Science topics: Proofreading
Science topic

Proofreading - Science topic

Explore the latest questions and answers in Proofreading, and find Proofreading experts.
Questions related to Proofreading
  • asked a question related to Proofreading
Question
10 answers
It is my observation that the RG Score has encouraged members to contribute expert scientific answers on the discussion threads, because Answers can raise one's RG Score each week, while posting scientific research Articles carries less weight, because the non-discussion thread portion of one's RG Score depends quite heavily on the number of Reads and Recommendations which any posted article in a specialized field may receive. Time is also a factor, because the discussion threads are more readily accessible so that one can participate and contribute one's expert scientific opinions everyday and for as long as one is able, but researching and writing a scientific paper requires a significant amount of time, not to mention the wait-time during the submission, editorial screening, peer review, proofreading, press run and distribution processes.
Relevant answer
Answer
Well, Prof. Nancy Ann Watanabe, there were several ways how to increase scores in RG, but when the scores rating is going to be eliminated in July, then still there is a possibility to comment on papers and preprints & I guess in threads as well, But that those do not reflect more than a pure interacting work.
Rarely this is done on unique scientific criteria, it is a mixture of respect and happiness for other members works as well, recommendations and reading of articles and preprints will be left for those members, and editorials willing to share the material, and there will be a growth in the research interest score and the Citations and the Readings. Advisable in addition, to post preprints if it is allowed so by journals.
arXIv for example now has added now a DOI and the traditional bibcode that leads to NASA ADS. RG has a DOI but it is not indexed always. I guess questions and discussion will remain open and we will have private statistics on those. Mentions in RRSS such as Twitter also are now starting to appear, I got one, let us see if I get another one, they are more difficult to track than citations.
Projects are the other options, although I do not know if they increase any scores, they are more to showcase with nice figures and reference our studies and findings. They can be shared on LinkedIn. Following the same matter of projects, a button should be implemented by the RG AI platform asking us if we want to be added to a particular project by creators (researchers that we don't know, I apologize but this is not a "star trek borg community" to be conquered by any project, since we are added without concern and that leads to misunderstandings sometimes. So do not only score that is under evaluation, projects memberships inclusions should be part of a discusiion as well, even if that is a rule in RG, scores were also a rule.
We are living in very difficult times and we do not always seek opinions to be part of projects outside our fields or particular interest.
Summarizing:
  • Research Interest, citations, and h index will be publicity mentioned in our profiles with a modern statistics curve on the citations.
  • Mentions (Privately) and Readings (Externally) will be left to see as well.
Best Regards, thanks for asking. Hasta Luego.
  • asked a question related to Proofreading
Question
2 answers
I cited a piece of information while submitting my article back in 2021. During submission, it was state-of-the-art. After being accepted in 2022, I found updated state-of-the-art published very recently. Should I update my citation with the 2022 data?
In the current stage, we, the authors, will submit the final files, and the editorial office will give us another chance of proofreading after adapting to the formats. And, it is just a piece of information in the Introduction section and doesn't affect the result/outcome of the article.
Thanks for your time!
Relevant answer
Answer
Once a paper is accepted, you cannot update the accepted version of the paper.
If you need to update the paper, you have to write a letter to the Editor explaining the reason for wanting to update the accepted version of the paper.
  • asked a question related to Proofreading
Question
6 answers
Hi everyone!
I am looking for a journal for our research. In our study, we focused on the synesthesia experience among six of the seven siblings. In the first study, we compared the auditory stimulus and color perception consistency of six siblings with their peers who did not experience synesthesia, and we found that these siblings empirically associated sounds with specific colors. In our second study, we used IPA to reveal the similarities and differences between the experiences of these siblings. Since we are not native speakers, our work has been proofread by an international company known in the field, even if we all complete our Ph.D. in English. However, we received rejections from about 15 journals as they were not suitable for the journal's scope.
In each journal we submitted, we checked that both a study on synesthesia and a study using a relatively less-known qualitative method such as IPA were published. Of all the journals to which we sent our manuscript, only 1 was rejected due to language problems. All the remaining journals stated that the study was out of the journal's scope. Among these journals were journals such as Current Psychology and the International Journal of Psychology, which published studies in many subfields of psychology. There were also journals that focused on more specific areas, such as the Journal of Mixed Methods Research or Color Research & Application. As a result, we feel that we have screened all potential SSC indexed journals. Linked you can see the preprint version of our manuscript:
I would especially appreciate your science citation indexed (SCI), social sciences citation indexed (SSCI), science citation index-expanded (SCI-E), or emerged source citation indexed (E-SCI) journal suggestions. Due to our local currency, we cannot submit our work to journals that charge for publication. So, no-fee journals would be great.
Other recommendations are also welcome!
Best wishes,
Sami.
Relevant answer
Answer
Have you tried these…? (Or were these discovered in the search function suggested by Hamada S. Abulkhair …?)
Consciousness and Cognition
Vision Research
Neuropsychologia
Journal of Neuroscience
Perception
  • asked a question related to Proofreading
Question
7 answers
Hello
I need real help from you. You must publish an item in a top Journal (WoS).
I used a professional English publishing service until now, but it was not enough for me.
I’m looking for another editing service with more complex services (including formatting on journal requirements). But I don’t know which one to choose. Plus, they have very high prices relative to my low income. But even at these prices, I don’t know if to risk it. I’ve seen some recommendations, but I don’t know what to choose. Some still recommend such services on the internet, but I do not know how much confidence to have. My impression is that most of them are self-recommending. (they work on such services)
Please recommend to me only if you have collaborated with such a service, and following this collaboration, you have managed to publish to a WoS Journal.
Thanks
Relevant answer
Answer
Hi there,
For the English editing of your manuscript at different levels and with very fair prices, you may contact me by my email address: amirh.montazer@gmail.com
  • asked a question related to Proofreading
Question
2 answers
Which proofreading service would you recommend?
Relevant answer
Answer
I have had a good experience with American journal experts - AJE. I will try SAGE MILES next time.
  • asked a question related to Proofreading
Question
5 answers
I am looking for a proofreader for my phd thesis, Any recommendation?
Relevant answer
Answer
besteditproof.com is one of the companies I got support for my articles. I can definitely recommend their proofreaders and editors. I believe they provide some samples when you communicate them. So, if you want to see some samples before placing your order. Hope it helps.
  • asked a question related to Proofreading
Question
8 answers
Some journal' editor said that "the authors should provide proof that the paper has been proofread by a native English speaker". Is this a reasonable request?; if yes, How can I provide it.
Relevant answer
Answer
Well narrated @ Wolfgang R. Dick
I agree with you
  • asked a question related to Proofreading
Question
10 answers
Is it okay to make a proofreader as second author? And i want to make some paper this year, maybe any of you interested for that role? (do proofreading and as a Second or third author) You may answer here or send message dirrectly to me. Thank you before
Relevant answer
Answer
These are good guidelines Anders Norberg let's look closely
first, it is nice to hit all 4 but realistically does not happen as we will see
  • Substantial contributions to the conception or design of the work; or the acquisition, analysis, or interpretation of data for the work; again I did say that a proofreader would have to do this or similar to
  • Drafting the work or revising it critically for important intellectual content; this would make most proofreading or editing eligible
  • Final approval .of the version to be published; how? when there are multiple authors involved often ten or more? poor trend of modern scientific literature but there you are
  • Agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. I guess this is the argument for including department heads but I don't see someone who has proofread in a field for 20+ years being not being able to do this
But is this a slippery slope? I agree that citations and publications are for sale in a publish or perish market. But on the other hand, ghostwriting is more prevalent than you would believe. I have helped write three books where I wrote from 30 to 50 percent of the sentences depending on the chapter and my name is never mentioned even in the acknowledgments. I needed the money;-). Finally, most editors and proofreaders never get much credit nor are they in a position to profit much if they were listed as a coauthor. Frankly, it is more of doing the right thing or not. Chris
  • asked a question related to Proofreading
Question
9 answers
Respected Sir/Mam
My Manuscript has been accepted. I received the email of the Editor that a certificate of proofreading from Native English Speaker is mandatory to publish your MS. If someone can help to check my MS for English language usage, Grammar, Punctuation and Spelling, i will be very thankful. This will save my money. nazirmkd@gmail.com
Relevant answer
Answer
Same issue
  • asked a question related to Proofreading
Question
1 answer
Every day I receive at one email concerning research proofreading. But I have not send them any paper. I do not know if any of you have any experience with them. If they have proficiency in editing manuscripts..
Relevant answer
Answer
www.proofstep.co.uk is very affordable, fast and reliable
  • asked a question related to Proofreading
Question
9 answers
Has anyone used the proofreading services of the journal publisher before submitting a paper? Some publishers offer this option with a fee. Would you recommend it as an option? Could it be increasing the chances for publication? Would you evaluate it as a reviewer?
Relevant answer
Answer
Thanks Rafael Baptista , good to know
  • asked a question related to Proofreading
Question
14 answers
For non-natives, a manuscript is often rejected based on the reason that idea is not presented clearly. Please ask a native colleague to proofread it.
There is no offense to say that I am non-native and have been facing rejections for the same reason. Concerning this, please guide me 1): how do you ask someone from the same field to modify/proofread your manuscript? 2): how do you develop trust in that person? 3): if one agrees to proofread and modify, which rank he/she deserves on the authors' list? And 4): is it okay to approach a full professor to do this task?
Looking forward to answers and guidelines by experts
Note: I have a complete manuscript that requires a native speaker to work on it.
Details; quantitative research, time-lagged cross-sectional design, emotional labor, organizational behaviors, individual-level data, and bank employees.
Relevant answer
Answer
Dear Prof. Igor Gurkov,
Thanks for your guidelines and answers. Much appreciated your time and insights!
  • asked a question related to Proofreading
Question
2 answers
Most non-native speakers seek to hire a professional language editor to proofread their manuscript so that they may secure an acceptance. However, these authors expect language editors to beautify the original text at the stylistic level to improve the overall readability of the submitted manuscripts. However, native speakers are committed to maintaining the original voice of the authors. Unless comments on the style of writing are not requested, most language editors will deal with the errors in the text. Of course, requesting customized edits would require direct author-to-editor communication (not through individual or institutional mediators).
Therefore, it might be useful for authors to familiarize themselves with the following types of editing.
1. Simple proofreading (checking grammar, punctuation, and word use at the basic level)
2. Copy-editing (proofreading with suggestions for improved sentence structure and word use)
3. Line editing (substantive copy-editing: a more comprehensive view, looking for the flow of thoughts, originality, paragraphing, redundancy, coherence, factuality of the given information and contradiction)
4. Developmental editing (comments on the structure of the thesis, its visualization, conceptual model, formatting, Reference consistency, comprehensibility of the line of thoughts and organization)
The following items must be defined.
- Specialty and subspecialty (to select editors who are most versed in your domain).
- English spelling (American, British or Canadian).
- Type of the required editing (Proofreading, Copyediting, Line editing, or Developmental editing).
- Budget.
- References and appendices (The style sheet must be defined: APA, MLA, Chicago,....etc).
- Reports and invoices (if indicated, requesting reports and invoices must be stated earlier in the conversation).
- Tips and feedback ( If the authors are willing to learn from their errors, they should request inline comments and general feedback).
To the best of my knowledge, Peerwith is the ONLY platform that provides a secure peer-to-peer language editing service.
  • asked a question related to Proofreading
Question
11 answers
The Manuscript deals on sexual ornaments and non-breeding events in a Eurasian ornamented bird. It was fisrtly unaccepted in Bird Study, Animal Behaviour, Behavioural Ecology and Sociobiology, Acta Ethologica.
Relevant answer
Answer
Dear Igancio,
Resources such as Grammarly, ProWritingAid, or Microsoft Word’s built-in tools can provide a starting point for simple grammatical corrections. They are cost-effective, user friendly, and relatively efficient.
As a next step, I would recommend engaging with a friend, local colleague, or your graduate advisor. Even if their English language proficiency is similar to yours, a second pair of eyes can often help identify issues that the original author may have inadvertently overlooked. Some schools even offer in-house editorial support via the university library or student services. Ask around, you may be surprised by the options available in your personal network.
After you’ve exhausted these resources, if your budget allows, I would suggest engaging with a professional editorial service. A professional editor can enhance the word choice, logic, and clarity of your writing, increasing the likelihood for manuscript acceptance.
I’m the proud Founder and Managing Director for JournalEdit, a premium editing service. JournalEdit has been helping researchers worldwide with professional scientific editing since 2012. We have a global network of 300+ experienced scholars (PhD, MD) with expertise across medical, science, and engineering fields. All our editors are exclusively native English speakers and based in the US, UK, Canada, or Australia.
As an introductory promotion for ResearchGate members, use promo code RG10 for a 10% discount. Or, if you visit our website & join our mailing list, we'll send you a discount for 20% off your first order!
Best wishes for a smooth and successful publication journey!
  • asked a question related to Proofreading
Question
18 answers
The manuscript will change during the review process.
I don't know, whether I receive funding, so I want to keep costs low.
I am not a native English speaker, but I don't have problems with the language either.
However, I don't know how picky editors are about potential language flaws.
Any ideas or suggestions?
Relevant answer
Answer
Yes - although it is also possible that they do realise that you have done good research. But in that case the bad writing (to put it bluntly) will still irritate them, and they will either reject the paper on that basis, or insist that you revise your text and edit that properly. Therefore, it is FAR wiser to make your work ready for printing BEFORE you submit it. It is well worth doing that, and uncompromisingly! I have published many scholarly publications, and know well, from experience, how one's judges will act. I also regularly read submissions from other scholars seeking publication, and the quality of the writing and general presentation (i.e. the use of footnotes etc) influences me very strongly. Of course WHAT is said is the most important thing, but if it is said badly one cannot, alas, accept the submission, and only the contributor can - and should - make the necessary corrections. So do try to get things 100% right from the beginning. It "pays"!
  • asked a question related to Proofreading
Question
4 answers
Its a very special time that we are trying to review our own ways of doing things during pandemic period. At the same time we can connect scientifically. Please I will be glad if I can get two native speakers who can share their email here and I send a manuscript to them. They must be good authors in the marketing/consumer behavior and have some papers in SSCI/SCI. I will recognize the output by adding as a co-author. Thank you.
Relevant answer
Answer
Hello Farida: I think I might be able to help you. I am currently helping a few PhD students in Business and Marketing to strengthen their write-ups. I am a full professor. For my solo write-up samples, check out my Project "Customer Experience" in my profile. I have just created it so it may take about 24 hours before it is published. Good luck with your intellectual pursuits and take care! Madan (batra@iup.edu)
  • asked a question related to Proofreading
Question
4 answers
Our lab has had great success with a range of PCRs using Kapa 2G Robust - particularly good with dirty samples and tricky PCRs that either fail or struggle to amplify well with standard Taqs. The issue is Kapa decided to use an alternative distributor, which effectively means we need to order our polymerase 6 months in advance (I wish I was joking, but actually true). Kapa don't seem to care.
So... what other engineered/evolved polymerases do you like for routine PCR work? (I already like Phusion/iProof polymerase for long/proofreading work, but wanting something for the mundane stuff).
Cheers,
Nick
Relevant answer
Answer
I usually use the Premix Taq™ (TaKaRa, Japan) for routine PCR and its products are used to agarose gel electrophoresis test. qRT-PCR are often performed using 2X TB Green™ Premix Ex Taq™ (TaKaRa, Japan). Clonal PCR are performed using PrimeSTAR HS (TaKaRa, Japan). According to my experience in the lab, these polymerases are worth trying.
regards,
Bai-Jun
  • asked a question related to Proofreading
Question
2 answers
Hi,
within my studies I usually analyse the effect of computer (VDT/VDU) work on (visual) ergonomics. I would really appreciate having a software that occupies my subjects with repeatable kognitive and visual tasks at the computer screen for a given period of time.
At the moment, we use self made tasks (e.g. proofreading) based on the IReST - International Reading Speed Texts, but are not totally happy with that.
Does anybody heard about something like that? For ergonomics, there are work simulators (e.g.
ErgosTM) utilized as functional capacity evaluation test, but until now, i found nothing for simulation typical tasks for computer work.
Thanks to everyone!
Oliver
Relevant answer
Answer
C K Gomathy : Thanks for your reply. The linked page at google preview is not available (for at least in Germany...). Could you give me the page numbers or The abstract your revering to? There is one single university in Germany that has a copy of this book where i could order the pages...
All the best!
Oliver
  • asked a question related to Proofreading
Question
4 answers
Hello. I have got rejection decision of submitted manuscript. As usual when i recieved decision of manuscript, every anonymous reviewer's comment and descion was available. In this letter I have just one review decision "Reject" and several points of reason. Moreover, before submitting the manuscript i sent it to language edition; and in rejection reasons one of the reason is grammar mistakes, proofreading is needed.
Can I argue the decision? How to make it in polite way? Can i ask to provide decision of every reviewer?
I am little confused with decision.
Thank you for your feedback.
Relevant answer
Answer
Typically, the decision of the editorial board to accept or reject the article is based on the study of the article/s material by only one reviewer - the subject of whose own work is closest to the subject of your article. You may not agree with the comments and the final negative decision of the reviewer. The surest way to convince the editors that your article is still worth publishing is to ask the editors to transfer your article to another reviewer. This approach to the dialogue with the Editorial Board is the most successful. (The editors are not obliged to inform the 1st reviewer about your request to replace him with another). So that will be just
just the 2nd attempt.
  • asked a question related to Proofreading
Question
23 answers
In order to write a good research paper, I need guidance on proofreading softwares/tools that help make a paper a good piece of academic writing.
Relevant answer
Answer
Many answers are more talking about editing, as opposed to proofreading. Proofreading looks for errors. Editing improves the use of language.
I do not think that there is any technology tool that will do satisfactory editing. That requires a person to use critical thinking about the nuances of the meaning of words.
  • asked a question related to Proofreading
Question
12 answers
How often are your articles rejected due to poor or ineffective language of the content in the article? How often do you have to take help from professional writers for improving the language quality of your research article? Do these professional writers really make the work worthy of being published or the authors themselves have to take that responsibility at all stages even after proof reading ?
How is the scenario different in english speaking developed, non-english speaking developed and developing countries?
Sorry for so many questions. Please answer any of these if you want.
Relevant answer
Answer
My articles are never rejected "due to poor and ineffectual language." I never hire professional writers to improve the quality of my writing. As the author of three academic or scholarly books, I proofread the galleys and page proofs, mainly because the publishing house's staff editor assigned to my book publishing project did not have specialized knowledge of the content. I am blessed to be able to publish books, chapters, essays, and articles in my native language, which is English, in a country where English is the official language.
After I earned the Ph.D. degree and taught for three years, I successfully completed a College of Engineering summer course designed for post-Ph.D. faculty members seeking certification in Teaching Technical and Professional Writing primarily in courses enrolling upper-division and graduate students majoring in engineering, business, sciences, pre-law and social sciences, and education.
English-As-a-Second Language (ESL) is a separate course of studies. ESL courses are designed for students who are first tested and then required to take appropriate courses offered by the ESL Department before they are allowed to take required courses offered by the department in which they are interested, whether to enroll in courses or to complete a two-year associate degree, bachelor's degree, master's degree, or doctoral degree.
As an administrative director of a university writing program, I strongly recommended that undergraduate and graduate-level students demonstrate their proficiency in English via the ESL programs. Most academic departments require transcript evidence of proficiency in English. Graduate students are required to do all of their written assignments without help. Post-graduate employment opportunities are restricted if a job candidate is unable to read, write, and speak English with a high level of proficiency. A scientist who is worth his or her salt typically works hard to achieve the highest level of competency in writing research articles without resorting to "professional writing services."
  • asked a question related to Proofreading
Question
1 answer
I need to submit and publish a research paper in a journal and I am looking for professional editing services. I already contacted San Francisco Edit" service. Does someone know about their quality of service?
Relevant answer
Answer
Dinuka,
My company, JournalEdit, would be honored to help with editing of your manuscript.  
We employ a team of highly-qualified academics and industry professionals (PhD or Masters-level graduates), who are native English speakers.  By leveraging our network of subject matter experts, we can pair your manuscript with an experienced editor in the same technical discipline, to provide step-by-step guidance and help maximize your potential as an author.
At JournalEdit we pride ourselves on providing quality, prompt service at an affordable price.
  • asked a question related to Proofreading
Question
4 answers
Is anyone knows what the best proofreding tool for manuscript? I need it, cause English is not my second langguage
Relevant answer
Answer
You might like Grammarly tool.
They offer extension and on page solutions. Here is the website: grammarly.com.
They provide both free and pro versions; however, I think the free version might help you a lot. But note that free trial does not allow to scan plagiarism.
  • They have automatic grammar, spelling and punctuation proofreader, giving some synonym suggestions. Support for file formats of DOC, DOCX, ODT, TXT, and RTF.
  • It is important to emphasize that they do not give you a depth proofreading.
  • If you need to check your papers for the basic grammar and spell checking, it might be helpful, but no for advance corrections.
  • Editing and proofreading service for scientific manuscripts with an affordable price I would recommend besteditproof.com. Their prices are mostly cheaper and affordable than other companies. It is a very user-friendly website. You even do not have to sign up to see the calculated price. I hate the websites requiring to sign up to see the quote. Click the following link to see your own rate: https://besteditproof.com/new-order-step-1
I believe Microsoft Office also offers some free instant checker. You might want to try that one too.
Hope it helps,
  • asked a question related to Proofreading
Question
23 answers
To review the English of my master thesis, I need an online reliable English proofreading and editing tool, what do you recommend for me?
Relevant answer
Answer
following
  • asked a question related to Proofreading
Question
8 answers
I believe proofreading is a very beneficial habit in writing papers, reports, chapters, ..etc. I trust some people who do that for me. Is there any website doing that?let us know what are you doing?
Relevant answer
Answer
Once I complete a paper, I would let it sit for a few weeks or sometimes months and then proof read, revise, and edit. Sometimes, I also request colleagues and friends within the same field and outside the field. It helps me in identifying issues that I wouldn't have noted myself. Especially, people outside my own field can provide a good objective assessment of readability and comprehension.
  • asked a question related to Proofreading
Question
32 answers
Hello every one ,any recommended proofreading service website for thesis or paper editing ?
Relevant answer
Answer
Dear Asma,
As Nashaat mentioned, resources such as Grammarly, ProWritingAid, or Microsoft Word’s built-in tools can provide a starting point for simple grammatical corrections. They are cost-effective, user friendly, and relatively efficient.
As a next step, I would recommend engaging with a friend, local colleague, or your graduate adviser. Even if their English language proficiency is similar to yours, a second pair of eyes can often help identify issues that the original author may have inadvertently overlooked. Some schools even offer in-house editorial support via the university library or student services. Ask around, you may be surprised by the options available in your personal network.
After you’ve exhausted these resources, if your budget allows, I would suggest engaging with a professional editorial service. A professional editor can enhance the word choice, logic, and clarity of your writing, increasing the likelihood for manuscript acceptance.
I’m the proud Founder and Managing Director for JournalEdit, a premium editing service. JournalEdit has been helping researchers worldwide with professional scientific editing since 2012. We have a global network of 300+ experienced scholars (PhD, MD) with expertise across medical, science, and engineering fields. All our editors are exclusively native English speakers and based in the US, UK, Canada, or Australia.
As an introductory promotion for ResearchGate members, use promo code RG10 for a 10% discount. Or, if you visit our website & join our mailing list, we'll send you a discount for 20% off your first order!
Best wishes for a smooth and successful publication journey!
  • asked a question related to Proofreading
Question
6 answers
The set of questions designed to test Acceptance and Usability of Human robot Collaboration by Intellectually disabled people working in Sheltered Workshops of Germany needs to be checked by an expert in the field for reliability and clarity.
Relevant answer
Answer
Also, what pattern is better suitable? Fill in type like the very first question, or a straight forward question. or statements to respond on a 5 point scale or 7 point scale to.
  • asked a question related to Proofreading
Question
3 answers
Hi
Is it possible for qualified persons to collaborate with local researchers to access the method of publication of research acceptable in international journals within the first category. If a particular person has the ability to categorize and correct the language in which paper wrote by the researcher, please replay
Thanks
Relevant answer
Answer
Is it correct to say you are looking for help to shape your research paper into a form that can be published? Judging from the phrasing in your request, there could be much work to do. This would require not simply a proofreader but a competent editor, someone acquainted with your field and the requirements of the publications you are trying to reach.
  • asked a question related to Proofreading
Question
11 answers
What is legal status of freelance writing in your country? & what you think about its ethical status?
Relevant answer
Answer
We do this job. We help mostly those have extreme-hours work and still need to cope with their university responsibility as postgraduate student. we also do for business people who looking for academic professional writing service. We help pupils/students/postgraduate/ community who in need of English academic and writing educational service. Helping community and empowering them is legal is it?
  • asked a question related to Proofreading
Question
7 answers
Shouldn't current practices regarding plagiarism be revised? What is your opinion?
  • asked a question related to Proofreading
Question
51 answers
Hello,
As non native english speaker, I havr many troubles with my english papers language, is there anyy free site / software that can help?
Relevant answer
  • asked a question related to Proofreading
Question
3 answers
My PhD student has been working with eDNA samples working on 2 genes namely COI (Leray's-313bp) and the MiFish-12S primers. He is using Illumina overhanging adapter with specific primers to amplify each samples, which means the primers became quite long with additional 30+ bp of the overhanging adapter (for each ends). He is now having problem with COI amplification. He did try a lot of protocols including Leray's touchdown PCR method, from using normal taq polymerase to using HiFi proofreading polymerase. And finally when he used HiFi polymerase there are some clear bands of non-specific amplification at 100bp+ region. However, we suspect that the bands are not the target size. With the COI primer, he is supposed to get 313bp, and with the addition of the overhanging adapters (+67bp), he is supposed to get a product with 380bp. But the product size is at 450bp+.
We need some advice here, because he is using pre-stained GelRed, and it may cause some issues with slow DNA migration in gels. Or probably, he did not amplified the right mtDNA. His positive control, labelled FISH did amplify at 400bp-ish. He repeated with the gel, but he still get similar band patterns. Is it possible that the target size is higher with the primer his using? He also gets a faint band on the negative control. He is sure that all his chemicals are fresh and he used fresh nuclease free water in the experiment.
The details of primers used-
mlCOIintF: 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGWACWGGWTGAACWGTWTAYCCYCC
jgHCO2198: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAIACYTCIGGRTGICCRAARAAYCA
*the underlined nucleotides is the Illumina adapter
from: Leray, Matthieu, et al. "A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: application for characterizing coral reef fish gut contents." Frontiers in zoology 10 (2013): 34.
Is it possible that the HiFi polymerase caused this 'contamination' to occur, because he did not see any bands or smearing for the negative control when he used the normal taq KAPA HiFi HotStart ReadyMix (2X) and buffer.
Can someone help us. We are at our wits end trying to figure out these problems. Thank you.
Relevant answer
Answer
I have not used the CO1 primers. For universal primers, it is normal that there is length variation among species. Mostly, you got targeted amplification based on your gel image. I would use DNA extracted from tissues of species known to be present in your eDNA samples to verify this.
  • asked a question related to Proofreading
Question
6 answers
One of my journal papers was under review in a reputed journal for over 2 years. Initially, there were major revisions, we submitted 4 revisions to the journal incorporating reviewers comments and justifying contribution of our paper.
In our last revision, it was minor revision. We did changes in 10 sentences (Question based headlines to statement based headlined) and did through proofreading.
After submission of the very minor revision (changes only in 10 sentence) and proofreading, I have got this mail from the new Editor-in-Chief after 10 month that our paper got rejected based on editorial objective and type of paper (as it was a review paper).
After 2 years, they found that our paper was not matching their editorial guidelines, hence, hence they cannot publish paper in the journal in its current state.
I do not know really how to handle this situation. I am not just questioning their judgement, but after 2 years they showed that it did not quality their editorial objective and journal scope (as it was review paper). I lost almost 2 years time to know their views after several revisions.
My questions to my research colleagues: Have you faced this situation in your research life? What did you do in such situation?
Requesting your views and suggestion.
Thanks
Relevant answer
Answer
Hi, Gobinda,
I am sorry to hear of your situation. It can be quite frustrating to respond sincerely to reviewers' notes without finally obtaining an acceptance. There is, of course, virtually no recourse once an editor has made a final decision.
I strongly recommend that you give yourself a few days to process the rejection, then to quickly resubmit your manuscript elsewhere for consideration. The worst personal example I can share is a controversial manuscript of mine that received 8 rejections before being accepted. One of my mentors often said, "there is a place for every manuscript." Find it.
  • asked a question related to Proofreading
Question
15 answers
When dealing with a manuscript I comprehended that my co-authors and myself have to read, update, expand, correct the manuscript for about 40 times before it is sent to the journal. Plus a statistician should be included. Plus proofreading. This number is let’s say final and this number can be divided to the number of co-authors. Probably this partly depends on the organization of writing/publishing from institution to institution. The number is an estimate for the publication in a journal indexed in Current Contents.
Relevant answer
Answer
I think this number of checking times is depending on the strength of the journal want to be published in it.
  • asked a question related to Proofreading
Question
10 answers
Comparing the relevance of medical information about ischemic heart disease retrieved by 2 search engines: Google and Bing
Introduction
As the connection quality and internet availability are improving, more and more patients tend to use search engines to retrieve medical information about their health issues through search engines. However, most patients are hardly able to acquire essential knowledge as effectively as an experienced search engine user nor can they confirm the validity of the retrieved medical information. Accordingly, identifying the relevance of retrieved medical information with efficiency is very important for patients to improve the communicative quality with clinicians so as to make better decisions on their health issues.
Objective
The study was to compare the relevance of medical information retrieved by 2 search engines: Google and Bing and to help non-professional patients seek out pertinent medical information about ischemic heart disease.
Method and material
We conducted 2 online searches using Google and Bing search engines to collect retrieved web pages in 100 rankings through loading keywords “ischemic heart disease” and its equivalent term “coronary artery disease” in Feb 2018. Commercials, adverts, text over 32,767 characters, images or videos were excluded out of our study.
The relevance of information was evaluated by 6 indicators which include pathophysiology, symptoms, diagnosis, prevention, treatment and risk factors with reference to the main page about ischemic heart disease of Wikipedia. Each indicator consisted of a series of keywords such as “ECG” or “myocardial” to indicate the relevance of medical information on the page. All websites were categorized into commercial (.com and .co.) and non-commercial (.gov, .edu and .org) via their top level domains.
A total of 200 pages evenly collected by Google and Bing search engines were investigated, managed and analysed by Microsoft Excel 2010 and Chi-squared was applied to show the significance among collected data.
Results and conclusion
Commercial websites (.com or .co.) were more likely to be retrieved than non-commercial websites (.edu, .gov and .org) by Bing search engines (p<0.05), but no statistical difference in number between commercial and non-commercial websites through Google search engine. Furthermore, dot edu websites retrieved by Google engine provided lower relevant medical information about ischemic heart disease in comparison with commercial websites. Likewise, dot.gov pages retrieved by Bing search engine provided less relevant medical information than commercial websites. Both carried significant difference in statistics (p<0.05).
Combining pages collected by two search engines, non-Commercial websites did not provide more relevant information about ischemic heart disease than commercial websites. The relevance of medical information on top 25 ranking websites searched by Bing had no difference from that by Google search engine, but on the following pages from 26 to 100, Bing provided more relevant medical information about ischemic heart disease than that by Google (p<0.05).
Discussion
Search engines with different settings bring about distinctive results, so being aware of the relevance of retrieved medical information provided by search engines is critical for patients to improve their communicative quality with clinicians.
A number of search engine users tend to preconceive commercial websites provide less relevant medical information and mostly they believe non-commercial websites such as educational or governmental websites should provide more relevant medical information on the pages, however our study showed commercial websites provided more relevant medical information than non-commercial websites (.edu, gov or .org) in general. Educational websites by Google or governmental websites by Bing provided less relevant medical information in comparison with other categories of websites.
In terms of page rankings, amateur seekers tend to concentrate on the top 10 ranking pages with minimal interest in further searching the following pages but our study showed top 30 ranking pages gave equivalent relevance on pages no matter with Google or Bing search engine.
Keywords: ischemic heart disease, coronary artery disease, Bing, Google, search engine
Relevant answer
  • asked a question related to Proofreading
Question
6 answers
Dear Thanos,
Thank you very much for the congress activity, impressive development and my invitation.
I finalizing my paper to the congress issue: Yuri Kartavtsev. "The evolutionary-and-genetic paradigm development: Neo-Darwinism vs. molecular evolution fit”. It is an assignment, short as possible. However, it in demanded format is 8 pages without References and 3 figures. Total volume is 17 pages. Should invited speaker follow 5 pages standard or there is a relaxed limit in this case?
If you will accept such MS volume, I’ll proofread finally this short review and submit it soon after on the congress site as requested.
For an occasion I attach draft of the paper.
Cordially
Yuri
07.04.18
Relevant answer
Answer
Dear Michael,
Thanks a lot for nice news. Always there a time limit...
With warm regards
Yuri
  • asked a question related to Proofreading
Question
8 answers
Microbiology paper on antimicrobial reistance- Gram negatives
Relevant answer
Answer
Hi,
Please visit us on:
Editing, Proofreading, Academic, Scientific Articles, Patents
GROUP
Facebook:
Fast and low price editing and proofreading services.
  • asked a question related to Proofreading
Question
5 answers
Hello. We are trying to clone a2-3 kb long insert into a 3,5 kb long vector by NEBuilder. We had to amplificate by PCR both the insert and the vector. We used MyFi polimerase.( https://www.bioline.com/de/myfi-dna-polymerase.html ). The products contain 2-3 mutations, so the polymerase made mistakes, but it is a proofreading, high fidelity taq... Why could it happen? What circumstances could cause this?
Relevant answer
Answer
It might not be errors from your polymerase. It's possible that your DNA template has SNPs compared to the reference genome.
  • asked a question related to Proofreading
Question
29 answers
Websites services for professional proofreading and rephrasing
Regards
Relevant answer
Answer
It's really useful question thanks for asking it.
  • asked a question related to Proofreading
Question
7 answers
I have a colleague engineer who is retired and is very good at proofreading scientific manuscripts and technical papers. He asked me how to get into proofreading business: freelance or join some bigger company. I assume he wants some part time thing but was not sure what to recommend on how to start. Any suggestions?
Relevant answer
Answer
Hi Jonas - Having worked in both camps, I think there are merits to each approach and it will largely depend on what motivates your friend. In my mind, joining a company is an excellent way to get started quickly and relatively hassle-free. You can decide how much time you want to dedicate for editing, what jobs interest you, etc. These attributes are particularly valuable for someone who enjoys reading/learning academic content and is pursuing editing as a passion or hobby, rather than a career.
Operating as a independent freelancer can be rewarding in a different way. It is gratifying to see your business grow over time and repeat customers seeking your individual expertise and editing style. Building a direct rapport with customers is great way to give and receive feedback. At the same time, an independent freelancer inherently needs to spend a substantial amount of time on administrative tasks e.g., marketing, billing, customer inquiries, quotes, etc. These activities may be less interesting for someone who prefers to focus on academic content.
Hope this was helpful? If your friend is interested in joining a company, please ask him to check out my firm, JournalEdit (www.journaledit.com). We're always looking for experienced editors to join our network. Email CV/Resume to support@journaledit.com
  • asked a question related to Proofreading
Question
19 answers
What is a helpful tactic for evaluating the quality of your academic writing from the perspective of the reader? and what are the main elements to be assessed while proofreading your final draft?
Relevant answer
Answer
Sarmad - academic writing follows a number of 'standard' conventions that witers are advised to follow routinely. They are mainly based around structure. The standard structure is an introduction that identifies the scene-setting context of the main topic and identifies the main objectives of the written piece. That then leads into the 'main body' of the article. The conclusion/summary - which further articulates, explores and expands on the introductory context throuhg a more critical appraisal of the existing literaure. This involves a critical integration of the literature to support observations and claims. This is through critical comparioson, debate, analysis and sythesis of the material - which should be logical and sequential as it progresses. The article should flow well and be well sign-posted with appropriate headings. The main things to avoid in the main body centre on 'pure description' i.e. just using cited literature to 'say what things are and what they do' without critical reflection. Under or over-citation add to this - as do other structural issues such as the over-use of direct quotation, bullet points, lists etc. The main body is followed by the concluding summary which is a critical evaluation of the main outcomes arising from the main text. You did mention proof-reading as well. It's imporatnt that the final 'touch' is an accurate proof-reading to avoid typos, grammatical errors etc.
  • asked a question related to Proofreading
Question
6 answers
Generally it is advised to use T4 DNA polymerase to generate overhangs in Ligation Independent Cloning (LIC). Since both these enzymes (Phusion and T4 polymerase) have 3`->5` exonulcease proofreading activity, can we use Phusion polymerase instead of T4 DNA polymerase.
Relevant answer
Answer
Dear Anshuman
U can use phusion for LIC but you have to optimize the protocol.
  • asked a question related to Proofreading
Question
6 answers
Dear Researchers, 
I have confused on this ? 
What are differences among Language Editing, Proofreading and Copy Editing ?Are they used interchangeably ? any clear lines among them ? 
Please advice. 
Thanks 
Relevant answer
Answer
  1. In English Language editing, the editor merely fixes grammar, spelling and by extension punctuation and capitalization errors, to present better English.
  2. Proofreading used to be a check that the handwritten manuscript had been correctly typed. Today proofreading will check that the fonts are correctly used, and that the pages are numbered. The proofreading would also check that figures and tables are correctly referred to in the text, and that all figures are clear and legible.
  3. Copy editing polishes the text to make it more readable. For example, two adjacent headings at different levels, with no introductory text could have obvious introducing text written and inserted. Furthermore, copy editing would e.g., look for and try to fix any errors in the citations. Page breaks could be improved.
None of the above activities is allowed to add any intellectual input. Any ambiguities must be referred back to the author for resolution.
  • asked a question related to Proofreading
Question
5 answers
In my working experience, many authors write to change their funding project names after the paper is accepted or during the proofread and formal publication period. 
To this phenomenon, what are  your comments and suggestions?
Relevant answer
Answer
Dunlian,
Your question of " whether the authors arbitrarily delete or add fund names are misbehavior" seems like a clear-cut question of ethics. No one should "arbitrarily" do anything in a publication for a scientific journal.
  • asked a question related to Proofreading
Question
20 answers
Authors whose native language is not English are advised to seek an advice of a native English speaker, before submitting their manuscripts. There are many associations, which do it for money. Do you have any experience? Do you know any web site with an individual offer?
I personally was working only with the American Manuscript Editors. It is quite good association. They take $0.03 per word (a number of word from MS Word). The price isn't so high, but if the salary is $800 - $900, it is quite a lot of money (average bill is $100 - $150).
Relevant answer
Answer
Have a look at REF-N-WRITE scientific paper writing tool. This tool allows you to import text from previous papers relevant to the subject area in MS word. While you are writing your paper, you can just search for similar statements from other authors and inherit their vocabulary and language to improve your paper. It also comes with a library of academic phrases that you can readily use to polish your paper. Here is the link for the site.
They have some nice tutorials here.
  • asked a question related to Proofreading
Question
36 answers
Any suggestions are appreciated.
Thanks in advance.
Relevant answer
Answer
What are the practical and effective ways of getting scientific papers proofread?
If you are pursuing your postgraduate or research study, you can seek help from your supervisor / adviser, professor(s) who are the subject matter expert in your research area.
If you are in academia or completed your research degree, you can seek help from peers, colleagues or even article reviewers that you might get in touch with through certain networking.
You can also consider ResearchGate, Academia.edu etc. members since their profile & published papers are visible in the websites for your reference.
After receiving feedback from proof readers - go through their comments with open mind, change / improve if needed, perform further literature review or seek 2nd opinion if you are not sure etc.  Wishing you all the best.
  • asked a question related to Proofreading
Question
10 answers
Are those free online software's editing, proofreading services for scientific manuscripts truth worthy enough? Formatting of the paper would be an added value service. What about the confidentiality factor? I need info on the latest actual updates. Thanks in advance. 
Relevant answer
Answer
Thanks, Jenny Triggs. 
  • asked a question related to Proofreading
Question
3 answers
I need English proof reading for my Arabic computational linguistics research, about 80 pages, it's English text with Arabic linguistics terms, a job not for free
Relevant answer
Answer
I am willing if you provide me with more info. 
  • asked a question related to Proofreading
Question
3 answers
What is the importance of proofreading a document on screen for online readers? 
Is it the same as proofreading a hand-written document? 
What are the differences in the eyes of the readers reading on screen and the ones reading off screen? Do they end with having different perspectives?
Is it easier to detect errors in a document presented online for online readers than detecting errors on a paper?
Relevant answer
Answer
I agree with Jeremy. It largely depends on personal preference and the methodology of the individual to proof-read.   Like Jeremy I too find it easier in printed material rather than on-screen.
  • asked a question related to Proofreading
Question
3 answers
gRNA kits say to "linearise" the plasmid containing your promoter+gRNA right after the termination signal. I was wondering whats the point of having the whole backbone there?. Cant you just cut at each side of your cassette (Promoter+gRNA) and electroporate that into your cells? Some of these kits say to use 4ug of template per reaction which it sounds to me like a lot. In addition, 4ug of a 10kb linearised vector containing your Promoter+gRNA wont be the same as transfecting 500bp of promoter+gRNA (i.e. without backbone). If you can cut at each side of your cassette and use this for synthesis cant you probably get away with using 1ug only or less?
On a different note, could you PCR with a proofreading polymerase your promoter+guides and transfect that? I find much easier to get large amounts of DNA this way. My only worry is that not 100% of the copies will be error free and if you are doing point mutation genome editing you may want to use a plasmid?
Any thoughts with these questions would be highly appreciated.
cheers
Relevant answer
Answer
Hi Dmitry, 
Many thanks for your response. Hope you don't mind me asking, but I was wondering if you know roughly how much space do you leave? is 10bp ok? or are we taking on the 100s? 
I find when I digest from my 14kb plasmid the 300bp worth of promoters driving 2 gRNAs that my 300bp band is very very faint, even when I carry out a digestion with 3ug DNA. I have done this same digestion in 2-3 large lanes and pooled the DNA for gel purification but I find this amount is very unlikely to be enough for the RNA synthesis reaction which recommends using ~4ug DNA template. However, I wonder if 500ng of 300bp fragment would be just as good as using 4ug of the linearised plasmid given the difference in size. Has anyone tried this?
  • asked a question related to Proofreading
Question
6 answers
Hello!
I am trying to sequence (Miseq) a custom amplicon from many samples using the Nextera indexes. For those of you not familiar, this involves a two step PCR protocol. The first round of PCR is carried out with your custom primers that have 5' overhangs complementary to the nextera indexes. The second round of PCR adds the indexes and adapters. The issue I am having is that my primer set contains inosine and so I can only get amplification using a Taq polymerase (Accuprime Taq in my case). This leaves my 1st PCR product with 3' A overhangs and I am not sure how this will effect the 2nd PCR step.
If I use a proofreading enzyme in the 2nd step, will this remove the 3' A's or do I need to include a specific step in my protocol to blunt my 1st round amplicons?
Could I accomplish blunting by using a proofreading polymerase and including a 72 degree incubation before the initial denaturing step in my 2nd round of PCR? Do I need to do a specific blunting step and then an additional PCR cleanup before round 2 of PCR?
Thanks!
Relevant answer
Answer
Hi Julian,
I agree with Petre. The a overhangs should have no impact in the end. You can go about as planned. Once you do the second round of amplification, introducing the indexes, the new amplicons will not contain the 3' overhangs as as these are not included in the indexing primers.
Cheers,
Vegard
  • asked a question related to Proofreading
Question
27 answers
I have written research articles and sending them in reputed research journals but came back with remarks for English language, and they often say to get it checked by a native English speaker. I request some native English speakers to correct the English of my articles, and I include your name as co-author in articles.
I wish that the person should belongs to academic fraternity, not a compulsion.
My area of research is marketing and tourism.
Relevant answer
Answer
My advice is to post this message on LinkedIn as well - check relevant social science groups or post it directly via your profile to all contacts in your network - there are a lot of professionals who can help you. Similarly, there are social science groups on Facebook but I can't give you specific suggestions except Routledge tourism section http://www.routledge.com/tourism/
Alternatively, try to find a mentor at AuthorAid http://www.authoraid.info/en/mentoring/
and World Library of Science http://www.nature.com/wls/people
I don't know how efficient and fast the process is but I hope it works.
  • asked a question related to Proofreading
Question
8 answers
I have a paper ready to go.
Relevant answer
Answer
I am sure you have found an editor by now. However, I am a manager at EvelynBen Scientific Editing and we would be happy to edit your future manuscripts. Our editorial team is largely composed of active senior scientists in academia and industry, department heads, academic program directors and tenured or tenure-track professors. A significant proportion of our editors also sit on the editorial boards of top-tier or specialized journals.
Please let us know if we can be of service.
Jessica Ward