Science topic

Plant Biotechnology - Science topic

Explore the latest questions and answers in Plant Biotechnology, and find Plant Biotechnology experts.
Questions related to Plant Biotechnology
  • asked a question related to Plant Biotechnology
Question
2 answers
Some strains of Pectobacterium sp. and other plant pathogenic enterobacteria are known to produce Trimethylamine, responsible for "fishy" smell of infected plants and bacteria on agar medium. Such bacteria were very rare in Russia until recent years. 
Trimethylamine smells, trimethylamine N-oxide does not. Trimethylamine N-oxide increases osmotic concentration and thus depress the freezing point in bacteria, an important detail for Russian population of plant pathogens. Does anybody know abount frequency of this trait in pathogen populations in other areas and possible use for diagnostics and evaluation of climate change impact  in plant pathology?
Relevant answer
Answer
Fishy smell is a well-known trait of Pectobacterium spp., but is where any Dickeya species that has the same feature?
  • asked a question related to Plant Biotechnology
Question
4 answers
During Tissue culture of Brassicae when explant(hypocotyl) was provided Ms medium containing NAA -0.125 mg/250ml and BAP-0 mg/250ml. The hypocotyl burst and formed shoot, in direct-embryogenesis we expect the formation of somatic embryos from the explant. Please explain is this organogenesis or somatic embryogenesis. Rectify please if I'm wrong in some interpretation. The snap is attached below.
Thanks in advance.
Regards,
Vinay
Relevant answer
Answer
Yes
  • asked a question related to Plant Biotechnology
Question
6 answers
I am happy to announce that the latest special issue of PCTOC, on Secondary Metabolites and Medicinal Plant Biotechnology, will be in print any day now. Meanwhile you can check the Preface by the editors at https://rdcu.be/cJ2Ryhttps://rdcu.be/cJ2Ry to see its contents. Articles are online already.
Relevant answer
Answer
Dear Colleague,
I just tried it and it worked. Are you sure you used the right link?
Please try copy-pasting it in your browser and if it still does not work contact me directly at sergio.ochatt@inrae.fr and I'll send you the pdf by email.
With best wishes,
S.J. Ochatt
  • asked a question related to Plant Biotechnology
Question
19 answers
C4 rice variety development project, involving an international consortium of researchers..
Relevant answer
Answer
Theoretically, many advantages like maize, however practically wait and see.
  • asked a question related to Plant Biotechnology
Question
3 answers
I'm designing a fusion protein for expression in plants. The first protein is about 1,400 amino acids in length and the second is about 350 amino acids in length. I am considering putting the SV-40 (cctaagaagaagaggaaggtt) NLS signal directly after the first larger gene followed by a flexible glycine-serine rich linker. My question is whether I should add an additional SV-40 sequence at the 3' end of my fusion directly after the second gene. I have read about concerns over the two identical NLS sequences potentially bonding together and disrupting the expressed product, but I have also seen publications where two of the same NLS signals are used to effect. Any advice would be helpful.
Relevant answer
Answer
Well, the comment about the His-tag does not really answer the question about nuclear import efficiency?! I think it is not fully predictable... some proteins are very well imported with a single SV40-NLS. For others, import may be improved by adding another copy. We worked with Cas9; import improved a lot with a 2nd NLS (see Gruetzner et al 2021 Plant Comms). Some Cas9 versions have 3 - 5 NLSs attached, still no negative effects. If you are worried about using 2xSV40, just use two different ones. I made good experiences with the c-myc NLS in plants, we used ATGGCTCCTGCTGCCAAAAGAGTTAAACTCGACTCAgctgccgcA fro N-ter fusions, tctgcaCCTGCTGCCAAAAGAGTTAAACTCGACTAG for C-ter fusions including some linker amino acids. The core motif is PAAKRVKLD.
  • asked a question related to Plant Biotechnology
Question
2 answers
.
Relevant answer
Answer
I hope this file is useful for you.
  • asked a question related to Plant Biotechnology
Question
7 answers
For the initiation of tissue culture of Philodendron pink Princess, I am curious about the starting material. There are some reports on different varieties of Philodendron concerning tissue culture from leaf explants, but couldn't see it for the pink princess. Have you ever tried tissue culture for this ornamental crop from its mature variegated leaves? Thanks.
Relevant answer
Answer
It is possible from old leaves.
  • asked a question related to Plant Biotechnology
Question
8 answers
We know that somatic embryo can be used as an artificial seeds, but encapsulation include many kind of material. I ask to researcher to give their experience for us.
Relevant answer
Answer
Take a look at this video link
  • asked a question related to Plant Biotechnology
Question
28 answers
Hi,
I'm new here so sorry If I'm in the wrong place.
I've been working in UK Agriculture for around 10 years now and I've decided to pursue a career in R&D and plant breeding after working for a seed production company with a local breeding site. I found it all fascinating so I've started a biology degree at Open University and I'm hoping to get a job as a technician or something similar soon.
I know I'm still a fair way from my ultimate goals but in the mean time I'm looking for any good books that go into detail on agricultural plant breeding methods, plant biology, genetics and modern techniques such as Marker Assisted Selection, Doubled Haploid and tissue culture.
I'm looking for something that covers these subjects in detail but on a suitable level for a student (I like diagrams and pictures haha). One of the best looking ones I've found so far is "Plant Biotechnology and Genetics: Principles, Techniques, and Applications" by C. Neal Stewart Jr. But i could do with some advice from anyone who's read any books like this in the past.
Thanks
Stuart
  • asked a question related to Plant Biotechnology
Question
9 answers
Many pieces of researches have shown that responding explant percentage, embryo number, plant regeneration and also response rapidity increase in TCL explants compared to larger size explant. Now, I ask all researchers to share their experiences and reasons.
Thanks
Relevant answer
Answer
Minimal plant tissue offers many advantages over big explants. In case of TCL, cells are directly in contact with the nutrients, and have maximum chances of organogenesis and somatic embryogenesis on optimized growth regulators.
  • asked a question related to Plant Biotechnology
Question
8 answers
#essential oils
Relevant answer
Answer
I recommend to use filter for sterilization.
  • asked a question related to Plant Biotechnology
Question
15 answers
agriculture, soil, mycorrhizal fungi, biology
Relevant answer
Answer
If the volume of soil used is not large, an autoclave or micro-oven can be used for sterilization.
  • asked a question related to Plant Biotechnology
Question
15 answers
Can turmeric be used as a substitute for the other comercially availble antifungal agents during plant tissue culture?
Relevant answer
Answer
I have not had the experience of using turmeric as an antimicrobial agent in PTC. In our country, this substance is much more expensive than conventional disinfectants. On the other hand, we know that turmeric has antimicrobial properties, but it is a natural phenolic compound and its negative effect on cell growth and proliferation has been reported. Also, in my opinion, since this yellow substance reduces the transparency of the culture medium and the environment becomes opaque, I preffer to use the transparent materials.
  • asked a question related to Plant Biotechnology
Question
5 answers
Vitis Vinifera : Transcription factor proteins NAC1, NAC08, NAC17, NAC26 already showed a resistance against abiotic and biotic stresses via different articles.
My Vitis Vinifera NAC36 gene might have same function like them ? What the best way to start with this comparison ?? and is it possible ??
Relevant answer
Answer
  • asked a question related to Plant Biotechnology
Question
9 answers
How to prepare FeEDTA by adding Feso4 7h2o and NaEDTA, avoiding precipitation?
Relevant answer
Answer
Dissolve the FeSO4.7H2O and EDTA separately in adequate amount of distilled water. Then Slowly mix these components to make up the desire volume.
This stock is photo sensitive.
  • asked a question related to Plant Biotechnology
Question
18 answers
On the same medium composition i.e. 2mg/l 2,4-D and 0.4/0.5mg/l Kn MS medium(1962). It is found that leaf and petal explant gives embryogenic callus and node, internode and petiole derived explants with nonembryogenic callus.
In the same study I have performed one more experiment: node, internode and petiole derived callus were transferred to cytokinin rich medium for shoot regeneration; after one month shoot bud differentiation was observed in all the calluses (node, internode, and petoile derived callus) but there is significant difference in morphogenetic potentials of each explant derived callus. I have further subcultured each callus maintained separately and studied for 7 subcultures... during subculture on callus maintenance medium I tried the same composition. During each phase of subculture I have studied morphogenic potential of node, internode and petiole derived callus.. during this study I have found that petiole derived callus retain morphogenic potential up to six subcltures, while the other explants fail after 3rd and 4th subcluture... I need references for a similar study. If anybody has any suggestion please recommend some research papers on related work.
Relevant answer
Answer
The response of the cells present in different parts of a plant may vary in vitro. Because of the variable availability of PGRs in different organs, the explants respond differently to exogenously supplied PGRs under in vitro conditions.
  • asked a question related to Plant Biotechnology
Question
6 answers
How can I wash it? Please suggest how.
Relevant answer
Answer
Water temperature is very important I agree with Mohiuddin Yatoo
  • asked a question related to Plant Biotechnology
Question
9 answers
Although it's not a very effective sterilizer alone for plants but still being part of treatments in all researches. i wonder over its widely essential use and what factors decide the time of ethanol treatment?
Relevant answer
Answer
Dear @Amina Ilyas You may find a detailed discussion related to your query at the link given below as to why 70% ethyl alcohol is used for surface sterilization:
I would like to add that I am fully convinced with the explanation by @Yuan-Yeu Yau on that thread.
  • asked a question related to Plant Biotechnology
Question
4 answers
for oxalate, i used 1g sample, 75ml 0f 3M H2SO4 to soak it. filtered and took 25ml aliquot and warm and titrate against 0,05M KMnO4. (1ml KMnO4=2.2mg).
for phytate, i used 2g sample, soak with 100ml 0f 2%HCl, filter and took 25ml aliquot and to it, 53.5ml dH20 was added. 10ml 0.3% ammonium thiocyanate soln was added and titrated against standard iron III chloride containing 0.00195n iron/ml.
 how do i determine these values in mg/100g?
thanks. swift response is anticipated
Relevant answer
Answer
  • asked a question related to Plant Biotechnology
Question
4 answers
1. Chemically induced mutagenesis in seed and qPCR detection and amplification of desired trait.
2. Site-directed mutagenesis in qualitative traits of a multiline seed.
Relevant answer
Answer
Yes, the topics 1. Chemically induced mutagenesis in seed and qPCR detection and amplification of desired trait.2. Site-directed mutagenesis in qualitative traits of a multi line seed.below viable research in plant biotechnology.
  • asked a question related to Plant Biotechnology
Question
6 answers
How to find the candidate genes to validate their role through functional genomics experiments such as cloning, transgenics, over-expression, localization, and its interaction with other proteins and DNA, etc.
1)Do we need to study a lot of literature and see which genes role is not deciphered in particular traits e.g. drought stress?
2.) Do we need to perform our own transcriptome or comparative genomic studies or analyze already published studies from literature?
3. ) Do we need to perform our own marker traits association(QTLs) study or already published studies?
4.) Some people functionally characterize already known genes(say arabidopsis) to plant of their interest (legumes). But is it a significant or novel research problem to work upon?
5. all of the above.
Relevant answer
Answer
Hey Shubham,
it depends on what questions you would like to answer with your experiments. I'm also not sure if i fully understand your question but maybe this helps:
1) -> it is always useful to read and know the important literature.
2) -> transcriptomic data and comparative genomic studies are useful to identify relevant genes for a certain issue. When it comes to transcriptomic data a useful approach is to expose your organism/cells to a certain stress to detect up-/downregulated genes compared to non exposed cells. Therefore it is important to design your own experiments to answer your individual questions.
Finding only homologous genes/proteins, you can use several bioinformatic databases (BLAST, UniProt...) in this case you should know your target genes.
4) -> characterizing already known genes of the same organism/cells is not useful. Why would you do that when it's already reported? But you can investigate homologous genes of another organism (not reported!) to check if comparable gene sets/proteins are involved in e.g. draught/starvation etc... Finding completely unknown genes and classify them to a cellular event is not that easy as you might think :)
good luck!
  • asked a question related to Plant Biotechnology
Question
8 answers
Dear Researchers,
        I am doing transformation in cotton plant. Now I want to check GFP expression in transformed tissue. Can anyone suggest a standard protocol for preparing tissue sample to visualize GFP under fluorescence microscope? Thanks in advance.
Relevant answer
Answer
  • asked a question related to Plant Biotechnology
Question
3 answers
Is there any DAB staining method for ROS detection in pea leaves??
Relevant answer
Answer
We only use in situ detection of H2O2. Histochemical staining is described in:
  • asked a question related to Plant Biotechnology
Question
3 answers
I know they are required for the transfer of T-DNA and are transferred along with it. But how is it useful exactly, apart from transfer. And how are they cleaved
Relevant answer
Answer
A key feature of Ti plasmids is their ability to drive the production of opines, which are derivatives of various amino acids or sugar phosphates, in host plant cells. These opines can then be used as a nutrient for the infecting bacteria, which catabolizes the respective opines using genes encoded in the Ti plasmid.
  • asked a question related to Plant Biotechnology
Question
5 answers
I am looking for few common tobacco pathogens as well as other general plant fungal pathogens. If anyone will be willing to provide it then please contact me. 
Thanks
Relevant answer
Answer
Lot of work has been done by Tobacco Research Centre at Nipani, Dist-Belgavi, Karnatak state(India). You may contact Director of the Research centre .
  • asked a question related to Plant Biotechnology
Question
4 answers
any one knows what is the effect of applied biochar upto 15 t ha-1 on maize yield and yield components?
like total grain yield, biological yield, thousand grain weight ,, stover yield and NPK uptake by the plant.
  • asked a question related to Plant Biotechnology
Question
17 answers
Dear Experts.....I am doing the superoxide radical scavenging assay.The result I got was opposite to what I found in theory/literature. I used NADH-PMS system. According to literature, the reaction must give the blue formazan dye.When I add the antioxidant standard to the reaction mixture, the color intensity should decrease.But I got the opposite result like the NADH-PMS-NBT system doesn't give any color formation. But when I add the ascorbic acid to the system, it showed blue color formation. But for the medicinal plants extracts, color doesn't change.Please give me any advice or show me how to correct the protocol.
Relevant answer
Answer
Mohammed Junaid Hussain
I will send you the protocol I used.
Best Regards,
  • asked a question related to Plant Biotechnology
Question
6 answers
I am using Genalex to analyze binary AFLP data of two Fusarium populations. What conclusion can I make from having greater within population variation, than between population variation? 
Relevant answer
Answer
I like this question and you already have some great answers. But I also think of this in terms of Fst, or Wright's fixation index, which varies between 0 and 1. The goal here is understanding the partitioning of variation, and this is important in estimating the level of past or ongoing gene flow and population connectivity. Sometimes it's helpful to consider interpreting the extremes, where fixation index of 1 is completely subdivided populations where all of the variance is among populations, and zero, none within, suggesting zero connectivity via gene flow. The opposite case, Fst of 0, suggest complete panmixia, no differences among populations. Your situation suggests substantial gene flow and low intrapopulation differentiation (less than 50%). These populations are connected, rather than isolated.
  • asked a question related to Plant Biotechnology
Question
11 answers
Journal Scopus indexed, ISI indexed that publish articles for free of charges in the field of plant biotechnology
Relevant answer
  • asked a question related to Plant Biotechnology
Question
21 answers
As we know that guide plays a vital role in the entire tenure of research leading to PhD, what are the qualities a scholar must look into consideration while selecting a guide?
Relevant answer
Answer
If you have a research supervisor or mentor in mind, choosing the right one is very important. First of all, the mentor must have knowledge of the research subject, as well as a desire and interest to work in the field. The presence of this type of person makes the work of the PhD student purposeful. Next, there must be innovative thinking and work style that does not bother the doctoral student. However, his job is to guide, support and guide the PhD student to relevant, up-to-date and well-developed scientific work.
  • asked a question related to Plant Biotechnology
Question
3 answers
I have difficult for to development of hybrids in Leucaena. I was applied common method but I can't create hybrids in this plant. Pls give idea or any specific method for producing hybrids in Leucaena and also give me some reference article.
Relevant answer
Answer
You can get the required information from this link
  • asked a question related to Plant Biotechnology
Question
8 answers
I have 2 genotypes, one resistant and another susceptible with two repeats of each genotype for stress and control condition. I will analyze them with one concentration of heavy metal  at two time points in comparison with control genotypes.  Briefly two genotypes, two time points, two repeats for heavy metal treatment and control, one heavy metal concentration. Totally 16 samples. could any one give aa advice? Regards
Relevant answer
Answer
YOU CAN TRY NETWORK ANALYST SOFTWARE FOR DIFFERENTIAL EXPRESSION ANALYSIS ,
  • asked a question related to Plant Biotechnology
Question
2 answers
The solution for immediate stabilization of DNA, RNA, and protein in tissues.
Relevant answer
Answer
Unfortunately it's proprietary.
  • asked a question related to Plant Biotechnology
Question
34 answers
The research area is not only limited to plant biotechnology, but also extends to plant physiology and biochemistry/Genetic engineering/plant growth and development/secondary metabolism and regulation/stress physiology/Plant molecular biology etc.
your valuable suggestions will be highly appreciated.
Relevant answer
Answer
Plant Cell, Tissue and Organ Culture (PCTOC), Journal of Plant Biotechnology.
There is no cost for publication, but if you'd like open access is necessary to paid it.
  • asked a question related to Plant Biotechnology
Question
8 answers
I need a comparison between Endomycorrhiza and Piriformospora indica in some crop production.
Relevant answer
Answer
Is the technology is being licensed to companies?
  • asked a question related to Plant Biotechnology
Question
8 answers
I am considering to use PCR for identification of X. vesicatoria (from tomato spot), however I am still exploring alternative tests. I have found an ELISA test for several Xanthomonas species, but have not found any for X. vesicatoria. Are there perhaps any ELISA tests available with X. vesicatoria?
Any recommendations would be helpful,
Thank you.
Relevant answer
Answer
  • asked a question related to Plant Biotechnology
Question
6 answers
I am struggling to find a helpful protocol for detection of these two bacterial species (one originating from tomato wilt disease and the other from tomato spot disease). I am unsure of how to properly set up PCR/Gel Electrophoresis for these particularly strains. My intent is to sample diseased plant tissue and culture the bacterial colonies, where I would purify them and run the respective colonies in PCR, then agarose gel for identification.
Thank you, I would appreciate the help greatly.
Relevant answer
Answer
  • asked a question related to Plant Biotechnology
Question
4 answers
I want built a small biochemistry lab for research purpose ( Phytochemical Study).
Phytochemical screening
 It refers to the extraction, screening and identification of the medicinally active substances found in plants. Some of the bioactive substances that can be derived from plants are flavonoids, alkaloids, carotenoids, tannin, antioxidants and phenolic compounds.
Please give me some guideline and references for built a small laboratory.
Relevant answer
Answer
Hi,
as
Sebastian Schmitt
mentioned, it is indeed necessary to provide a more specific question in this case. Depending on the machines available in your lab it could be possible to perform an analysis more than another. Of course some basic chemicals are in every lab, but to avoid misleading you it could be better to receive more information about the type of research you want to carry.
Please have a look at the following link:
Best regards
  • asked a question related to Plant Biotechnology
Question
6 answers
The attached image shows chromatograms from the same FAME sample run three times on our GC-MS. As seen, additional peaks show up if running the sample several times. From the MS spectra the additional peaks seem to be plasticizers. If I heat the column to max for 30 min and then rerun the sample the peaks are gone. The additional peaks elute at approximately the same in all samples. I have tried changing septum, liner, injector needle, needle wash whiteout any improvements. Any suggestion how to lose these peaks? Thanks in advance.
Relevant answer
Answer
What is m/z for plasticizers peaks?
  • asked a question related to Plant Biotechnology
Question
2 answers
Resistant starch and its implications in relation to fish diets Can someone help me with materials on resistant starch in legumes and how they can be determined in relation to fish diets?
Relevant answer
Answer
Thank you
  • asked a question related to Plant Biotechnology
Question
17 answers
Dear Colleagues/Editors/Reviewers,
Comment those journals which are going to receive its first impact factor in JUNE 2020 and currently indexed in ESCI, SCOPUS, PubMed, etc.
Journals must be related to plant physiology, plant biology, plant sciences, agriculture, and biotechnology, etc.
Note. Please don't comment any predatory journals. Thanks in advance.
Regards
Ali
  • asked a question related to Plant Biotechnology
Question
7 answers
Recently I was performing some rooting trials with in-vitro produced walnut plants, at this time a lot of those plants have died from fungal infection.
I mention some background about:
- Induction in DKW 1/2 for 5 days in darkness
-Rooting in humidity chamber ~ 90%
- Peat-Perlite Substrate 1: 1 and Jiffy 7C
-In in-vitro conditions some of these plants had a white halo in the callus.
-Substrate humidity controlled
In previous tests I never saw anything like this. 
Relevant answer
Answer
You may read my paper attached. I am giving consultation to commercial tissue culture labs to produce walnut by tissue culture commercially. Let me know if there is any company who need my services.
  • asked a question related to Plant Biotechnology
Question
6 answers
we placed plant in a dark conditions (in growth chamber without light) before isolation of mtDNA but still we have little contamination of chloroplast DNA. Is there any other method to control it..
Relevant answer
Answer
Hello!! I'd like to ask one thing. I have isolated Chloroplast from leaves with percoll gradient. Chloroplast, observed under a microscope were very beautiful. After I extracted DNA with a DNA extraction kit and amplified with chloroplast genes. I think that in my chloroplast DNA there was nucleus contamination... how can I obtain a Ch DNA without contaminations???
  • asked a question related to Plant Biotechnology
Question
2 answers
I want to test the in vitro phosphorylation of a LAMMER kinase against an external substrate. How can I non radioactively achieve this? Also,what are the general effects of autophosphorylation on kinase activity?
Relevant answer
Answer
Hi Ankita
Use PamGene’s global kinase activity arrays. They are more sensitive (1-5 ug proteins only, 10-50k cells), robust, reproducible (<10% CV), non-radiolable, high coverage as 200 phosphopeptides, very inexpensive with current proteomic techniques.
  • asked a question related to Plant Biotechnology
Question
2 answers
My friend said to me to use different levels of peclobutrazol and monitol on potato micropropagation. Is it ok, if so what is the process for that please.
Relevant answer
Answer
Paclobutrazol is anti-gibberellin and mostly commercially used to induce flowering on woody perennial plants like mango. You may test it wherever you want to suppress gibberellin activity.
  • asked a question related to Plant Biotechnology
Question
11 answers
I need to know about the bioinformatic database and resources for abiotic and biotic stresses?
For Example:
PRGdb: a bioinformatics platform for plant resistance gene analysis
Relevant answer
Answer
Here, numbers of links related to your target databases have been attached. Before surfing through the literature to find some relevant websites in accord with your project goal, try to specify your terms of search especially in the case of that stress you would like to work on. For each aspect of plant tensions, at least five to ten databases presently developed within the academic web-pages. I hope the following links support you for retrieving quintessential information you would like to archive. Please let me know if you want get far more specific data in this case. I am at your disposal.
  • asked a question related to Plant Biotechnology
Question
14 answers
2-iP, Zeatin, BA, Picloram, NAA, IAA, IBA, CCC, etc.
Relevant answer
Answer
Adding PGRs after autoclaving is better for good results. BA, NAA, IBA 2,4 D can be added before autoclave with no big deal in efficiency. However, Zeatin, TDZ , IAA can perform better if added after autoclave.
  • asked a question related to Plant Biotechnology
Question
13 answers
Its unclear the role of plant hormone in plant resistant.
  • asked a question related to Plant Biotechnology
Question
25 answers
It is difficult to work on crops and chances of successful experiments are very less, that is why we prefer these model organisms to study the mechanism and then apply the same knowledge on other crops. So, according to you, for different traits and developmental studies which is better?
Relevant answer
Answer
I have worked with Nicotiana tabacum and Arabidopsis thaliana. As for me tobacco is more easy culture to grow and work with. But for arabidopsis there is full genome and special resourse about genes and etc https://www.arabidopsis.org/
  • asked a question related to Plant Biotechnology
Question
10 answers
Hi All,
I am looking for several plant expression vectors (pML-BART, pART27 and pART7). Could anyone please tell me where I can find these vectors? I have searched in google but did not get any source where I can buy them.
Thanks,
Dr. Mahmudul Hassan
Postdoctoral Research
Oak Ridge National Laboratory, USA
Relevant answer
Answer
Hi , this website might want to contact them , they make plasmids according to order.
  • asked a question related to Plant Biotechnology
Question
3 answers
i want to estimate the saponin content in crude extract of aloe vera using HPLC. which standard of saponin should i use to estimate the saponin or which type of saponin is found in Aloe vera?
  • asked a question related to Plant Biotechnology
Question
46 answers
Suppose someone is working on molecular characterization of particular fungus using ITS region. He obtained the DNA and amplified using specific primer pairs and went for sequencing. However, without submitting the sequence to GenBank or any other related databases, is it possible to publish in journal or PhD thesis. How authentic/ scientific is such type of work?
Anticipating a positive response.
Thanking you.
Relevant answer
Answer
Most journals (and funding sources) require you to make sequence data publicly available when you publish in a peer-reviewed scientific journal. Part of the collaborative nature of science, adding to the known data collection, etc. It's unprofessional to not make your data available.
A thesis isn't technically a peer-reviewed publication so you don't have to publish your sequences. But you can't cite your unpublished thesis.
That's what's normal for my field of research. Other fields might have different conventions.
  • asked a question related to Plant Biotechnology
Question
7 answers
Relevant answer
Answer
how to ensure the purity of apoplastic fluid
  • asked a question related to Plant Biotechnology
Question
8 answers
Why there are two names for the same growth regulator?
Relevant answer
Answer
Yes you can. The two abbreviation BA and BAP describe the exact same cytokinin, 6-benzyladenine or 6-benzylamino purine.
  • asked a question related to Plant Biotechnology
Question
2 answers
I am a PhD student working on genetic diversity of Strychnos cocculoides
Relevant answer
Answer
Hi Dr. Jarret
i suggest you this
SIMPLE SEQUENCE REPEATS PROTOCOLS
  • asked a question related to Plant Biotechnology
Question
12 answers
Hi,
I have some Catharantus roseus callus tissue (about 25 days on medium) that I kept in 12 hrs light condition on MS medium with 1 mg/L NAA and BAP. I don't want to let them differentiate and I need to maintain them in the undifferentiated mode. They are already green. Can I transfer them to dark now or is it too late? 
Thank you
Relevant answer
Answer
I would try to reduce the amount of 2,4-D to a minimum (0,1 mg / l) and increase the amount of BAP to 1 mg / l. Maybe I would replace BAP with IBA.
Important is to induce embryogenesis in the dark, or organogenesis to light. Depends on how you want to get regeneration.
  • asked a question related to Plant Biotechnology
Question
7 answers
I am a plant biotechnology researcher basically working in plant tissue culture and secondary metabolites genetic engineering. I would like to move in the field of immunology and medical biotechnology, however, no one is supporting (No one accepting PostDoc application and no funding agency supporting new projects in new field for being a plant biologist).
What should I do ?
Relevant answer
Answer
This is very obvious. Not only in India, in many places (including US) too. You are shifting field from plant science into animal science. The PIs will be worried about whether you have the basic knowledge of animal science to perform experiments. Beside, there are many other qualified candidates for choosing. They don't want to make a risk, because it is not easy for them to obtain those funding. They are under a lot of pressue to publish good papers for future funding. So, basically they will look for experienced candidates who are in the same field and are capable to publish good papers in a jiffy.
  • asked a question related to Plant Biotechnology
Question
2 answers
The Foxtail Millet has a lot of data related to rice ILP markers. How is this data best utilised?
Relevant answer
Answer
For basic understanding about ILP marker following 2 minute video should be watched:
PIP is one such database to design ILP markers.
  • asked a question related to Plant Biotechnology
Question
15 answers
Strawberry plants
Relevant answer
Answer
Nice to see!.
  • asked a question related to Plant Biotechnology
Question
8 answers
I have a paper to do and I have little to no experience in the field of genetically modified organisms. We did not cover this subject yet and I would like to get a head start (as well as finish my paper). Do you have any novice-level articles to recommend? Thank you.
Relevant answer
Answer
Hello, you can try google search but it's better to start with book attached. Good luck.
  • asked a question related to Plant Biotechnology
Question
7 answers
Invitation for MS contribution in edited book Plant Biotechnology
Plant scientists are cordially invited to contribute a chapter on “Genome editing technologies for value added traits in plants ” for edited book on Transgenic Technology Based Value addition in Plant Biotechnology; to be published by Elsevier Inc. Acceptance Deadline Jan 25, 2019
Relevant answer
Answer
Sent you mail.
  • asked a question related to Plant Biotechnology
Question
9 answers
Invitation for MS contribution in edited book Plant Biotechnology
Plant scientists are cordially invited to contribute a chapter on “Transgenic approaches for improved shelf life and nutritional quality of fruits and vegetables” for edited book on Transgenic Technology Based Value addition in Plant Biotechnology; to be published by Elsevier Inc. Acceptance Deadline Dec 15, 2018
Relevant answer
Answer
I have got chapter contribution for this topic. Thanks for being part.
Regards,
  • asked a question related to Plant Biotechnology
Question
6 answers
Whatman CF 11 cellulose powder (Cat. No. 4021-050) has been used to separate dsRNA elements from ssRNA, ssDNA and dsDNA. Column chromatography under 15% ethanol concentration, CF 11 cellulose specifically binds dsRNA fraction. Now the producer of CF 11, Whatman, does no longer produce it. Does anyone has experience with alternatives? I need it for dsRNA-binding purpose. I look forward to hearing from you...
Relevant answer
Answer
Sad! CF11 has been discontinued!! however I use sigma Cellulose fibers, (medium) Cat # c6288 and it works.
The only difference I found is the texture of the two products are different. CF11 seems to absorb the solvent faster than sigma cellulose, Therefore, if your method requires cellulose slurry then you need to mix it with the solvents for longer times.
I do recommend to optimise the parameters including temperature, contact time and equilibrium time as I found slight differences when I started using Sigma cellulose.
  • asked a question related to Plant Biotechnology
Question
4 answers
I am seeing that microbial biotechnology field is having great work as compare to plant biotechnology.
Relevant answer
Answer
Hello, here the global challenges in plant biotechnology.
Increase crop productivity especially in adverse environments,
Management of herbicide tolerance,
Management of resistance to pests,
Management of resistance to diseases,
Improvement of genetic engineering technologies to enhance public perception etc.
What about microbial biotechnology the many topics related with plant biotechnology for example genetic engineering and transgenic crops, biopesticides, bioinsecticides, biofeltilisers, bioleaching, soil desalination etc.
  • asked a question related to Plant Biotechnology
Question
6 answers
Hi there, sometimes we have trouble dissolving 1 % (w/v) birchwood xylan for use as a substrate for xylanases. Any suggestions?
Relevant answer
Thank you for your help.
  • asked a question related to Plant Biotechnology
Question
5 answers
I'm trying to look at the induction of candidate genes involved in plant defence when I block the signalling pathways related to JAs and ethylene and apply different stresses. For ethylene I can use the AVG, an inhibitor of ethylene biosynthesis, but as far as I know, there are no inhibitors of the jasmonate signaling pathway. Do you have any info about it?
Relevant answer
Answer
  • asked a question related to Plant Biotechnology
Question
28 answers
Generally during the transportation, DNA is often degraded, specially the High Molecular Weight DNA which is extremely fragile to external shocks. I am looking for suggestions/recommendations regarding export of High Molecular Weight DNA (more than 50-100 Kb) from one country to another, without losing the integrity of the DNA.
Does anyone have experienced this before?
Thanks in advance
Relevant answer
Answer
I agree with Dr. Karen
  • asked a question related to Plant Biotechnology
Question
11 answers
In what ways could one commercialize plant biotechnology or it's products?
Relevant answer
@Osama Al-Saffar
Dear Dr. Osama
Yes doctor there is amazing techniques to produce transgenic plants. I am currently studying a plant biotechnology course. It is very useful to have knowledge about production and improvement of commercial crops.
I am attaching a copy of the book that studying currently.
Respectfully,
  • asked a question related to Plant Biotechnology
Question
3 answers
Currently I am working on stevia protoplast fusion. Do you have any information on how to set up experiments to investigate batch sorting of protoplasts?
Relevant answer
Answer
I have worked on protoplast isolation and fusion , sorting is generally done by flow cytometry
  • asked a question related to Plant Biotechnology
Question
8 answers
In VIGS we silence genes but i wish to know if the silencing signal spreads in root or not. Putting it in other way, are silencing signals by VIGS or dS RNA degradation spreads equally from top (shoot/leaf) to bottom (roots) and bottom to roots (consider a RNAi construct in hairy root or VIGS) in plant systems.
Relevant answer
Answer
Nature Communications Vol 9, Article Number: 3107 (2018) entitled "
Gating of miRNA movement at defined cell-cell interfaces governs their impact as positional signals" explains a lot of this question.
  • asked a question related to Plant Biotechnology
Question
9 answers
I've done an in vitro cytotoxicity study on a crude plant extract. Reviewing the literature, there were two different values for IC50 limit considered by NCI to be significant enough to conduct further purification : <20 and  <30 micrograms/mL.
Which one is correct?
Relevant answer
Answer
You can apply the threshold proposed by Suffness & Pezzuto. It stablishes that crude extracts showing an GI50 ≤ 100 mg/mL can be considered to be cytotoxic and selected for further studies, whereas the most promising ones are those with an GI50 lower than 30 mg/mL.
Cite it as :
M. Suffness and J. Pezzuto, Eds., Assays related to cancer drug discovery. London: Academic Press, 1999.
NOW A PERSONAL REFLECTION ON NATURAL PRODUCTS SUCH EXTRACTS:
This threshold is just an arbitrary convention, and still some non promising extracts may contain extraordinary compounds just in too low concentration to be seen. Disguising these numbers with physiological considerations makes it nice, but these are huge approximations and there are too many unknowns on ADME parameters.And for natural products such as extracts, 20 or 30 are the same order of magnitude to me.
I prefer to find out if the 50% effect is roughly above or below fixed conc such as 100, 50, 25 or 12.5. The linear trends in most studies are just horrible as complex natural products rarely fit to any line due to too many compounds acting independently (or in combination) ... there is people that finds pleasure in reporting an IC50 down to two decimals believing it makes them better scientists and the paper more credible... I believe that it is rather the contrary ...
  • asked a question related to Plant Biotechnology
Question
4 answers
Hi, i am doing a literature search and i need to know which type of microalgae produces beta-glucan. Or a place where i can start my search would be helpfull
Relevant answer
Answer
Euglena gracilis for instance produces paramylon (beta 1-3 glucan)
  • asked a question related to Plant Biotechnology
Question
1 answer
Plant Biotechnology
plant physiology
Relevant answer
Answer
I don't see a reason why not assuming they were stored properly. You just need to dissolve them in appropriate solvent and proceed to the measurement.
  • asked a question related to Plant Biotechnology
Question
7 answers
Actually i am working with seed size variation in wheat. For this i need to extract total proteins from developing and mature seeds. Which buffer will perform best?
Relevant answer
Answer
Dear Yash Gupte,
Can you share the protocol or paper? Also, does it extract all or most of the proteins for accurate quantification using Bradford's method ?
  • asked a question related to Plant Biotechnology
Question
4 answers
Rose, RNA, real time
Relevant answer
Answer
i am also having a lot of trouble in RNA extraction from Rose tissues (leaves, flower buds, etc). I have used pBiozol, but still i haven't been successive in having a brighter 28s band in gel. I have repeated about 30 times, with different criteria, but all in vain. Please help me :`(
  • asked a question related to Plant Biotechnology
Question
8 answers
we are try to comparing total cellular content like chlrophyll ,carotenoid ,anthocyanin, proline ,sugar ,antioxidant enzymes of medicinal plant at different altitude level of Himalayas , know about the plant response to abiotic stresses . Will it show any significant result. what else we can do to make our project more informative ?
Relevant answer
Answer
Dear Shubhan
The alterations in the leaf structural elements (leaf morphological, anatomical, ultrastructural, morphometrical and photosynthetic parameters) and genome-wide investigation of molecular mechanisms for high-altitude adaptation have attracted great attention in the last few years.
  • asked a question related to Plant Biotechnology
Question
2 answers
Need based selection of research topic is good
Relevant answer
Answer
Medicinal Plants to Calm and Treat Psoriasis Disease
March 2017
DOI: 10.5772/67062
In book: Aromatic and Medicinal Plants - Back to Nature
Azadeh IzadyariAzadeh IzadyariAzim Akbarzadeh Khiavi
  • asked a question related to Plant Biotechnology
Question
5 answers
Hello,
I am looking for a protocol by which I can detect the Ion-leakage in the anthers of my Arabidopsis Mutants.
I want to know the detailed protocol mentioning the tissue amount (anther numbers) and steps to be followed.
TIN
Cheers,
Dharmesh
Relevant answer
Answer
Dear Dharmesh, have a look to the attached file!
Regards