Plant Transformation - Science topic

The cell color appears normal, with a slight pink hue, which is perfectly fine!

Yes, genomic clones can be expressed in plants. Sometimes there are important regulatory elements in introns so you sometimes need to include them for proper expression. I only know of doing plant genes in plants with this approach (not from another organism).

here is an example of a large gene where a YFP fusion was made which included the first intron of the gene of interest

Myosin XIK of Arabidopsis thaliana Accumulates at the Root Hair Tip and Is Required for Fast Root Hair Growth (nih.gov)

How can I get CMS sources to use in my program

J.D. Franco-Navarro

Isn't callus-forming mainly due to phytohormones we add inside the medium, less to do with Agrobacterium per se? (I need to check out more)

[1]

Have you tried *In Planta* transformation? It has been successfully used on Citrus species [1]. It seems to be much easier. No tissue-culturing is needed. You grow young seedling from seeds. Cut the stem, add Agrobacterium to the wounds, co-cultivation for a length of time, clean, then add antibiotic and wait for shoots ("transgenic") to come out. (see attached Figure from [1]).

[1]

Thank you.

Yes, here:

Suja George In fluorescence microscopy, the lamp intensity and exposure time are the most critical parameters one should look at. If you use either higher lamp intensity (50% or more) or longer exposure time (> 1 sec), then probably you will see fluorescence everywhere. This is due to presence of flavonoids and other reductive compounds present in the cell that shows autofluorescence.

You should define the parameter in your case, try lamp intensity of 12-25% and exposure time 200-500 ms, under these conditions you would see the fluorescence only in transformed variety and not in the control lines.

Hi Christopher, the following are links for Silwet. The product name is Silwet L-77, and it is very effective. Silwet-70 may be a typo.

Hi Bipasha,

Please first ensure that your vector is properly digested or not from both the enzymes? In that case, Add each component in your ligation reaction except the insert. This will serve as the control. If you are getting more colonies in insert free ligation control then your vector is not properly digested with one of the enzymes. I recommend for sequential digestion.

Hi. Dear sir. It will be very easy to solve your problem by referring to the professor T.A. Brown gene and genome book.

This shows how easily you can go deep into theory to explain something, when actually one of more of your measuring instruments is simply totally wrong and giving meaningless readings. I feel sure that if the RIS are working properly you won't get this effect at all.

Very good and true remark! Working in biotechnologies I’ve often encountered the same problem, i.e. the impossibility of obtaining reproducible results of my own experiments, carried on by the same people, keeping strictly the same process conditions and quantities of materials taken with high precision. Furthermore, duplicate or triplicate samples in simultaneous experiments give very different results. This has happened to me since I work with biochemical, fermentation processes, involving living matter, bacteria, plant and animal biomass, active sludge. For comparison, when I worked with chemical processes (synthesis), the repetability and reproducibility of the results was very high. My explanation is that the biochemical processes are much more complex, dynamic, rather unpredictable, and the biological factor is responsible for the poor reproducibility. Bacteria and living matter generally work by complex mechanisms that involve very different biochemical pathways, specific enzyme and high instability even for the same conversion process. Often it is not possible to know exactly which product will be obtained, on what biochemical pathway, under what environmental conditions and at what time in two identical experiments involving bacterial metabolism. Although as a whole, even in detail, science has made tremendous progress, it seems that living matter has its strict information that does not allow us to fully control it. This is an explanation in the lack of explanation...

Hi , this website might want to contact them , they make plasmids according to order.

Thanks, Dear Kamal Kumar. It is helpful.

I would use normal PCR to check for the presence of your insert in your potentially transformed plants. It's very common to have epigenetic silencing of transgenes (as you mentioned), but the integrated DNA will always show up with normal PCR. Just remember to include a full set of controls. Good luck!

I am not sure what you mean by "any difference;" However, just to illustrate the two strategy:

1) If the two transgenes are transferred using one contruct, then the two transgenes will be integrated in one locus within the genome of the target plant. The two transgenes will act as a single locus and will be sexually transmissible to the next generation as a single entity (a single block). Therefore, the two transgenes will be inherited together.

2) If the two transgenes are transferred using two different contructs, then the two will probably be integrated independently in two different locus within the genome of the target plant. The two transgenes will act as an independent loci and will be sexually transmissible to the next generation as two entities (two different loci). Therefore, the two transgenes will be inherited independently and part of the progeny population may inherit the first transgene, others may inherit the second transgene, and the other may inherit both.

how to ensure the purity of apoplastic fluid

Hi Camila,

you got already very valid suggestions from other researchers.

However, the number of reference genes that you will use depends a lot on your organism too. I do not work with plants, but for my experiments it was impossible to go for one reference gene alone... I tested many of them, spending a large amount of time, but I could not find any RG stable enough to stand alone. Therefore I went for 2/3 RG.

I also like to test at least 6 or 7 reference genes before deciding on which to use... it takes quite a large amount of time, but it makes your work more solid and it will be less stress once you try to publish your results (I can attest that almost all reviewers will question if you followed the MIQE guidelines!).

Hope it helps!

Infiltration is a different animal than stable transformation. Although there are certainly a few common mechanisms functioning, such as silencing, there are also some important distinctions. When you select stable transformants, you will be using a selecting for transformation events that express. Silenced events would die. The copy number is vastly greater for infiltration, which will then elicit silencing more strongly. In my opinion, you will get expressing stable transformation events without co-expressing P19. If you want to ensure that you get some useful events, I would consider using at least a couple of different promoters for your GOI and ensuring that you have no repetitive elements in your transformation constructs (e.g. don't use the same promoter or polyA site for your GOI and your selection marker).

1) Plant seeds at high density on regular soil mix 2) Stratify for 4 days if seeds are freshly harvested and dried. 3) When you put them to the green house spray trays with 500 ml / square meter of a diluted commercial Basta/ Liberty solution at 0.25 g/ l. Use the regular Basta from Hoechst (yellow bottles, which contains 200 g/ l glufosinate-ammonium, isomer mixture); in the US get Liberty which, however, may contain another concentration of glufosinate. 4) Repeat spraying 2-3 times every 8-10 days until most of the germinated seedlings are dying (yellowing of cotyledons, drying) and a few plants stay green 5) Harvest seeds from surviving primary transformants. 6) Segegration analysis of resistance can be done in the same way if you plant seeds on soil and count the number of surviving germinated seedlings. "Basta" selection on agar plates: use 25 ug/ml phosphinotricin (pure, not the isomer mixture used in the commercial formulation). You may add it before autoclaving because it is rather heat stabile. I was told (and therefore never did that) that it is not wise to use the formulated stuff when autoclaving because it would start foaming (the info was from Hoechst people). However you might try to add it after autoclaving at a concentration corresponing to 25 ug/ml,

i.e.up to 50 ug/ ml Basta

Hello Dr. Álamos,

Could you kindly provide the full title of the Sugita et al 2014? We are quite interested in this protocol, however the search is fruitless.

Thank you in advance.

Sincerely,

Liu

Dear Casimiro

I suggest you read the link below to get your answer

Differences in integration sites will put your cassette in a different regulatory context in each transgenic line. Since your Gene A and Gene B face in opposite directions, they can be differently regulated by local regulatory elements in the genome. Also, you can get methylation of your cassette after integration, which will down-regulate expression. Depending on the integration method, you can also get truncation of your cassette, which will reduce expression of just Gene A or just Gene B or both. Map and sequence your inserted cassettes to get a better explanation (if it matters). Or just screen more lines until you get several with the expression pattern you need for your project.

This abstract doesn't give any finding. it gives only suggestion about new methodology about gene transfering. the abstract needs key points about new methodology (why we are prefare, what will be happen when we use more than two Cry genes etc.)

it is still interesting subject. the review will get more attention.

Except some model plants (ex. Arabidopsis), most plant genetic transformation with Agrobacterium are performed with tissue-culture methods. The sterile tissue-culturing medium environment is already encourage the occurrence of  somaclonal variation (SV) for explants such as callus, without even the infection of Agrobacterium. The infection of Agro can further stress the explants and induce more SV. However, I think it will be hard to determine which SV is due to environments and which are due to Agro infection.

I partly disagree with the answer by Liu (respectfully). To my knowledge sugar is neither a nutrient nor a osmoprotectant in infiltration experiment but was shown a long time ago to have the capacity to trigger vir genes synergistically with phenolics (in fact our lab systematically uses both in our dipping solution). 

Here is the reference of the original publication.

Proc Natl Acad Sci U S A. 1990 Sep;87(17):6708-12.

Sugars induce the Agrobacterium virulence genes through a periplasmic binding protein and a transmembrane signal protein.

Cangelosi GA1, Ankenbauer RG, Nester EW.

 I did get it, thanks! A professor here in Mexico was kind enough to share some with me. Do you need some Paz Estefanía?

Good question and nice discussion. Finding a homozygous transgenic plant while working with crop plants expressing gene of interest is more challenging as far as time is concerned. I endorse qPCR is helpful in this regard as mentioned in article from Israelian fellow researchers. 

 Thank you sir

The target of Kanamycin in prokaryotes is the ribosome. In plants, Kanamycin's target is the chloroplast ribosomes, which are very similar to prokaryotic ribosomes.

Are you germinating the seeds so that you will have actively growing cells? Have you added acetosyringone to induce the vir operon?

I read your attached paper. Their plant is not tomato.

They used 100 mM AS to infect the cotyledon (they germinated the seeds to obtain the cotyledons, then, used the cotyledon as explants for infection in a 'transient assay' (see the yellow highlights, p409). I see nothing wrong with it.

Is this paper you indented to attach?

1. Different plant species might have their own preferred 'selection agents'.

2. BASTA is a herbicide, Hygromycin B is an antibiotic.

3. You need a 'bar' gene in your vector to resist BASTA; while you need a hygromycin-resistant gene ('hyg') in your vector to resist hygromycin.

4. Yes, you need to replace the gene in your vector to resist either BASTA or hygromycin.

1. In which step you need to added MgC₂? Can I take a look at the protocol?

2. You mentioned that "However it did not work very well. Have you experience with acetosyringone?" in your last post.

Acetosyringone which increases transformation frequency has been reported in Agrobacterium rhizogenes-mediated genetic transformation. From the attached paper, it shows results of transformation frequencies between 'using Acetosyringone' vs. 'without using Acetosyringone' (yellow highlights and Table 3). The results were very obvious, especially when the leaves were used as explants. In the paper, it also shows that the incubation time of the explants and Acetosyringone is a important factor as well.

When you said "it did not work very well", what did you mean by that? No-to-low transformation frequencies? This could be also caused by other steps of the transformation protocol, not necessary Acetosyringone. The effect of acetosyringone on ifferent plant varieties could also end up different results.

Thank you sir, But long back i have successfully transformed this same construct to BL21(DE3) and got expression, that i have checked it in SDS PAGE. Now i wanted to repeat this, But i am not getting colonies after transformation, 

yea, i think so. I usually confirm the size of insert segments by PCR and then sequencing them (about 5 clones) to find the right clone.

It may not be published on the 'web, assuming that the "pBISN1-IN" sequence at ncbi linked here is different. If you could find the parent vector sequence and have the software, you could potentially reconstruct the putative sequence using the original paper here. I used to do that in the old days (1990's) in order to work with vectors that I obtained from labs that didn't have a full-length sequence.

Good luck.

Hi Anirban, you are right - in most cases the blotting is to avoid an excess of agrobacteria in order to reduce the occurance of overgrowth. If you don't have that problem, than you could (probably, but see below) skip this step. We also played around with this a bit. For our in vitro systems it looks like some explant types also don't "like" an excess of liquid on the surfaces. For them, excess liquid medium (even without bacteria) tends to reduce regeneration efficiency (stress?, gas exchange?). You would probably have to check that for your species/explants/regeneration systems.

As to your problem with necrosis - we also encountered such reactions on occasion. In our experience, there were two reasons for this. First, some plant species react rather strongly to certain agrobacterium strains - almost like a hypersensitive reaction. In our case, we had to switch from a hypervirulent strain (EHA105) to a "normal" one (LBA4404), as EHA105 caused increased cell death and a MUCH reduced regeneration rate (ergo, transformation rate was also down). Second, we found that while hygromycin is a very efficient selection agent for many species in our hands, it doesn't work for other species. For some species, we could not establish a regeneration system even when using hygromycin at very low concentrations. There, we had to switch back to kanamycin - which worked just fine although with a higher number of escapes due to the "softer" selection.

As for the temperature - we do the co-culture at the temperatures optimal for the plants/explants. Higher temperatures will most likely cause more stress in your plants which could rdeuce regeneration. Agrobacteria, on the other hand, do grow quite nicely at lower temperatures. If the transformation rate is too low you could try to increase co-culture duration.

Hope that helps,

Klaus

your uncut sample is very suspicious and interesting!!!! you have bands of 1.4 and 2.5kb in all samples as in your uncut! 1.4 is sharp in all of them and 2.5 faint! how can it be existing without digestion ofcourse if your plasmid is ok ..

strongly I believe you have contamination in your extracted plasmid... having those unwanted bands in your UC means that they are already existing in your plasmid! it has been contaminated by your extraction kit or water or some where else... ONLY after digestion by XhoI you have your desired band of 14 kb linearized vector (I hope there is only one site of XhoI and that is the linear band of 14kb) so change your extraction buffer or conduct another extraction and bacteria using the same kit to check your extraction kit components... 

also check the digestion manuscript of the enzymes to avoid partial digestion or star activity of the enzymes for the digestion of the 1-4 lanes...

so as conclusion from my point of view you have bands of 1.4 and 2.5 because of the contamination and other bands because of the unsuccessful digestion...

Hi Prithwi,

The question is kind of vague. Do you mean several T-DNA cassettes in the same binary vector? I am not so sure about the meaning of "multiple insertion" (in a vector) in your question.

Dear Dr. Mayavan,

Greetings, thank you for your questions. Their are several groups did research on it. You could check the paper and the crop of interest as the response differ from monocotyledon and dicotyledon 

Also, their are some company can sell it.

with best regards

Khaled

Hi Yehia,

You can prepare your plasmids as following for sending:

1. Prepare a small clean 'filter membrane'

2. Drop 3-5 uL of your plasmid (vector) on the filter membrane.

3. Take a pencil to mark (make a circle) where the 'drop' is (because after it dries, you will not see anything).

4. Wait for it to dry

5. Wrap the membrane with parafilm.

6. Now, it is ready to send (remember to write a note about the info of this vector).

After it arrives, Valeria can cut out the 'drop' and place it into TE buffer in a 1.5 mL tube to retract the vector into the buffer. The plasmid should be retransformed into competent cells to isolate a new batch of it for downstream experiment.

Hey Zeinab, unfortunately PFU polymerase will not give any 3'A overhangs, which is crucial for the TA cloning. I think you could proceed with the A tailing treatment.

This protocol is taken from the NEB about A-Tailing with Taq Polymerase.

This protocol can be used to add As to the blunt-ends of DNA fragments that have been amplified using a high-fidelity polymerase (such as Q5® High Fidelity DNA Polymerase).

You can refer here https://www.neb.com/protocols/2013/11/01/a-tailing-with-taq-polymerase

Dear Liker! I think u might get a completely new gene product if the upstream Kozak sequence comes in to function and your intended Kozak sequence might now be acting as a coding sequence in the undesired ORF of upstream KOzak.

Hello, I have this sequence for my PH7WG:

agctctcccatatggtcgacctgcaggcggccgcactagtgatatcacaagtttgtacaaaaaagctgaacgagaaacgt

aaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacataatactgtaaaacacaacatatc

cagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagt

taggatccggcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatc

ccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggata

ttacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatg

aatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgt

tttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatatt

cgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagcc

aatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatggg

caaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtctgtgatggcttccatg

tcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaacgcgtggatccggcttacta

aaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtat

gtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatat

gatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcgga

aaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacagggactggtgaa

atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacac

gcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtgg

tgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtg

gctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctccct

tatacacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgc

aaaatctaatttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgatatcccg

cggccatgctagagtccgcaaaaatcaccagtctctctctacaaatctatctctctctatttttctccagaataatgtgt

gagtagttcccagataagggaattagggttcttatagggtttcgctcatgtgttgagcatataagaaacccttagtatgt

atttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtgacctgcaggcatgcgacg

tcgggccctctagaggatccccgggtaccgcgaattatcgatcatgagcggagcaattaagggagtcacgttatgacccc

gccgatgacgcgggacaagccgttttacgtttggaactgacagaaccgcaacgttgaaggagccactgagccgcgggttt

ctggagtttaatgagctaagcacatacgtcagaaaccattattgcgcgttcaaaagtcgcctaaggtcactatcagctag

caaatatttcttgtcaaaaatgctccactgacgttccataaattcccctcggtatccaattagagtctcatattcactct

caactcgaatcccccctatgaaaaagcctgaactcaccgcgacgtctgtcgagaagtttctgatcgaaaagttcgacagc

gtctccgacctgatgcagctctcggagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcct

gcgggtaaatagctgcgccgatggtttctacaaagatcgttatgtttatcggcactttgcatcggccgcgctcccgattc

cggaagtgcttgacattggggagttcagcgagagcctgacctattgcatctcccgccgtgcacagggtgtcacgttgcaa

gacctgcctgaaaccgaactgcccgctgttcttcagccggtcgcggaggctatggatgctatcgctgcggccgatcttag

ccagacgagcgggttcggcccattcggaccgcaaggaatcggtcaatacactacatggcgtgatttcatatgcgcgattg

ctgatccccatgtgtatcactggcaaactgtgatggacgacaccgtcagtgcgtccgtcgcgcaggctctcgatgagctg

atgctttgggcgaggactgccccgaagtccggcactcgtgcacgcggattcggctccaacaatgtcctgacggacaatgg

ccgcataacagcggtcattgactggagcgaggcgatgttcggggattcccaatacgaggtcgccaacatcttcttctgga

ggccgtggttggcttgtatggagcagcagacgcgctacttcgagcggaggcatccggagcttgcaggatcgccaaggctc

cgggcgtatatgctccgcattggtcttgaccaactctatcagagcttggttgacggcaatttcgatgatgcagcttgggc

gcagggtcgatgcgacgcaatcgtccgatccggagccgggactgtcgggcgtacacaaatcgcccgcagaagcgcggccg

tctggaccgatggctgtgtagaagtactcgccgatagtggaaaccgacgccccagcactcgtccgagggcaaaggaatag

agtagatgccgaccgaacaagagctgatttcgagaacgcctcagccagcaactcgcgcgagcctagcaaggcaaatgcga

gagaacggccttacgcttggtggcacagttctcgtccacagttcgctaagctcgctcggctgggtcgcgggagggccggt

cgcagtgattcaggaattaattccctagagtcaagcagatcgttcaaacatttggcaataaagtttcttaagattgaatc

ctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatg

acgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcg

cgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgaccggcatgcaagctgataattcaattcg

gcgttaattcagtacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatat

cctgccaccagccagccaacagctccccgaccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtcc

gggacggcgtcagcgggagagccgttgtaaggcggcagactttgctcatgttaccgatgctattcggaagaacggcaact

aagctgccgggtttgaaacacggatgatctcgcggagggtagcatgttgattgtaacgatgacagagcgttgctgcctgt

gatcaattcgggcacgaacccagtggacataagcctcgttcggttcgtaagctgtaatgcaagtagcgtaactgccgtca

cgcaactggtccagaaccttgaccgaacgcagcggtggtaacggcgcagtggcggttttcatggcttcttgttatgacat

gtttttttggggtacagtctatgcctcgggcatccaagcagcaagcgcgttacgccgtgggtcgatgtttgatgttatgg

agcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaaacatcatgggggaagcggtgatcgccgaagt

atcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggct

ccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacg

cggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcac

cattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatg

acattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagc

gttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaac

cttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtaca

gcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagccc

gtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatt

tgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctagctagaaattcgttcaagccgacgccgc

ttcgccggcgttaactcaagcgattagatgcactaagcacataattgctcacagccaaactatcaggtcaagtctgcttt

tattatttttaagcgtgcataataagccctacacaaattgggagatatatcatgcatgaccaaaatcccttaacgtgagt

tttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgc

tgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggt

aactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctg

tagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccggg

ttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttgga

gcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcgg

acaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttat

agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaa

cgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctg

attctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtca

gtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtg

cactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggc

tgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctg

tgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagggtgccttgatgtgg

gcgccggcggtcgagtggcgacggcgcggcttgtccgcgccctggtagattgcctggccgtaggccagccatttttgagc

ggccagcggccgcgataggccgacgcgaagcggcggggcgtagggagcgcagcgaccgaagggtaggcgctttttgcagc

tcttcggctgtgcgctggccagacagttatgcacaggccaggcgggttttaagagttttaataagttttaaagagtttta

ggcggaaaaatcgccttttttctcttttatatcagtcacttacatgtgtgaccggttcccaatgtacggctttgggttcc

caatgtacgggttccggttcccaatgtacggctttgggttcccaatgtacgtgctatccacaggaaagagaccttttcga

cctttttcccctgctagggcaatttgccctagcatctgctccgtacattaggaaccggcggatgcttcgccctcgatcag

gttgcggtagcgcatgactaggatcgggccagcctgccccgcctcctccttcaaatcgtactccggcaggtcatttgacc

cgatcagcttgcgcacggtgaaacagaacttcttgaactctccggcgctgccactgcgttcgtagatcgtcttgaacaac

catctggcttctgccttgcctgcggcgcggcgtgccaggcggtagagaaaacggccgatgccgggatcgatcaaaaagta

atcggggtgaaccgtcagcacgtccgggttcttgccttctgtgatctcgcggtacatccaatcagctagctcgatctcga

tgtactccggccgcccggtttcgctctttacgatcttgtagcggctaatcaaggcttcaccctcggataccgtcaccagg

cggccgttcttggccttcttcgtacgctgcatggcaacgtgcgtggtgtttaaccgaatgcaggtttctaccaggtcgtc

tttctgctttccgccatcggctcgccggcagaacttgagtacgtccgcaacgtgtggacggaacacgcggccgggcttgt

ctcccttcccttcccggtatcggttcatggattcggttagatgggaaaccgccatcagtaccaggtcgtaatcccacaca

ctggccatgccggccggccctgcggaaacctctacgtgcccgtctggaagctcgtagcggatcacctcgccagctcgtcg

gtcacgcttcgacagacggaaaacggccacgtccatgatgctgcgactatcgcgggtgcccacgtcatagagcatcggaa

cgaaaaaatctggttgctcgtcgcccttgggcggcttcctaatcgacggcgcaccggctgccggcggttgccgggattct

ttgcggattcgatcagcggccgcttgccacgattcaccggggcgtgcttctgcctcgatgcgttgccgctgggcggcctg

cgcggccttcaacttctccaccaggtcatcacccagcgccgcgccgatttgtaccgggccggatggtttgcgaccgtcac

gccgattcctcgggcttgggggttccagtgccattgcagggccggcagacaacccagccgcttacgcctggccaaccgcc

cgttcctccacacatggggcattccacggcgtcggtgcctggttgttcttgattttccatgccgcctcctttagccgcta

aaattcatctactcatttattcatttgctcatttactctggtagctgcgcgatgtattcagatagcagctcggtaatggt

cttgccttggcgtaccgcgtacatcttcagcttggtgtgatcctccgccggcaactgaaagttgacccgcttcatggctg

gcgtgtctgccaggctggccaacgttgcagccttgctgctgcgtgcgctcggacggccggcacttagcgtgtttgtgctt

ttgctcattttctctttacctcattaactcaaatgagttttgatttaatttcagcggccagcgcctggacctcgcgggca

gcgtcgccctcgggttctgattcaagaacggttgtgccggcggcggcagtgcctgggtagctcacgcgctgcgtgatacg

ggactcaagaatgggcagctcgtacccggccagcgcctcggcaacctcaccgccgatgcgcgtgcctttgatcgcccgcg

acacgacaaaggccgcttgtagccttccatccgtgacctcaatgcgctgcttaaccagctccaccaggtcggcggtggcc

catatgtcgtaagggcttggctgcaccggaatcagcacgaagtcggctgccttgatcgcggacacagccaagtccgccgc

ctggggcgctccgtcgatcactacgaagtcgcgccggccgatggccttcacgtcgcggtcaatcgtcgggcggtcgatgc

cgacaacggttagcggttgatcttcccgcacggccgcccaatcgcgggcactgccctggggatcggaatcgactaacaga

acatcggccccggcgagttgcagggcgcgggctagatgggttgcgatggtcgtcttgcctgacccgcctttctggttaag

tacagcgataaccttcatgcgttccccttgcgtatttgtttatttactcatcgcatcatatacgcagcgaccgcatgacg

caagctgttttactcaaatacacatcacctttttagacggcggcgctcggtttcttcagcggccaagctggccggccagg

ccgccagcttggcatcagacaaaccggccaggatttcatgcagccgcacggttgagacgtgcgcgggcggctcgaacacg

tacccggccgcgatcatctccgcctcgatctcttcggtaatgaaaaacggttcgtcctggccgtcctggtgcggtttcat

gcttgttcctcttggcgttcattctcggcggccgccagggcgtcggcctcggtcaatgcgtcctcacggaaggcaccgcg

ccgcctggcctcggtgggcgtcacttcctcgctgcgctcaagtgcgcggtacagggtcgagcgatgcacgccaagcagtg

cagccgcctctttcacggtgcggccttcctggtcgatcagctcgcgggcgtgcgcgatctgtgccggggtgagggtaggg

cgggggccaaacttcacgcctcgggccttggcggcctcgcgcccgctccgggtgcggtcgatgattagggaacgctcgaa

ctcggcaatgccggcgaacacggtcaacaccatgcggccggccggcgtggtggtgtcggcccacggctctgccaggctac

gcaggcccgcgccggcctcctggatgcgctcggcaatgtccagtaggtcgcgggtgctgcgggccaggcggtctagcctg

gtcactgtcacaacgtcgccagggcgtaggtggtcaagcatcctggccagctccgggcggtcgcgcctggtgccggtgat

cttctcggaaaacagcttggtgcagccggccgcgtgcagttcggcccgttggttggtcaagtcctggtcgtcggtgctga

cgcgggcatagcccagcaggccagcggcggcgctcttgttcatggcgtaatgtctccggttctagtcgcaagtattctac

tttatgcgactaaaacacgcgacaagaaaacgccaggaaaagggcagggcggcagcctgtcgcgtaacttaggacttgtg

cgacatgtcgttttcagaagacggctgcactgaacgtcagaagccgactgcactatagcagcggaggggttggatcaaag

tactttaaagtactttaaagtactttaaagtactttgatcccgaggggaaccctgtggttggcatgcacatacaaatgga

cgaacggataaaccttttcacgcccttttaaatatccgttattctaataaacgctcttttctcttaggtttacccgccaa

tatatcctgtcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatccaagctcaagctaagcttg

Hi Shruti,

What did you mean by "the cells get lysed"? Did you mean that you observed many 'cloudy' string-like materials (look like the bacteria are dead) in the liquid medium after incubation. I saw this phenomenon quit often when I used LBA4404 for genetic transformation. If this is the case, stop using the commercial pre-mixed standard LB powder. Make your own LB liquid medium with the same 3 components, but use half of the amount for NaCl. I found that this change improves the situation a lot.

By the way, I tried couple of times using the Agrobacterial culture with 'cloudy' materials for transformation, and it worked. But I did not follow up its efficiency.

Hi Silvia,

I understand the need for you to standardize the vector/backbone that you wish to express your DNA constructs (genes/transgenes) from, and that is an excellent starting control for your experiment. If all the constructs in these various plasmids that you want are flanked by the same restriction enzyme sites, and these sites are available in the plasmid vector you wish to move them to, you would be able to "cut & paste" i.e. restrict and ligate the genes/transgenes you want into this particular vector.

This, however, is probably not going to be the case, and you might have to deal with the restriction sites you wish to use being present in the genes/transgenes you wish to move as well. This latter scenario might involve additional complications such as a "partial digest".

In this case, Sneha's suggestion to use PCR (with a high-fidelity DNA polymerase, not Taq) and amplify the individual constructs of interest with primers that come with restriction sites you wish to use. This will enable you to insert your constructs into the same position within the target vector you want, since distance from the promoter also influences the strength of expression (unless your genes/transgenes come with their own promoters).

There's a lot to consider here, but this should get you started.

Continuing to what Tamara and Eric have explained nicely above, I would like to add some suggestions. To determine whether the transgenic plants you have are homozygous or not, you need to do the "Progeny Test."

Lets assume that you have introduced (nptII + gene of interest) construct and you have single integration of the construct in all of the transgenic lines.To level the ground, I would define the following:

(1) The regenerated transgenic plants are named as T0 generation (T0 transgenic plants). The phenotype of the T0 transgenic plants is Kanamycin resistance (Kan R) and the genotype is hemyzygous (R/0).

(2) The plants grown from seeds, harvested from self pollinated T0 transgenic plants, are named as T1 generation (T1 plants). The phenotypes of the T1 plants are either Kanamycin resistance (Kan R) or Kanamycin sensitive (Kan r). The ratio of phenotype classes are Kan R : Kan r=3 : 1. The genotype of T1 plants will be mixtures of homozygous R/R (Kan R); hemizygous R/0 (Kan R); and homozygous r/r (Kan r). If the T1 seeds are grown on medium containing Kanamycin as Eric suggestion, we can eliminate the r/r (Kan r) individuals from the population.

(3) The plants grown from seeds, harvested from self pollinated T1 transgenic plants, are named as T2 generation (T2 plants). The phenotypes and the genotypes of T2 plants depend on the genotype of the T1 progenitor.

If the T1 progenitor is R/R - then the genotype of T2 plants will all be R/R and the phenotype will all be Kan R. If the T1 progenitor is R/0 - the genotype of T2 plants will be a mixture of R/R, R/0, and r/r (1:2:1) and the phenotype will be a mixture of Kan R and Kan r (3:1). If the T1 progenitor is r/r - the genotype of T2 plants will all be r/r and the phenotype will all be Kan r (but we have eliminated this by growing T1 seeds in medium containing Kan and growing only Kan R to maturity in soil)

Back to your question, if you grow 100 T2 seeds on medium containing Kanamycin (progeny test) and all T2 seedlings are Kan R then most probably the T1 parent of this T2 population is homozygous R/R. You can go back to this particular T2 seed lot and grow as many T2 plants as needed for your metabolomic evaluation.

If you grow 100 T2 seeds on medium containing Kanamycin (progeny test) and you see some Kan r - T2 seedlings, then most probably the T1 parent of this T2 population is hemyzygous R/0. You will not select this seed lot for your metabolomic evaluation.

Words of caution: the more number of integrated construct (multiple copy transgene integration) the more complex the segregation ratios between Kan R vs. Kan r in the progeny. Therefore, make sure you determine the copy number of construct integration in the genome by Southern Blotting first and select one that indicate single integration.

If you did not select for progenitor that are homozygous R/R, probably you will have mixtures of genotype in the progeny population (mixture of R/R; R/0; and r/r) which may probably affect recording of your metabolomic parameters.

Once you establish copy number integration in the T0 plant, you can skip molecular analysis in the T1 generation and just employ selection using media containing Kan, select only Kan R T1 progeny, and grow the T1 seedlings to maturity to harvest T2 seeds. Select T2 seed lots derived from homozygous R/R T1 plant based on progeny test as outline above.

Good luck...

How did you grow the bacteria? When you grow the bacteria on plate such that you should obtain single colonies you would need at least 2 days. When you streak out a colony or from -80C vial, you could see growth after O/N incubation where bacterial amount was highest. In liquid culture with small volume O/N incubation is enough to obtain good growth.

Ideally the entire sequence between the left and right borders is inserted.  However, partial inserts can and do happen, as do multiple insertions at one location, or multiple insertions at different locations.  You can use PCR amplification of the LB and RB to check if the entire T-DNA was inserted in your purchased lines. 

I dont germinate tomato on MS but on Nitsch.

Then they have to be kept in nearly dark for one week and then they grow very well. Under light.

Interessant idea from Jayson woth the taproot and all and the connection to phosphorus.

I suggest that you carry out your selection of the transgenic plants in plates of MS + Kanamycin, you need to germinated your seeds well spaced (50 seeds per plate) to avoid the overcrowding of the plantlets produced. After 10 days after germination you are going to see that the transgenic plants will be healthy and the non-transgenic will turn chlorotic.

Kanamycin needs to be absorbed by the roots the be effective and Basta works directly on leaves by the fact that this compounds give rise to a decrease in the pH of the thylakoid lumen to yield reactive oxygen species in this tissue.

Regards,

Yes. You can have a transgenic plant with histochemical GUS negative. A phenomenon called 'gene silencing'. This can be caused by 'position effect' (depending on where your transgene inserts) or multiple transgene insertion such as >2 transgenes in the same locus. This is a common phenomenon and problem for producing transgenic plants.

Hi,

The plasmid sequence:

A reference article:

The free software to create and annotate your plasmid map:

Cheers,

Ruben

The pSoup vector is a low copy vector in both E. coli and Agrobacterium -- so low plasmid yields are to be expected. I have also experienced some challenges with the Tetracycline resistance conferred by the pSoup vector.  It can be a little tricky, -- if the tetracycline level is to high -- you can't recover any colonies (and obviously if it is to low, everything grows). Recovering Tet resistant Agrobacterium with transformation of the pSoup vector alone can be done -- but you may need to find just the right level of antibiotic, in our experience that is usually about 5 ug/ml of Tetracycline (but this can depend on the Agrobacterium strain you use and media as suggested by David Oppenheimer -- concerning the Mg2+ concentration).  

Usually, my lab just performs co-transformation with the pSoup and pGreen vectors in one shot and then selects using only 50ug/ml kanamycin selection (we do not select with Tetracycline). This usually works just fine because the kanamycin selection is robust and pGreen cannot replicate in Agrobacterium without pSoup, (so recovering kanamycin resistant colonies is sufficient to select for co-transformation of both plasmids).  We use either heat shock or electroporation, and both can work fine (although electroporation typically will produce many more colonies due to higher efficiency).

Note, although tri-parental mating can be used for other binary vectors, I do not believe it works with the pGreen vector, because that vector lacks the necessary "tra" sequences for a successful mating transfer. 

There could be several reasons but you seed to indicate where you you want the insert to be since expression could be affected by position of insert of construct.

Hello Guojing,

Please use pART27 vector. Don't use Basta based transformation as it doesn't work in tomato. Submerge cotyledons from aseptically grown 8 day old seedlings of tomato

 for 5 min in cultures of Agrobacterium harboring the constructs, then cocultivate on solid basal medium  consisting of modified Murashige and Skoog salts and B5 vitamins supplemented with 3% (w/v) sucrose, 0.05 mg L1 indole-3-acetic acid, 1 mg L1 zeatin, and 100 μM acetosyringone. Maintain explants under light (30 μmol m2 s1, 16 h photoperiod) at 24 C for 48 h and transfer to termination regeneration medium [solid BM supplemented with 3% (w/v) sucrose, 0.05 mg L1 indole-3-acetic acid, 0.5 mg L1 zeatin, and 500 mg L1 cefotaxime] for 48 h. Then transfer explants to termination regeneration medium supplemented with 50 mg L1 kanamycin and maintain under light with transfer to fresh media every 3 weeks until fresh shoots are formed from callus ends. Transfer a single healthy shoot per explant to rooting media (BM with 500 mg L1 cefotaxime and 50 mg L1 kanamycin).  I have added our publication and we produced hundreds of transgenics using this method. Any details, please ask.

All the best!

Ranjith

"The transformed cells resistant to the antibiotic kanamycin remained vigorous whereas non-transformed cells were necrotised and died on selection medium"

This was one of our findings in our recent research.

The critical points could be:

1. Starin & Itslevel of response to selective marker

2. Infection time

3.Use of acetosyringone

4. Disinfectant used

5. Regenaration media used

6. Frequent changing of regenaration media during different level of growth

7. Photoperiod.

Hope this might be helpful.

Regards

NZ

Hi Marcin,

There are at least 2 ways we can narrow down the random insertion of transgenes in the genomes when doing plant genetic transformation.

1. Site-specific recombination (SSR) system- mediated gene integration. Most SSR systems derive from microbes or lower eukaryotes such as yeast. A transgene can be directed to a pre-determined 'landing-pad' (at a locus) through the site-specific recombination between a specific sequence on the landing pad and a specific sequence on a plasmid carrying your gene-of-interest. Please visit my profile for this topic.

2. Designer nuclease (such as ZFN, TALEN etc)- mediated gene integration at a specific locus through homologous recombination. Designer nucleases cause DNA double-stranded breaks (DSBs) at a specific locus. The cellular DSB repair systems will kick in to fix the break, including a homologous recombination (HR) mechanism. By providing a donor plasmid with your gene-of-interest, this gene can be integrated into the specific locus through HR.

Hi Tomas. I did use pCAMBIA for epidermal onion cells bombardment and it worked very well. I've never tried bombardment with a protoplast sampe but it doesn't seems to be best option for such a sensitive system.

Ciao Pasquale,

We did not have such a problem with transformed tomato plants (Published in: Brummell et al. Biofortification of Tomato Fruit with the Anticancer Compound Methylselenocysteine Using a Selenocysteine Methyltransferase from a Selenium Hyperaccumulator, J Agric. and Food Chemistry, 2011 59: 10987-20994) and we used agar as the solidifying agent. Other precautions you can take include: better ventilation of culture vessel, more frequent subculture and adding anti hyperhydricity agents such as EM2, gelling agents conyaining pectin or certain polysaccharides extracted from seaweeds. If you are using rich media, try lowering the concentration of major salts (e.g.half MS macro), try replacing ammonium with nitrate. I have noticed that water condensation on culture vessel also contributes to this condition, so vessels that allow better ventilation will help. If your rack gets heated at the bottom (often this happens when there is another set of lights below), you should raise the culture vessel, not allowing it to touch the surface by using a wire mesh for example. If you can maintain the bottom of vessel colder than top, water will condense on the agar, thus reducing hyperhydricity. By the way, science community now use the term hyperhydricity as against vitrification as the latter is now more and more used in cryopreservation, to supercool cytoplasm without ice crystal formation.

Grazie,

Ranjith

Hi, I have done this with many different plant sp and tissue types, mostly with Solanaceous plants, including many Nicotiana sp, solanum lycopersicum, solanum tuberosum and petunia sp. and other dicot plants like Arabidopsis and carrot, but I've also had success with various monocot sp. like rice sugarcane and sorghum.

Growth medium is also a factor that can aid agro bacterium growth, try cutting back the amount of sugar you add to the medium :)

Dear Ahmed,

Such truncations are often found on the LB region. Below I gave you some examples of reports indicating this fact.

You last sentence is not clear to me. If you meant that you found exactly the same truncation in 3 independent transgenic plants and they all are in the same plant locus, this is definitely novel. I doubt that this is what you meant. I find it still interesting that in 4 plant you analysed showed LB truncations. It would be important to check the LB sequence present in your vector and compared to the Ti Plasmid LB to see if only the 25bp border is used or there are 30-50 bp flanking sequence is also present. Perhaps these additional sequences might make the LB better protected, for example if they are bound by a protein effector or host factor.

This info is from Chapter 3 of the Book

AGROBACTERIUM AND PLANT BIOTECHNOLOGY

Many of the early binary vectors carried the selectable marker near

the RB, where it would be transferred before the transgene of interest. In

contrast, placement of the marker closest to the left border greatly dimin-

ishes the chance of selecting transgenic plants resulting from interrupted

bacterium-to-plant DNA transfer that carry only the marker (Hellens et al.,

2000).

Hellens R, Mullineaux P, Klee H (2000) Technical Focus:a guide to Agrobacte-

rium binary Ti vectors. Trends Plant Sci 5: 446-451

A previous rice transformation paper

A proposed mechanism which siuggest that presence of VirD2 at the 5'end (RB) protects this border but LB might be truncated

Some other examples reporting truncations