.B: Such treatments and their concentrations are based upon and derived from a cell viability assay made in 96-well plates on 7000 cell per well. And concentrations to be used are IC50, quarter of IC50, and twice IC50.

Many thanks in advance and best regards.

Hello,

I have recently read about the reverse transcription activity of one of the subunits of telomerase. As far as I know, all reverse transcriptases so far are of viral origin, including the ones from retrotransposons and ERVs.

However, the fact that this enzyme is performing a function so important for all eukaryotic life, makes me wonder if it is the same or if it has a different independent origin from the rest of reverse transcriptases known since it might be needed since multicellular organisms' genomes acquired chromosomal organization.

I have tried to search papers addressing this but I could not find any so far. Does anyone know?

Hi!

I am trying to understand whether it is important for me to use an RNA Cleanup kit (such as NEB Monarch #T2030S).

I am isolating microbial RNA from an environmental liquid sample, and I subject this RNA to subsequent DNAse I treatment. Does it really make a difference if I do not clean up the inactivated DNAse and buffer salts, and just go on with RT/qPCR? I am guessing it should work without a cleanup, but does such a cleanup help in some ways that I might be missing? What is your experience?

Thanks!

Artur

Hi to all.

My question is how can I optimize my RTqPCR if the cDNA dilutions ended up in similar Cq?

I synthesized my cDNA from 350 ng total RNA, assuming 1:1 production I should have 350 ng cDNA in 20 ul right? Then I did a dilution of 1/2, 1/5, 1/10 and 1/20 (I know the first three are consider quite a lot to be used in the run) and used them in a 20 ul run. The gene is a ref. gene: GAPDH. Interestingly the Cq values aren't that different between the dilutions (~29, ~30, ~31 and ~30). Obviously these aren't good values but I don't know what can I do to optimize the run.

Hello!

I usually use 2μg of extracted RNA to prepare cDNA using "Thermo Fisher high capacity cDNA reverse transcription kit" and proceed with qPCR.

I was wondering if anyone has ever used a higher amount (for e.g 3μg or 4μg of extracted RNA) and saw significant changes in the Ct values?

Thanks in advance for your help!

Hello everyone,

I have just started working on a microRNA project. The 260/230 and 260/280 ratio of the miRNA was in the range of 1.8-2.1. I did a reverse transcription of miRNA using a stem-loop primer starting from 500 ng of miRNA. I used a superscript II kit as well as a pulsed reverse transcription for this process. However, the cDNA 260/230 ratio was low (around 1) and there was only ten times amplification (5000 ng of cDNA in total). Is this a common phenomenon using this kit?

May I proceed with the qPCR using this cDNA?

Any insights would be helpful.

Thank you.

Hello, I'd like to ask whether it is necessary to add primers or oligo(dt) to Reverse transcription mastermix (MMLV RT)? Is it possible to mix Primer independent RT reaction? If you have any experience with reaction conditions for MMLV I would be grateful for All advices. Thank you.

Bohuš

Can Taq DNA polymerase uses RNA as its substrate? I mixed RT reaction with: dNTPs, RNA of GFP gene, Reverse transcriptase and water and incubated 30 min at 45 °C. Then I mixed PCR with Taq DNA polymerase and as a templat I used 1,5 ul from previous RT reaction. I Saw bands I need but I'm afraid Taq DNA pol could amplify it from residual RNA. I just want to test Reverse transcriptase activity.

Thanks for your responses

Bohuš

Has anyone tried reverse transcription from a DNA template? How well does it work compared to an RNA template?

Hi, I'd like to ask whether it is necessary to precipitate MMLV Reverse transcriptase before affinity chromatography purification (Äkta)? My colleague must do this step with his Taq DNA polymerase. He use (NH4)2SO4 or Na2SO4 + PEG. Without this precipitation is polymerase inactive.

Thank you for your responses.

Bohuš

Can someone help me by solving this issue?

I have a cell culture of THP1 cells and I need to extract RNA but the cells are frozen and they have been washed by PBS and 0.1 M BSA is added. The RNA is used for reverse transcription and then qPCR is going to be performed.

What is the best way to deal with the frozen cells before we start extracting?

Should the BSA be removed? Or should I just scrape the cells and pipette the mixture out?

I am trying to set an experiment on molecular detection of miRNAS in MDS, using RT-PCR. I have chosen the poly T adaptor method.

I am starting with total RNA and I want to proceed with polyadenylation, reverse transcription for miRNAs, and real time pcr with SYBR green method, all custom made.

I decided to use specific primers pairs from previous publications.

But, I am dealing the gap of poly T adapter.

Could you please explain me, how to design this and the universal primer that I need to complete the setting of my research?

Thank you, in advance

Hello everyone,

Greetings!

Hope everyone is fine and in good health in the current Covid19 pandemic.I would like to know the difference between the Reverse Transcriptase-qPCR and normal realtime qPCR.If we can extract DNA directly from the cells and then prepare the samples for qPCR then why do we go for Reverse Transcription step to prepare cDNA and then qPCR?Kindly explain in detail.

Thank you,

I am trying to check expression of hsp-70 by reverse transcriptase PCR in human sperm. But I am not getting anything. However I checked the quality of cDNA by internal control (GAPDH expression), and the cDNA was fine. When I use the same primers for other sperm/somatic cell samples, the primers are working fine.

Can someone please suggest how to overcome this problem?

Thanks

I want to do a toeprinting assay to map translation start sites. Typically, these experiments are carried out with radioactively labeled oligos that are extended using reverse transcriptase. However, working with radioactivity is difficult in my institution, and I would like to avoid it.

I am thinking of an alternative. Specifically, what I am planning to do is to use 5'-biotinylated primers, then employ reverse transcriptase as in the standard protocol, then run the primer extension products on a PAGE gel, then transfer it onto nitrocellulose membrane just as if it were a Western blot (I would use the exact same protocol, just leaving out the SDS), and finally stain the membrane with streptavidin-HRP.

To my surprise, I nowhere found a protocol like this in the literature. Instead everybody keeps working with radioactively labeled primers. This suggests to me that my plan is probably a bad idea, because somebody must have tried this, right?

If anyone would like to way in, I would appreciate an opinion. I'd be happy about any support for my experimental layout, any concerns why this might/will not work, or suggestions on how I could optimize the plan ...

I would like to know the lentiviral titre before i proceed with my transductions. Reverse transcription RT-PCR can be used for knowing the viral titre however i need to isolate genomic RNA (shRNA) from the lentiviruses for doing that . Though commercial kits are available for isolating RNA from viruses , i would prefer a lab protocol rather than a kit as it would be more economical..

I'm trying to clone some cDNA, but when I PCR the cDNA with my primers, I get no product on the gel. So I checked around and found out that I might be missing the second strand synthesis step, could this be the reason for the lack of product? My cDNA is fine, and appears on agarose gel, and I have also used this for qPCR, amplicons look fine on the bioanalyser.

Also the second strand kits are too expensive to purchase, does anyone have a protocol that has worked for them? I can purchase the second strand buffer from NEB, they used to sell this with the second strand enzyme mix (RNAse H, E coli polymerase and E coli ligase) but have discontinued it.

My second issue is that the e coli ligase in the quantity on the NEB protocol is a lot and also too much to purchase, does anyone have any protocol without e coli ligase? Will be very grateful for your help, been stuck on this process for too long. Thanks

Hi!

I am using a reverse transcriptase called "Maxima H minus" (Thermo#EP0753). Its protocol recommend using the Thermo Scientific™ RiboLock™ RNase Inhibitor (#EO0381). However, our lab are rich in stock of Takara recombinant Rnase inhibitor (2313A) and it takes too long to wait for the EO0381. What is the difference between the two inhibitor and can I just simply replace the Thermo Scientific™ RiboLock™ RNase Inhibitor with Takara recombinant Rnase inhibitor?

Thanks!

Can I use 'quantitect reverse transcription kit' storaged in refrigeration temperature for 20 days?

Originally, it should be stored at -20 celsius temperature scale.

Hi!

I am having some DNA probe conjugated on gel surface (polyacrylamide) and I want to perform reverse transcription and PCR after the DNA probe capture target RNA. Yet the volume of water absorbed in the gel cause a problem. How should I calculate and decide the amount of reaction mix to use? should I directly add same volume, 2X concentration onto the gel (20ul gel in a well)?

Thanks!

Hi!

It is commonly used of silica membrae membrane in DNA extraction column to bind and release DNA. Yet I wonder can I simply use extraction tube to filter and collect ~20um beads (conjugated with DNA), then take out the whole membrane for the downstream reverse transcription, exonuclease and PCR. Will the membrane block or impede the enzyme to access the DNA on spheres? The membrane will be fully immersed in the reaction mix.

Thanks!

Hi!

I am trying to perform a drop seq from Macosko's protocol. Yet I found a very interesting point that 40ul 20% Ficoll PM 400 is added to the reaction mix. What does this do?

Thanks!

ps: here is the full reverse transcription recipe in Macosko's protocol. The mRNA has already bound to the poly T primer on the surface

75ul H2O

40ul Maxima 5x RTBuffer

40ul 20% Ficoll PM 400

20ul 10mM dNTPs(Clontech)

5ul RNase Inhibitor(Lucigen)

10ul 50uM Template Switch Oligo

10ul MaximaH-­‐RTase (add after you’ve begun the breakage portion of the protocol

Hi!

I am doing a screening of cell phenotype. Because of the high throughput and few cell number (500-1000 cells in 6-10ul) in each well, it may be better to just process cell lysate to reverse transcription without RNA extraction (directly add reaction mix to lysate). Are there any optimised and commonly-accepted recipe for this purpose?

Thanks!

-----------------------------------------------------------------------------------------------------------------------------------

also how should I design the volume ratio of cell suspension : lysing buffer : RT reaction mix, to minimise the cost of RT reaction mix (it accumulate fast considering well number)? Heat complementary lysing is possible in this system as well (heat up to 65 or even 80 ℃ to break cells).

Hi!

We are trying to perform RT-PCR on a conjugated functional surface. However because of the conjugation either heat or SDS deactivation is not possible and the current way is simple wash. How will the residual Reverse transcriptase influence the downstream PCR? Is there another way to eliminate or deactivate Reverse transcriptase?

Thanks!

I accidently found out cDNA can be generated in the absence of RT primers, in other words self-primed cDNA. This happened due to the first strand synthesis kit I am using at the moment which has only one tube that contains everything except DMSO and primers. I wanted to include RT minus as negative control but since it was not possible with this kit, I omited RT primers instead expecting not to produce any cDNA. Well, it was not the case... The Ct values from primed and unprimed cDNA samples are exactly the same. I got suspicious since I did not know this could be possible, I searched in the literature. I came across several papers which adressed the problem and claimed that it could be due to secondary structures of RNA (folding on itself) and unspecific feature of reverse transcriptase enzyme. The RT enzymes also have reduced activity of RNAseH which could also contribute to this observation. The increased RT temperature also increased the RT specificty in publications, which was not the case in my experiments since I observed at 37 and 55C RT primed and unprimed cDNA showed almost exactly the same cT values. I want to ask now, are you aware of this self-primed cDNA issue? Should we ignore eventhough cDNA was not made by RT primers but somehowelse. I also included RT- sample (using another cDNA kit) which did not give any signal; this tells there is no gDNA contamination in my samples or qPCR primers are not picking gDNA but only cDNA .

I know none of us include such negative controls apart from RT(-). I guess RT enzyme is efficienctly reverse transcribing RNA to cDNA regardless of RT primers. If this is the case why we even bother ourselves adding RT primers? :)

/Sibel

Experimental details:

I converted 2ug of total RNA (in 20 uL rxn mix) using first strand cDNA synthesis. No DNAse I treatment. I compared both random primers and oligo dT primers.

Diluted cDNA samples 20x to get 5ng/uL and took 2uL (10ng) for qPCR reaction in total volume of 20 uL. Used SYBR green power track.

P.S: the melting curves from unprimed and primed cDNA samples were the same.

Hi,

I'm doing RNA Extraction, Reverse Transcription and qPCR on synovium samples from mice that are dissected in half. I use Thermo-fisher RNAqueous Micro Kit for the RNA Extraction.

During RNA Extraction, I first remove the sample from -80 and immerse it in 100μL of lysis solution. then I homogenize the sample using the following mixture;

1. 10 ml PBS (without Calcium chloride and Magnesium chloride)

2. 1 tablet of protease inhibitor

3. 500μL Tween 20

then I add 1000μL of this mixture to my sample and use manual homogenizer to homogenize my tissue.

after that, I add 50μL of 100% ethanol to my samples and apply it to silica-based filter. then I centrifuge it at max speed for 30 sec.

then I wash it 3 times with 180μL wash solution 1 and 2 and centrifuge it for 10 sec after each wash. at the end, I centrifuge it for 1 min.

Then I replace the filter cartridge with new one and elute the sample in 7.5μL of elution buffer that is pre-heated to 75C. Incubate it for 1 min and spin-down for 30 sec. Then I repeat this step with another 7.5μL of elution buffer.

For Reverse transcription, I take 14.8μL of sample with 1μL of Oligo dT and 1μL of 10mM dNTP (16.8μL final volume)

then I place it in thermo-cycler for 5 min.

After that, I add 0.2μL of RNAase inhibitor, 1μL of M-MuLV Reverse Transcriptase and 2μL of 10x reverse transcriptase buffer to the sample and place it in thermocycler (37C for 50 min, 72C for 15 min, 4C infinite hold),

for qPCR, I dulcet the cDNA using 1:5 RNAse and DNAse free water, then further dilute it in RNAse and DNAse free water to get 1:50 dilution.

Then I add 4μL of diluted cDNA and 6μL of mixture including 0.6μL of forward and reverse RPLP0 primer (10mM concentration) and 5.5μL of 2x SYBR GREEN PCR Master Mix. and load my sample in 384-well plate and run it.

I tried changing my dilution to 1:25 instead of 1:50 but still don't have the result.

When I use cells (THP1) around 450,000 cells, Cq value is around 27.3 but for synovium is around 34. Still, both values are high for RPLP0 gene.

I will sequence viral nucleic acids using Nextera XT library prep. I was informed by Illumina that the input must be dsDNA, at least 300-bp. I am wondering how to get it. I have a commercial kit to prepare the first strand using the viral RNA as template. My problem is synthetizing the second strand. I have seen a strategy where you must use a number of enzymes (RNAse H, ligase, polymerase), but I understand that this is more adequate when you work with long eukaryotic mRNA. For constructing the first strand, I will use random primes. Could I synthetize the second strand using random primers and only a polymerase (Klenow fragment)? In this case, how I would break the RNA/cDNA duplex? Is it possible (and necessary), to validate each step (first strand, second strand) with a qubit fluorometer?

Also, should I eliminate the viral DNA before the reverse transcription? Or may I keep it, get the cDNA for the viral RNA, and use the same reaction tube, with DNA and cDNA, to prepare a single Nextera XT library?

I know that there are commercial kits that prepare both strands at once, however I just found very expensive options (such as SuperScript™ Double-Stranded cDNA Synthesis Kit). If anyone knows a less expensive alternative, I would appreciate the advice.

Hi!

In single cell droplet sequencing, 2 cell lysis buffer are often chosen: 0.5%CA-630, or 0.2% sarkosyl 160 + 6 % of the Ficoll PM 400. What is the difference of these 2 choice in RNA yielding, mRNA completence and etc.?

Thanks!

I have been reading several publications where reverse transcription was performed and I have seen that in many cases RNase H is used after reverse transcription and during second strand synthesis, and in many others RNase H is not used. Trying to understand why, I have read in Superscript III (Invitrogen) manual that amplification of some PCR targets (>1 kb) may require the removal of RNA complementary to the cDNA and RNase H should be used. In my personal case, I just want to reverse transcribe my RNA, make double stranded cDNA and build Illumina libraries. Do I need to treat with RNase H after RT? Thanks in advance for any help with this.

Best wishes

Niccolò

Dear all,

I am currently working on a reverse-transcription protocol (otal RNA extracted from CHO cells, then reverse-transcribed to be used in qPCR) with QuantiNova Reverse Transcription kit supplied by Qiagen.

When performing a negative control (ie., no template RNA), I obtain approx. 2 µg/µL DNA. I measured out the RT mix alone (containing oligo-dT, random primers and dNTPs), diluted 1:5 (4 µL in a total reaction volume of 20 µL when performing RT reaction), and obtained 3 µg/µL DNA.

I would like to know how to determine the cDNA concentration of my samples, as far as components of the RT mix are also absorbing (without performing a blank with RT mix each time).

Many thank for your help,

Lucie

Hi!

A special primer has to be used with only 19 bp poly dT (Tm 44.9) instead of 30 bp in original study (Tm 55.2). Will this induce failure of mRNA capture? Will this cause RNA detachment in Reverse transcription using Superscript II (@42 ℃)? If this is a problem, how about start reverse transcription @ 37℃ or 40℃ for 20min, then rise it to 42℃？ Will superscript II be completely block at lower temperature?

For some reason, we need to have sodium chloride (NaCl, 0.05-0.1M) in our system. Will this affect the reverse transcriptase and block the SMART reverse transcript?

Thanks

Hi everyone. For my project I have to reduce the time for reverse transcription of mRNA.

We are using High Capacity cDNA Reverse Transcription Kit from Applied Biosystems.

It's recommended there to use the the extension time of 120 minutes.

The same time I see the general recommendation for MMLV RT 60 min.

Where came this 120 min from?

Could anyone suggest where I can read something about it?

Thanks in advance!

When targeting long fragments (2 k bp) by rt-PCR from double stranded RNA template, should we opt for one step (same primers) or for two steps (random hexamers for rt, and specific primers for pcr)?

Hello, I am not too clear with protocols I get on choice of Reverse Transcription primers for cDNA synthesis. I know that random primers are used for prokaryote samples and oligodt primer for eukaryote. Also I have come across protocols that uses both random and oligodt primers for eukaryotes cDNA synthesis. I have once used both and reverse transcription was fine but after amplifying my gene of interest I got polyA tail noise in my chromatogram abi file (70% of bP). I want to know if it's possible to use only random primers for eukaryote mRNA Reverse Transcription, if I got no oligodt primers for reverse transportation.

I would like to evaluate the amount of reverse transcription (cDNA) on a 20um fixed mouse brain section. I am using random primers with RevertAid H Minus M-MuLV (reverse transcriptase).

and would like an estimation of the reaction efficacy on different protocols.

I've been wondering if removing the random primers from the reverse transcription reaction either with a column or precipitation before using it as a qPCR template reduces the background a bit in later cycles.

Notes:

1. I am working with bacteria so some amount of genomic DNA amplification is inevitable no matter how much I DNase treat it.

2. I am using the BioRad iScript kit for reverse transcription.

3. I am quantifying cycle thresholds with a real time PCR machine using Sybr Green.

Hello everyone,

I would like to know how cell growth and proliferation can impact the expression of some proteins. In other terms if a fixed amount of cells was seeded in 12 well plate in Day0 and then each day a Well was lysed. RNA extraction is performed for all samples and then reverse transcription then PCR. Knowing that for reverse transcription the same quantity of RNA is used for all samples, how can we explain the variation in the expression of the target ?

The FFPE tissues are relatively difficult to extract the RNA from so, how one can use reverse transcription based PCR

I wonder if the positive control primers and probes authorized by the US CDC for amplifying human RNAse P are specific to the RNAse P chromosomal DNA. My thought process is that if primers are created that are specific to cDNA for RNAse P (i.e. the primer crosses a region between two exons, eliminating it's ability to bind to the chormosomal gene) then those primers could be used to validate the reverse transcription step in RT-PCR.

#covid19 #RT-qPCR #diagnostics

So far, RT-PCR testing has been the frontline response to the COVID-19. PCR testing is considered as the gold standard for detecting COVID-19 and was designed by WHO, soon after the virus was identified. The PCR test employs reverse transcription of the viral RNA and loop-mediated amplification for the detection of the viral RNA.

The lateral flow immunoassay detects antibodies IgM and IgG and provides historic information about viral exposure of the individual. In comparison, PCR tests are highly accurate but the requirement of shipment of clinical samples takes about 24 hours at best. On the other hand, immunoassays provide results in 20–60 minutes but are less accurate since antibody response takes time to characterize. Several kits with SARS-CoV-2 antigens: the N protein and the S1 and S2 domains of the S protein have been developed with sensitivity over 90%. However, the difference of 10% can initiate the spread of the virus. In early-stage i.e. between 4–10 days, the test provides a sensitivity of just 70% (IgM detection). The sensitivity between 11 and 24 is about 92%. Further, the detection of IgG offers a sensitivity of 98%. Given the circumstances, the integration of PCR testing for a negative result might be useful for battling the COVID-19 outbreak.

Ref: https://www.nature.com/articles/d41587-020-00010-2

I have performed a reverse transcription using the High Capacity cDNA RT Kit but due to an error in programming the thermocycler instead of one cycle (25C-10min, 37C-120min, 85C-5min) the last step continue for 29 mins, so the cDNA samples have been at high temperatures (85C) during half an hour aprox. I want to do rt-PCRs with those samples, do you think I can use them? I will be doing a test with some samples anyway but I would like to know what can be the consequences to have cDNA at high temperatures.

I've tried a couple of methods, including Qubit and Fragment analyzer. They all didn't work. Is there a well-established way to measure DNA-RNA complex concentration? Thanks.

GAGTTCCAGGTCACTGTCACTGGCTCAGGGA

Im using a Nucleic Acid Detection Kit for Multiplex Real Time RT-PCR. Its content is:

- PCR Reaction Mix (Transcript II Multi probe one-step qRT-PCR SuperMix 1 UDG)

- PCR Reverse Transcriptase (RT plus RNase inhibitor)

- PCR Primer/Probe Mix (Primers and probes for ORF1ab and N genes; primers and probes for the control-RNase P gene)

- Positive Control (In vitro transcribed RNA with ORF1ab and N gene sequences; In vitro transcribed RNA with the control-RP gene sequence)

- Negative Control (Water)

Regarding I do not own a qPCR termocycler. Im performing a regular PCR and then run a electrohpresis gel. The product length for RP primers is 65pb and the product length for ORF1ab's primers is 129pb.

The protocol specified by the manufacturer is a one-step RT-PCR program:

1 cycle at 50°C for 5 min (Reverse Transcription)

1 cycle at 95°C for 30s (Pre-denaturation)

45 cycles of:

95°C for 5s (Denaturation)

60°C for 30s (PCR cycling)

The problem is that my positive control is not showing a positive result (I do not see a band in 129pb)

But the PCR works fine because I see bands in 65pb (RP gen) in the Samples wells.

I do not perform a DNA clean up in the extraction process. Should I do it? (Im using a ARN/ADN extraction kit with spin colunms, proteinase K, etc). So my sample has DNA and ARN.

My question is: Is it possible that the bands I see in 65pb in samples are produced by the primers bining to the original ADN (from the extraction) and not produced by primers binding to the cDNA? (which should be product of the Reverse Transcriptase transcribing the mARN to cDNA, and the syntetic ARN to cDNA too)

My assuption is that there is no cDNA then there is no bands in 126pb. Why there is no cDNA? Posible causes:

1) Reverse transcriptase is not working. Why? how to verify?

2) Positive Control ARN is degraded. Why? how verify?

3) Other issue? any ideas?

Thank you in advance!

what is the annealing and elongating temperature of a specific primer (31 bases) for reverse transcription ?

We have done a survey to confirm the occurrence of NDV and H7N3 in one province. We have performed Rapid HA, Agar gel precipitation test (AGPT) and Reverse transcription polymerase chain reaction (RT-PCR). Along with all above tests we want to perform Phylogenetic Tree test on ND and H7 genes but i am confused whether we add this test or not? What is the worth of phylogenetic tree test in this research project?

I use around 1 microgram of RNA for the reverse transcription. So far I've been using 2 microliters of the 25 microliters reaction that I obtain from the reverse transcription. I'm using two reference genes, 18S rRNA and actin. For the former, Cts ~6-7 and for the latter around 16-17. My genes of interests present Cts ~ 25-27.

Thank you in advance.

I'm preparing to do reverse transcription reactions, but would like each molecule of RNA to be represented once in the cDNA. I was looking for RTs that have RNaseH, but it looks like most RTs have reduced or eliminated RNaseH activity. So, my question is: do RTs generate cDNAs over and over again from the same RNA strand?

Or, does anyone have a recommendation for an RT with RNase H activity?

Guys, I have a High capacity cDNA reverse transcription kit, but it has been expired for 5 months. I would like to konw if the enzime is working yet. Should I buy a new kit?

Thank you.

Dear colleagues,

I have a bucket of carrot's inflorescence buds that were fixed with FAA, dehydrated and stored in methanol at -20°C for ca. 3 months. I did ISH with some of them that worked fine (so I assume RNA is there) but I decided to synthesize additional probes and I am running out of RNA stock. Could I rehydrate the samples, grind them in LN2 and proceed with Trizol isolation? Do you have any experience on that field?

I found some paper in which authors managed to extract good quality RNA from aquatic insects even from ethanol or acetone after prolonged to storage but plants are not exactly the same I suppose.

Best wishes

Jakub

I'm using the Qiagen Quantitect reverse transcription kit to convert RNA into cDNA. I want to quantify the cDNA product. The kit recommends using qPCR afterwards, but I don't want to buy more kits if I don't need to. Using a nanodrop (ssDNA), the dNTPs are causing interference, so I'm unsure whether I can trust those concentrations.

1) Can I have blank samples in my nanodrop (master mix of reagents with no RNA) and simply subtract it from the 260/280 of my samples to achieve a relative concentration of cDNA? (cDNA260/280 - blankMasterMix260/280)

2. Is there a column cleanup I can do to cleanup the cDNA to then quantify with nanodrop?

3. Someone mentioned a Qbit has something that binds to DNA, so the excess dNTPs shouldn't matter, but I'm unsure whether that is true.

Please, I would like to know, if I did RNA extraction one year before and stored it at -80^oC without use of RNase Out, will it be possible now to do reverse transcription reaction and receive good quality cDNA from it.

Thank you in advance.

I am looking for literature related to self-cleavage sites in RNAs which are involved in the reverse transcription. I mostly find the literature related to ribozymes in some viroids i.e. hammerhead structures, but i want to find some other structures undergoing self cleavage.

I am using the Ion Total RNA-Seq kit v2 to construct sequencing libraries from total RNA, with rRNA depletion. However, I've come across a potential issue with the reverse transcription.

After fragmentation, my fragmented RNA looks of a good size distribution (Bioanalyzer). However, when I check the cDNA on the Bioanalyzer after reverse transcription, the vast majority (>60%) of the fragments are less than 50bp in size.

This is using a brand new kit.

Has anyone come across any similar issues?

Thanks

Greetings,

I am performing a reverse transcription using the taqman microRNA assay protocol.

Parameters of thermocycler for this step are as follows: 30 min/16°C, then 30 min/42°C, then 5 min/85°C.

The program was only running for about 8 minutes, then the power failed for about 5 minutes before returning, and the program was restarted again.

How would that affect my reverse transcription product?

What would be the best course of action if such event occurred again?

Thank you.

I am currently working on tea miRNAs. For RT-qPCR analysis i need to use the U6 as control. I have worked out the primers for miRNAs, and also have forward and reverse primer for all. But how can i design the RT primer for U6snRNA?

Dear Sir/ Madam,

I am designing a primer for microRNA reverse transcription. But some microRNAs like hsp-mir-21-5p has a strong secondary structure. It forms a stable hairpin.

Can anyone please tell me whether the secondary structure of the microRNA(especially stable hairpin structure) will influence the reverse transcription?

If possible, please recommend some good RTase applicable in reverse transcription with severe secondary structure!

Thanks!

Binbin

I'm doing RLM-RACE of a beta-defensin gene, I have amplified 5' & 3' UTR regions and then I have designed overlapping (UTR+gene) forward and reverse primers using UTR sequences. But I'm not getting full length amplification while primers showing 100% BLAST identity with my gene. one thing is that I'm always getting only single band of RNA (at 1% agarose gel after RNA extraction with TRIzol, and I'm using epididymis tissue for RNA isolation).

and for reverse transcription I'm using my gene specific primers.

and also, I'm using touch-down PCR

please suggest me solutions.

Good Morning,

I have a problem with qPCR measurements and I hope you can help me with that. We would like to implement a probe (TaqMan) assay.

For receiving our samples, we isolated neutrophils from buffy coat. RNA was isolated by ‘RNeasy® Midi Kit’ (Qiagen) and on-column digested with DNase I according to the manufacturer’s recommendations. Afterwards, the isolated RNA was digested with DNase I for a second time (peqGOLD DNase I, VWR) to eliminate genomic DNA. The ‘High Capacity cDNA Reverse Transcription Kit’ (Applied Biosystems) was used to convert RNA into cDNA and afterwards, ‘PrimePCR™ Probe Assay’ (Bio-Rad) or ‘Dual Labeled Probes’ and primer pairs (Eurofins Genomics) were used for quantification of transcript levels by RT-qPCR.

For the probe assay we used 12.5 ng cDNA per 10 µl per well. We performed qPCR according to that protocol: enzyme activation, 95 °C, 2 min; denaturation, 95 °C, 15 s; annealing, 60 °C, 30 s. We used the ‘GoTaq® Probe qPCR Master Mix, 2X’ (Promega) and did duplex RT-qPCR studies.

Unfortunately, our curves are very crazy (see photo). This leads to falsified values and large standard deviations. When you change the settings of the cycles to be analyzed from 3 to 40, the previously bad Cq values get better, but some Cq values that used to be good deteriorated.

We implemented several tests, including either the use of different template amounts, or different primer/probe concentrations, or different master mixes. We also performed a gradient qPCR and changed the volume per well to 20 µl. We also used non DNAse I digested samples.

But we received always more or less the same curves.

We do not have this problem using a Sybr assay with our primers that we also used in the probe assay. So maybe our probes are the problem. But what can we do to solve the problem without buying new probes?

Attached you will find our graph.

Many thanks

Tamara

I am attempting to perform a qPCR standard curve using viral DNA (Adenovirus and MCMV) and cDNA (Influenza A) to be used to determine relative abundance of these viruses in primary samples. Viral DNA and RNA was extracted from viral stock using the QIAmp MinElute Virus Spink kit and vRNA was converted to cDNA using the ImPromII Reverse Transcription System. 6 point 10x dilutions were performed using this viral DNA and cDNA (undiluted-1:100,000) and a negative water control was included. For the qPCR, I am using TaqMan Universal qPCR Master Mix along with virus specific primers (forward and reverse) and probes whose sequences were provided from literature review or provided by neighboring labs but have not previously been used by our lab with this particular master mix. I believe that all of the input DNA/cDNA concentrations are fine (ranging from 17-180 ng/rxn note: master mix prefers concentrations <250 ng) and being that I have repeated these experiments a number of times with great care, I do not believe that it was a pipetting error with the dilutions. The amplifications curves, especially for Adenovirus, do not follow the natural curve progression seen in most standard curves and for all of the viruses the points do not fall on the slope of the standard curve line. I have attached photos for reference. I have tried repeating these experiments many times and adjusting the input concentrations of the viral DNA and cDNA. All experiments were for each virus was done separately, there was no multiplexing. I am wondering if it is possible that the primer efficiency may be the problem. The annealing temperatures for these primers are slightly higher (~3-6 degrees) than recommended by the master mix but a representative from Fisher seemed to believe that the reaction should still work. Also the target regions for these primers seem very short (all <150nt). Is it possible that I need to design new primers or is there possibly another obvious issue. If anyone could provide any feedback on what they believe the possible problem is or has further questions, please let me know.