Science method

PCR-RFLP - Science method

Explore the latest questions and answers in PCR-RFLP, and find PCR-RFLP experts.
Questions related to PCR-RFLP
  • asked a question related to PCR-RFLP
Question
1 answer
Restriction enzyme and primer design startup
Relevant answer
Answer
Please ask your seniors or supervisor for help and guidance.
  • asked a question related to PCR-RFLP
Question
4 answers
Hello everyone. I need to find restriction enzymes that may allow me to distinguish between Pseudomonas species using ARDRA (16S RFLP), so I want to run in silico PCR-RFLP on all pseudomonas 16S sequences I can find. I found this web-based tool from University of the Basque Country (http://insilico.ehu.eus/PCR-RFLP/) but I need to run every PCR-RFLP separatedly. Does anyone know a software that allows for running this in batch?
Relevant answer
Answer
You can use Graphical user interface of REDigest and can use any number or sequences in any format (fasta / genbank ). Try it.
If you have any problem in installing or execution, let me know.
  • asked a question related to PCR-RFLP
Question
15 answers
I'm screening an SNP of Y-chromosome specific SRY gene by PCR-RFLP, and found three genotypes. As SRY is single-copy gene and Y specific (allosomic gene) we cannot expect an alternative allele, but we could find three genotypes. why and how?
thanks in advance
Relevant answer
Answer
Thank you for the primer sequences . Jeevan .C
I have blasted them and my comments refer to the sequence
cagtgca gtcgtatgct tctgctatgt tcagagtatt
14281 gaacgacgat gtttacagtc cagctgtggt acagcaacaa actactctcg cttttaggaa
14341 agactcttcc ttgtgcacag acagtcatag cgcaaatgat cagtgtgaaa ggggagaaca
14401 tgttagggag agcagccagg accacgtcaa gcgacccatg aacgccttca ttgtgtggtc
14461 tcgtgaacga agacgaaagg tggctctaga gaatcccaaa atgaaaaact cagacatcag
14521 caagcagctg ggatatgagt ggaaaaggct tacagatgct gaaaagcgcc cattctttga
14581 ggaggcacag agactactag ccatacaccg agacaaatac ccgggctata aatatcgacc
14641 tcgtcggaga gccaagaggc cacagaaatc gcttcctgca gactcttcaa tactatgcaa
14701 cccgatgcat gtagagacat tgcacccctt cacatacagg gatggttgtg ccaagaccac
14761 atactcacaa atggaaagcc aattaa gccg gtcacagtcc gtgatcataa ccaattcact
14821 cctgcaaaag gagcatcaca gcagctggac aagcctgggc cacaataagg taacattggc
14881 tacacggatt tcggcggact ttccct gtaa caaaagctta gagcctggac tttcttgtgc
14941 ttattttcaa tattgactt c cttactctcg ctaacaaagg cgct
Which probably varies slightly from your amplimer but I will use it as an example and you can compare it to your sequence. The MSe1 site at 14786 will cut in all samples giving sizes of 540 and 201 and in partial digests of 741. Partial digests are a problem with pcr product as the partial looks just like an uncut sample and pcr product may have a higher incidence of cut site than genomic dna so we have to cut for longer and use more enzyme than usual. Your gel is excellent but it really should have included a couple of deliberately uncut samples for comparison purposes.
The 201 base fragment has the motif TTAG at about 14921 which can be mutated from TTAG to TTAA and then this also cuts with MSe1 to give fragments of 135 and 66.as is seen in your gel samples top3 and bottom 14. The remaining samples with 2 small bands must be cut again for longer and with more enzyme ( overnight) Normally I would expect the 201 bans to be as intense as the 2 smaller bands combines . I agree that 201 looks weaker and is probably a partial digest but you cannot be absolutely sure so cut again and be sure.
The very larges bands are interesting. I think that what you have here is a heterozygote situation. So the pcr amplified strong bands so the last cycle of pcr melts the product and as there is a lot of product we get annealing not only of primers but reannealing of the 4 dna strands . Calling these strands N and M for the changes base we get NN.NM,MN and MM strands reannealing in the heterozygote situation. NM and MN have annealed with a bubble in the dna at the enzyme cut site so the enzyme cannot cut as the dna is not double stranded at that point. Also because of the bubble in the dna the dna runs slower ( apparently larger) through agarose gel. As You say this only occurs with heterozygotes. You may think that this is a nuisance but it is also indicative of the heterozygote existing so is diagnostic of a heterozygote. An uncut control sample of a heterozygote amplimer would show this clearly.
  • asked a question related to PCR-RFLP
Question
3 answers
I have used PCR-RFLP for the genotyping of fowl adenoviruses previously but now I am interested in the genotyping of FAdVs by real time PCR. Kindly share your experience if someone has already used this way. Thank you
Relevant answer
Answer
This is a good source of primer/probe for detection of FAdVs by rRT-PCR:
  • asked a question related to PCR-RFLP
Question
11 answers
What are the stages of life? What is conidia, spores, siri (misspelled)?
How can I find a region in the genome using RFLPs and PCR?
Also what are the stages in sexual and asexual reproduction resulting in 8 ascospores.
Thank you so much for the help. 
Relevant answer
Answer
in addition to PDA, you can also use Synthetic Nutrient-poor Agar (SNA). If you want to obtain pure culture for single spore technique for identification of Fusarium species, PDA is recommended.
  • asked a question related to PCR-RFLP
Question
5 answers
Hello everyone!
Currently, I am genotyping DNA samples via forced RFLP-PCR method. However, most of the time, I get the second non-specific band. The main problem is that when I use this PCR product, the restriction enzyme does not work. From this, I understood that I need perfect PCR band. I assumed it's probably a problem with primer design but sometimes I could get clear band. Primers and PCR procedure were retrieved from previous studies (articles). I tried to increase an annealing temperature, and also ran gradient PCR. However, it does not work!
Relevant answer
Answer
*Depending on your question about using a PCR product and the restriction enzyme (RE) doesn't work, If you targeting specific gene, maybe the sequence of this gene doesn't have the restriction site that specific for your current RE or the RE doesn't work, especially you already have bands in the attached figures.
*So, simply, can you change the RE?
There are many online tools to defined the restriction enzymes, such as; NEBcutter V2.0 (https://www.labtools.us/nebcutter-v2-0/) based on the previous sequence of the target gene. Worth mentioning, your problem not related to the primers or PCR product, it`s related to Restriction fragment length polymorphism (RFLP) technique.
* If it's not working, then you have to check the conditions of incubation (time, temperature,...etc.) for RFLP technique.
*Also, about the second band, I think it`s not specific band, may also, you need to reduce the volume of the primer.
  • asked a question related to PCR-RFLP
Question
2 answers
Hello everyone, I am new in the field of PCR-RFLP and I am planning to use it for clustering yeast isolates. I am using HaeIII, HhaI and HinfIII to digest the ITS region and using GelAnalyzer software for the analysis of the band sizes. I am getting similar restriction patterns while repeating the procedure on the same isolates. However, the band sizes have been shown to be nearly 70-80 bp higher in the second run, in the software. I doubt, this might be because of the lower resolution of the bands. Please suggest, how can I obtain accurate band sizes in each gel? Moreover, in most of the papers I have read, I have observed that, the authors depict the band sizes in multiples of 5, like 355bp, 360bp etc. Why is it so?
Relevant answer
  • asked a question related to PCR-RFLP
Question
3 answers
I have carried out a western blot to detect the p53 protein by using a primary and secondary antibody, then I have used RFLP with controls to detect differences between a mutated or normal wild type p53.
1. Accordingly to protein marker the proteins were at level 50kD, is that still fine or does it have to be at 53kD specifically to say its p53?
Other question included:
2. 'Would you expect a molecular weight difference from a single polymorphism? What about a 1 kb deletion or addition, how might that change the molecular weight of p53?'
- what is it supposed to mean?
-- i have detected that mutated had 3 bands whereas normal had 4, is this what the question is potentially refering to ? How can I describe the digestions in the RFLP?
Relevant answer
Answer
Hi,
Let us start with you first question.
1. Accordingly to protein marker the proteins were at level 50kD, is that still fine or does it have to be at 53kD specifically to say its p53?
Answer: By Western Blot Assay you use primary and secondery antibodies on nitrocellulose or similar membrane and then detect your band with chemilimuniscent substrate. Normally you don't need any marker if you use monoclonal antibody as primar Ab. Because monoclonal antibody is very spesific and you should see just one band after western blot. We use markers to control the protein migration on SDS-PAGE, we don't want to lost our protein. I mean you follow the marker and end the electrophoresis before your protein of interest goes out from the gel. Therefore marker bands are needed just for tracking the proteins.
2. 'Would you expect a molecular weight difference from a single polymorphism? What about a 1 kb deletion or addition, how might that change the molecular weight of p53?'
Answer: First of all , a single polymorphism means genetic diversity, it is only one nucleotid difference. I would not expect any molecular weight change. However 1 kb change makes big difference if it is on exon part of the gene. Sometimes insertion (addition) or deletion even in intron effects the gene expression too, due to RNA splicing.
i have detected that mutated had 3 bands whereas normal had 4, is this what the question is potentially refering to ? How can I describe the digestions in the RFLP?
Answer: If you got 3 bands after RFLP (Restriction Fragment Length Polymorphism) analysis, it means: one of the recognition site of your restriction enzyme changed. This change could be a single polymorphism or a mutation. You have to amplify your fragment with PCR and send for sequence analysis to understand which one it is.
I hope this helps
  • asked a question related to PCR-RFLP
Question
3 answers
i am using a PCR-RFLP protocol to identify CCR3 T51C genotypes but I found a PCR product at a different length than a previous paper that used the same protocol despite using the same primer sequence and the same restriction enzyme ??
also when I used the restriction enzyme it showed a mild displacement behind the PCR product ??
i used Primer blast and found a single paper that used the same techniques to identify genotypes and i went to NEB cutter to make sure that enzyme can cut both primer strands.
my question is how to know the bands of the genotypes of this SNP thanks indeed
Relevant answer
Answer
@katie A burnette thank you for your response its the same genomic human Dna
  • asked a question related to PCR-RFLP
Question
3 answers
I'm trying to amplify a NRAMP D543N (rs17235409) polymorphism, but I'm not getting succefull.
I alredy tried temperature gradient (annealing temperature 56-60°C), MgCl2 optmization (06-1.2uL) and DMSO.
I'm using the folloowing primers: Forward primer: GCATCTCCCCAATTCATGGT- Reverse primer: -AACTGTCCCACTCTATTCTG-
And the following reagents:
GoTaq® Flexi DNA Polymerase 5U - 0.1uL
Colorless Flexi Reaction Buffer - 1.5 uL
MgCl2 25mM - 0.6-1.2 uL
dNTPs 10mM - 0.4 uL
Primers 20uM - 0.5 uL
Nuclease free water -
TOTAL: 13uL + 2uL (40ng) of DNA
What else can I do?
Relevant answer
Answer
In addition to what Charles D Anderson is suggesting are you doing all of these experiments so far on a single dna sample. If so has it ever amplified with other primers?
Does it have a good OD260/280?
Are you getting a primer dimer small diffuse band of about 60BP with your primers?
Can you borrow a dna sample that has amplified from a colleague in case of either poor quality dna or a polymorphism under one primer in your sample?
  • asked a question related to PCR-RFLP
Question
6 answers
I used HotShot protocol to extract DNA from pig ears, needing to do PCR RFLP. Most of my samples I had successful PCR first time, and succesfsul RFLP. For some samples I only get very faint bands, even after extracting the same animal a second time. Most recently I played around with adding 0.5ul for samples with a concentration between 100-200 ng/ul, and add 1.0ul for those with concentration 50-100 ng/ul, to a 25ul reaction volume. The 260/280 is low, around 1.2-1.6. I know my primers, reagants, temperatures etc all work, it seems to just these last 30 samples are finicky. What can I do to get better amplification using this "dirty" DNA?
Relevant answer
Answer
You probably have pcr inhibitors present, These can often spoil the reaction by removing or chelating Mg ions essential for the enzyme to work. For samples that do not work I would double the amount of Mg and amplify less dna. Run 1/2, 1/4 and 1/8 amount of dna. Often less dna means less inhibitor so more amplification. Add a couple of extra pcr cycles as well will do no harm
If that fails then re purify the poorly performing dna.
You can test for inhibitors by adding some poorly performing dna to a good dna and amplifying. Use the good dna only as a control. If the added dna spoils the reaction then you have pcr inhibitors present in the poor sample
  • asked a question related to PCR-RFLP
Question
1 answer
Hey all,
I am about to do a research the requires investigating a SNP in the promoter of the bradykinin 1 receptor B1R (G-699 to C) substitution.
The paper I found uses SSCP and [32P] - alpha dCTP. Can I skip the denaturation of the PCR product using formamide dye and use normal dNTPs and EtBr for staining after digestion?
Relevant answer
Answer
Since it is RFLP then one snp base creates a restriction site and can be determined by cutting the pcr product and either getting 2 fragments ( cuts) or 3 fragments (one allele cuts and the other does not cut) or 1 band ( neither allele cuts).
If your snp does not create a cut site you can use a mismatched primer to create a cut site from almost any sequence using the DCAPS technique to prove that any sequence exists at a particular position but labelled ntps are not necessary to show the existence of a base at a snp position
  • asked a question related to PCR-RFLP
Question
11 answers
Dear my professors and colleagues,
I prepare a review about use biotechnology and molecular marker at poultry breeding.
I want your help.
Relevant answer
Answer
Hello Dr. Esteftah
I recommend for you the following chapter
"Selection Methods in Poultry Breeding: From Genetics to Genomics"
Good Luck
  • asked a question related to PCR-RFLP
Question
3 answers
When i use PCR-RFLP technique to detect SNPs in Wnt5a markers in cases and controls patiens i just have heterozygous genotypes however i never find a homozygous and am wondering why!?
It should be noted that the assay was performed with the Mluc1 enzyme following the manufacturer's recommendations
Relevant answer
Answer
Hello Angel
First of all, ampliphication the amplicon must be detected by gel electrophoresis. Then the amplicon incubated with the restriction enzyme. Are you do that?
  • asked a question related to PCR-RFLP
Question
2 answers
I have read that the MseI restriction enzyme can be used for 2 SNPs like rs2231142 and rs628031. Is it true?
Relevant answer
Answer
rs2231142 has a sequence of
CACTCTGACGGTGAGAGAAAACTTA[A/C/G]AGTTCTCAGCAGCTCTTCGGCTTGC
and alleles of c or g or A so the MSE1 cut site of TTAA only exists for one of the 3 alleles and will not distinguish between the C and G alleles.
rs628031 also has alleles of A, C or G so in its sequence
CGTGGGCCGCATCTACCCCATGGCC[A/C/G]TGTCAAATTTGTTGGCGGGGGCAGC
Mse1 cuts TTAA and this sequence does not exist for any allele of rs628031 so the enzyme does not cut this sequence at all so is not useful
  • asked a question related to PCR-RFLP
Question
2 answers
I want to study SNP in CYP2C8*3 (rs11572080 and rs10509681) by PCR-RFLP and I want to know the suitable restriction enzymes for this purpose.
Relevant answer
Answer
Thanks for your answer
  • asked a question related to PCR-RFLP
Question
21 answers
Which type of PCR techniques is the best in your opinion?
There are several different types of PCR techniques. Any technique is used as the best for most reliable, accurate diagnosis, fast, and lower cost.. in your opinion? Why?
Please, Share your experience in this field.
All appreciation for all contributions.
Relevant answer
Answer
Dear Dr.
Shaban A. A. Abdel-Raheem
, Thanks for your participation in this discussion.
Regards.
  • asked a question related to PCR-RFLP
Question
3 answers
Hello All,
I did whole exome sequencing (WES) on mouse tumors. We want to validate detected potential neoantigens before we do any further experiments. Basically, we want to make sure that identified missence mutations (only 13) are only selectively expressed by the tumor cells and not gremlin mutations. To answer this question, should I do PCR–RFLP/any other PCR methods or targeted sequencing, in order to get this data published?ANy other suggestions?
Thank you,
Reham
Relevant answer
Answer
Do you have WES on matched normal tissues?
  • asked a question related to PCR-RFLP
Question
5 answers
I want to use RFLP-PCR to different An.minimus group. But I do not have BsiZ I, which RE could I replace?
Do you know which RE can separate Hyrcanus group by RFLP method?
Thanks
Relevant answer
Answer
Hi Thai,
Paul was so closed, try NEBcutter (http://nc2.neb.com/NEBcutter2/) and see which replacing enzyme you could use.
fred
  • asked a question related to PCR-RFLP
Question
5 answers
i had designed primers for two sequences using blast tools in NCBI but they gave poor amplification lower than the ladder after gradient pcr
i want any one to check them and help me in designing new primers
the sequences and designed primers are attached file
Relevant answer
Answer
Hi Noha,
I only tested the first set of primers. ok they are not perfect (see attachment I produced in Oligo7) but it's not catastrophic and you should have some amplification. I also tested your primers in the UCSC insilco-PCR tool, it gave an amplification in human WNT5A gene. if you're testing cancer samples, maybe this gene is affected or bears some variants in primers sequences.
but as Paul and Thibault advised, you should take the protocol and see what could be wrong.
fred
  • asked a question related to PCR-RFLP
Question
3 answers
i have designed a primer but i found it gives 200 hits over than the intended sequence (5 of them in the organism that i work with). this give poor pcr results. i want to avoid this but i don,t know the way
Relevant answer
Answer
Hi, which species you are working with? I suggest to make the multiple alignments of the 5 sequences that are the most similar to your target sequence in your organism. Then identify the places where you find nucleotides that are specific fro your target gene and design the primers in the areas where you found more specific nucleotides. There are other important aspects as the location of the specific nucleotides in the 3' end to increase the primer binding specificity.
For a better understanding, it is better you check this paper that explains a tool for designing sub-genome specific primers in wheat
you can even consider to use this tool to perform the multiple alignment of your sequences and the the software is able to suggest you some primers pairs adequate for your target sequence. I hope this helps.
  • asked a question related to PCR-RFLP
Question
12 answers
i do a study for a gene expression in HCC patients compared to healthy person using real time pcr. i have analyzed ct for gene of interest and house keeping gene in each sample either HCC or healthy persons. i have calculated delta ct for each sample by subtracting ct of housekeeping gene from ct of gene of interest. now i want to calculate delta delta ct. i didn't make a calibrator through my run. some colleagues suggested to consider the sample (either from patients or healthy) of highest ct is my calibrator to be subtracted from all the samples to calculate delta delta ct. i have add my result in excel sheet.
Relevant answer
Answer
Hi,
You should first take a look to your housekeeping gene CT .
A CT above 30 make no sense, it should be in the range of 22-28
Then, the CT in your patient groupe above 40 may indicate that you have almost no CDNA in your sample.
Can you give more information about your RNA extraction in patient and healthy ?
  • asked a question related to PCR-RFLP
Question
4 answers
in the synthesis of TaqI endonuclease using Ecoli strain by NEB company for example, where from they get the gene coded for this enzyme, what is the function of this enzyme in the original organism and by what technique can be extracted from E- coli?
Relevant answer
Answer
An optimal purification procedure is dependent onquaticus, in the host organism, the enzyme provides defense from viruses and other invading DNA.
I do not know what methods NEB uses but Isolation of functional thermotolerant proteins from mesophilic host such as E.coli is quite simple and involves induction of foreign gene, followed by cell lysis, and heat inactivation and precipitation of host proteins. Since TaqI is a thermotolerant protein from a thermophile, it remains active after heat treatment.
Other proteins can be purified by incorporating His-Tag or S-Tag, if protein tagging hinders activity, the tag can be removed by thrombin cleavage or similar methods. An optimal purification procedure is dependent on the scale of production and the intended use.
  • asked a question related to PCR-RFLP
Question
3 answers
Different methods are there to determine association of different genetic polymorphism with Vit D deficiency. most of the researchers have used PCR-RFLP method but some have used ARMS pcr method. i think ARMS pcr method would be simple. what you suggest?
Relevant answer
Answer
Hi Sajid
ARMS is used when the variation does not create or abolish a restriction site, and some time enzymes are too expensive so that the ARMS is prefered. you just need to design for your target a common primer, the mutated or wild type for the second primer, and of course a couple of primers at one different position/gene/chromosome just to be sure that both multiplex PCR won't fail. On the other hand, targeted NGS of the targets will give you what you're searching for and of course new results on your targets.
fred
  • asked a question related to PCR-RFLP
Question
3 answers
All other pcr reagents were added along with dna and primers so what should i do? Do i need to make the master mix again? Or i can use this one?
Need some experienced or logical replies thank you 😊
Relevant answer
Answer
if these are dna samples where you have very littledna then I think that the buffer,Mg , primers and dna will be fine so I would add dNTPs with more enzyme and expect the pcr to work. otherwise just run it properly as it should have happened first time
  • asked a question related to PCR-RFLP
Question
2 answers
Qubit 3 gives only DNA concentration but doesn't tell about its purity as in spectrophotometers (260/280 ratio). So i want to ask - how much DNA concentration (quantified by Qubit 3) is good enough for performing PCR-RFLP?
Relevant answer
Answer
Thanks.
  • asked a question related to PCR-RFLP
Question
6 answers
I have used the following procedures but am still having strong primer dimer bands while the desired product is absent.
The cycling conditions for PCR program that i used were 5 min at 95C for activation followed by 35 cycles of 95oC for 30 s for denaturation, 55oC for 30 s for annealing, 72C for 30s for elongation and a final cycle 72C for 10min for final elongation
the primer used are
F: CAGCCATACAGGGCATCCAG
R: ACAGATGGGTGTGTGGGGAT
and expected pcr product size is 250
please i need a help about what is wrong
Relevant answer
Answer
Hi
I hope you are fine
- First, make sure of the nucleotide sequence from Blast Program online
- it is possible to give the time instead of 30 seconds to be 1 minute in all cycles (denaturation 1 min, annealing 1 min and extension 1 min) to give chance of primers for catch in gene target
- using dilut concentration of DNA
- Try different annealing temperatures of 50 to 65 (gradient PCR)
Good luck
  • asked a question related to PCR-RFLP
Question
3 answers
needing to search about associated genes with RA
Relevant answer
Answer
You are going to need to provide a LOT more information to get any sort of specific advice. Talk you your mentor or advisor about your project. Read the literature for published protocols. There are good reasons to use each of those techniques. They have have limitations and challenges. There is no one "best" method.
  • asked a question related to PCR-RFLP
Question
9 answers
So I am trying to determine if there are a C421A polymophism of ABCG2 gene of some blood samples. During optimization of the digestion protocol, i managed to get a good result the DNA is cleaved perfectly (with 2 units of TaaI enzyme for 4 microlitres of DNA, total reaction volume of 10 microlitres for 1 hour in 37oC). But then, I went on with the same protocol using the real sample and somehow not a single band showed up. The uncut control (pcr product with no enzyme) showed a thick band in agarose gel, however all other products digested with the enzyme just disappeared. We tried to reduce the incubation time to 15 minutes and it still disappears. What is the cause and what can i do about it? I'd prefer if there are other solutions than buying a new enzyme/reagent if there are any
Relevant answer
Answer
DNA doesn't just disappear. My guesses are either:
you used a nuclease that degraded your PCR product into a smear
you didn't add enough PCR product to your digest to see bands after the digest & loading
you accidentally used the wrong PCR tube for your digest (it happens)
Run uncut PCR product as a size comparison, double-check your math for the digest, and if you still have the problem just buy a new tube of enzyme. Enzymes are cheap compared to your time figuring this out.
  • asked a question related to PCR-RFLP
Question
5 answers
Hello,
I am working with SNP genotyping by PCR-RFLP method. When I put the FASTA sequence of my target region in the NEB cutter to know the relevant cut site of the restriction enzymes, it shows cleavage affected by cpg methylation or cleavage affected by other methylation in case of some enzymes. Should I use those enzyme for genotyping my SNP locus?? I think if there is any methylation in DNA then restriction enzymes will not cut that site. Then how can I determine the polymorphic allele?? Is there any in silico method to check DNA methylation before doing RFLP??? Please suggest.
Relevant answer
Answer
  • asked a question related to PCR-RFLP
Question
9 answers
with electrophoresis appeared the faint smear with specific band, are this smear interfering with the results of sequencing
Relevant answer
Answer
thank you Dr. Wisam, that is good answer
  • asked a question related to PCR-RFLP
Question
5 answers
Hello, I have a problem with my digestion, and I want to know how can I separate my bands one from another, I have 3 fragments (291, 273 and 21), I want to see the fragments of 291 and 273 to identify the genotype, I tried with 1.5 % of agarose but I could not see the fragments, I used 110 v for 30 min, I want to know what conditions do you recommend to have a great separation of these fragments or you recommend that I use polyacrylamide gel?
Relevant answer
Answer
I agree with Paul, I can also suggest a longer gel because your bands will reach more than 3/4 of the total gel, I think the important thing is that you do the run slowly to separate, after digestion, the two bands,
  • asked a question related to PCR-RFLP
Question
4 answers
I genotyped my samples using PCR-RFLP. But there was a comment that I can also get haplotype from these genotypes. But how can I do that if I don't know the genotypes of the parents? Thank you.
Relevant answer
Look for SHEsis and/or SNPStats online programs for haplotype construction and analyses from individual SNPs data
  • asked a question related to PCR-RFLP
Question
4 answers
I have a research to find the resistance gene of Trypanosoma evansi to diminazyne drugs.
Well, there are two type of mthode that my supervisor offered to me, by using the RFLP-PCR or RT-PCR, but hosnestly I never know about these two methods, so could anyone here can help me which one the best methods to find the resistance gene of Trypanosoma?
Could you share the journal or link to read.
I am looking forward your sharing
Regards,
Relevant answer
Hi M. Mirza Nuryady
You can use a genetic screening using increasing concentrations of the drug to generate drug-resistant parasites, which genome afterwards you must analyse by NGS to identify the mutation conferring resistance. This approach would be useful, but you would need to be aware that potentially you would also find a mutation of drug-related transporters. So, a double confirmation would be necessary using specific RNAi cell lines.
Furthermore, you can do a genome-scale RNAi screens for high-throughput phenotyping in bloodstream-form African trypanosomes, as described in http://www.nature.com/nprot/journal/v10/n1/full/nprot.2015.005.html
  • asked a question related to PCR-RFLP
Question
5 answers
I've designed a novel Multiplex-T RFLP protocol for the simultaneous detection of a various strains of pathogens from a genus of bacteria. The multiplex design and gene selection mean that each strain of bacteria produces a unique pattern of amplicons of different length. I'm then using T-RFLP to visualise these fragments on an electropherogram, allowing detection of different strains simultaneously. As only the 3' of each amplicon is labelled with a fluorescent dye, is restriction digestion prior to T RFLP necessary? 
Relevant answer
Answer
Check first that the restriction is not essential in the process. For instance if 2 organisms both amplify 200 base amplimer but digestion cuts one organism to distinguish it from others then just the full length amplimer may be of limited use but if amplimer size defines your organism then you are fine.
best wishes
Paul
  • asked a question related to PCR-RFLP
Question
7 answers
Does anyone know, why would the amplification of CHD gene from female Chicken blood DNA gives only one band at 280-290bp in 3% agarose gel instead of two bands at 281bp and 310bp?
I have attempted with different PCR conditions to optimize the amplification of CHD gene, yet only a single band was shown in the 3% agarose gel.
If anybody have had similar experiences or any possible reason, I would appreciate the support. 
Thank you!
Relevant answer
Answer
Is your size standard separating well on your gels?
Are all your results from the same dna sample and if so can you try another sample in case there is a sample mix up or you have a sample with a polymorphism/deletion  on one amplimer under the 3' end of one primer
Is your negative control negative ( no amplification) to rule out contamination from male amplimer taking over the reaction?
what is the OD260/280 ratio of the dna sample?
Are these new primers or have they worked before in your hands?
  • asked a question related to PCR-RFLP
Question
6 answers
I want to design ARMS- PCR primers for use to detect the polymorphism of any SNP.
Relevant answer
Answer
Try this
PRIMER1: primer design for tetra-primer ARMS-PCR
  • asked a question related to PCR-RFLP
Question
12 answers
I am having this consistent issue with all my restriction digestions lately. The same reactions were fine a month back but now they are giving smearing of bands. I have changed all the components one by one, PCR reagents, res. digestion enzymes/buffers, template DNA, running buffer (TBE) even agarose. But the problem remains the same. The smearing is more initially and starts contracting with time giving thin bands with smiley effect. The PCR product runs fine. And its nothing to do with enzymes I guess, the PCR products when incubated without enzyme in buffers (I have changed the buffer vial also) also gives the same effect but not when incubated with water. I do heat inactivate and have also tried SDS/EDTA loading dye but no improvement. Please suggest where I am going wrong or which reagent might have gone bad??
Relevant answer
Answer
it sounds like too much salt in the sample...some from pcr buffer and some from the enzyme buffer.. try running less sample or adding some water to the cut sample before running the gel. Run the gel at a lower voltage for longer time. Make sure that the running buffer in the electrophoresis tank is fresh as old buffer can have organisms growing in it that may degrade you dna product as it runs
  • asked a question related to PCR-RFLP
Question
9 answers
If I am doing genotyping for Toxoplasma by RFLP-PCR but don't have a standard strain as a control, how to analyse digest results? 
Relevant answer
Answer
Thanks.
  • asked a question related to PCR-RFLP
Question
8 answers
Working with IL-10 polymorphism using a common reverse primer and two different allele specific primers differ at 3' end. After agarose gel electrophoresis Bands with different intensity was found. Little confused how to explain it. Template DNA concentration was fixed and DNA quality was equal for all samples. Does it matter with the type of SNP (purine/pyrimidine, purine/purine or pyrimidine/pyrimidine bases). Or how much i can rely on this techniques. Well, i am also trying PCR-RFLP for other SNP detection.
Relevant answer
Answer
I would recommend adding a -2 change in the primer as in Tetra-primer ARMS PCR (Ye et al. NAR 2001) since this will give further specificity to your primers. This is because although you have a mismatch at the end of your forward primers (for the two alleles), sometimes PCR extension occurs and you get faint bands for the absent allele and you would erroneously call that sample as heterozygote.
And Yes! The combination of alleles you have at a SNP does matter! Transversions are easier to detect than transitions (see Ye et al. for more details).
Even if you want to use your current primers, then always add positive control samples for your two alleles in 'every' run. This will help you to decide whether alleles are present . If you don't have positive controls (e.g. from sequencing) and your SNP is common (MAF > 0.05) then you could make a pool of let's say 20 samples and genotype that sample in every run.
Final QC step: Do HWE exact test (or Chisquare if genotype counts are above 5) and see if there is significant deviation. Allele specific PCR usually results in an 'excess of heterozygotes'.
Hope it helps.
  • asked a question related to PCR-RFLP
Question
10 answers
I'm trying to cut a PCR product using a fastdigest restriction enzyme for PCR-RFLP analysis. the enzyme is supposed to cut in a single location within the product. Upon digestion at 37 degrees for 1 hour I had four bands: one at the original size of the product (without cutting), the two products of cutting with the correct sizes and another band of a wrong size that is lower than the original product size by 100 bp. Any ideas about the reasons or suggestions for a solution?
Relevant answer
Answer
May I suggest another possibility Samira. Everything is fine and working as it should do.
You have a polymorphism at a restriction site and let us assume you are working with a heterozygote normal and mutant N and M amplimers. The three double stranded amplimers generated are NN, MM and an NM heteroduplex.  Let us say the mutant cuts then cutting this mixture give an uncut NN band. It also gives a fully cut MM amplimer giving the expected 2 small bands. The NM heteroduplex ,however, does not cut because the restriction site is spoiled BUT it does not necessarily run at the normal uncut size because it is a heteroduplex so has a bubble in the sequence so runs at a different speed from the normal ( often slower but not always I think ). I suggest the extra band is such a heteroduplex. To test this  idea amplify an NN and separately an MM and also a mixture of NN and MM sample. Cut all and see if the PCR process has produced the heteroduplex running at the size that you report compared with the NN and MM cut products. Alternatively just heat a mixture of NN and Mm amplimers and let them cool slowly and cut the resulting mixture and see if your extra band appears
  • asked a question related to PCR-RFLP
Question
7 answers
I did RFLP of PCR product and electrophoresed the RE digested products on 3% agarose. RE digestion should provide band of 217 bp and 54 bp DNA.
I am getting band of 217bp but unable to see 54 bp DNA band. I have tried 16% PAGE but still unable to observe. I am doubting if the smaller band is getting run out too fast or else it must be coming with primer dimer. Guys I would be glad if you have any suggestions for this.
Relevant answer
Answer
Try using less primer if you think it is in the same region as the primer dimer, especially if your primer dimers are very strong.  This just means that the forward and reverse primers are dimerizing because they are not being utilized in the PCR reaction, so theoretically, a lower concentrated primer mix shouldn't hurt the reaction significantly.  maybe try 5mM if that's not what your already using.  
  • asked a question related to PCR-RFLP
Question
2 answers
Please, can anyone send me the protocol and the restriction enzymes
Relevant answer
Answer
Thank you
  • asked a question related to PCR-RFLP
Question
3 answers
I want to digest my PCR product using two restriction enzymes (HhaI- 37 0C and TaqI- 65C). Which is the best way to digest in a double digestion. Which one has to be used for digestion first as both have different incubation temperatures. Kindly give suggestions. 
Relevant answer
Answer
First of all, see if the two enzymes can work in the same buffer. These two enzymes from NEB are 100% active in buffers 3.1 and Cutsmart. Now restrict with HhaI at 37C for appropriate period of time and heat kill HhaI. Next, add TaqaI and restrict at 65C for appropriate period of time. I recommend to heat kill first enzyme to make sure that its presence at suboptimal temperature is not leading to unspecific restriction (star activity). 
  • asked a question related to PCR-RFLP
Question
5 answers
In the literature we can find different targets for each fungal species using different techniques like PCR-RFLP, PCR-sequencing, fingerprinting, etc.
How can we (young researchers) find the best and the most reliable target and method?
Relevant answer
Answer
Hi Shahram
The most reliable molecular technique identify fungi to species level without doubts is DNA sequencing. The main molecular marker to sequence in order to identify species is the region of the nuclear ribosomal internal spacers commonly known as ITS.
In this paper you find the whole discussion of this topic:
However, the molecular technique, and the DNA region will always depends on your objective, fungi of interest, the sate of your knowledge, and research questions.
For example, if you made an experiment of several known species from whose you already have their ITS sequences, the new samples can be identified by PCR or RFLP. In contrast, if you have several species of unknown identity you will have to sequence them.
good luck
  • asked a question related to PCR-RFLP
Question
8 answers
i want to know what is  better to use real time with sybr green otr taq man for quantification of miRNA
Relevant answer
Answer
Hello Noha,
Both stains allow for the detection of nucleic acids, however there are a few key differences. SYBR green will nonspecifically stain any nucleic acid with the highest performance on double-stranded DNA and lower performance on single-stranded DNA and RNA. Taqman probes make use of the 5'-3' exonuclease activity of taq polymerase during polymerization. The taqman probe is a complementary DNA sequence that has a 5' fluorophore and a 3' quencher where the fluorescent signal from the fluorophore is silenced by the adjacent quencher until it gets cleaved during the PCR reaction to give a fluorescent signal. Since you want to quantify micro RNA I would suggest doing a reverse transcriptase PCR with real-time monitoring using a taqman probe or a molecular beacon. This will be more specific than SYBR green, however you will have to order a probe specific to each target and it will be more expensive.
A more economic method is to do the reverse transcriptase PCR and run your products through an agarose gel stained with SYBR green. If there is only one band, then the reaction is specific at the annealing temperature used and you can repeat the reaction on a real time monitoring platform. If there are multiple bands, all of the extra products would result in an overestimation of your product during real time monitoring because SYBR green will bind no specifically to all of them!
Good luck!
Alex
  • asked a question related to PCR-RFLP
Question
6 answers
What is better, the  use of total RNA extraction kit or mi RNA extraction kit to extract miRNA from serum or plasma . What is better for whole blood?
Relevant answer
Answer
special Kit for miRNA now is present to the best of my knowledge
  • asked a question related to PCR-RFLP
Question
10 answers
Does it hamper restriction digestion if I am using directly the PCR product showing primer dimers or non specific bands instead of cutting out the specific bands from the gel.
Relevant answer
Answer
Dear Ankita,
if your PCR product seems to contain only one bad of desired MW, you can use PCR purification columns. However, if there are additional bands which appear to be products of nonspecific reaction, I wolud recommend purification of a band excised from the gel. Personally, I always use the second method, but maybe I am to cautious.
Yours Marcin
  • asked a question related to PCR-RFLP
Question
4 answers
I am performing rpoB PCR and then RFLP by the enzyme Hae III and MSP I. Now I want to store the digested product before gel run for 1 night at 4 degree cantigrade. Would it be good for my product?
Relevant answer
Answer
Hi Mahfuza,
As Gaurav mentioned above, you should store it at -20 degrees. The chance of further digestion by restriction enzymes (in case you have not inactivated them) and attack by nucleases (if any present) is negligible at -20, so its better than 4 degree storage
  • asked a question related to PCR-RFLP
Question
8 answers
I want to assess genetic diversity of a plant species from its entire distributional region. I used SCoT and intron based marker to assess the diversity among/within the populations. 
 Can I use PCR-RFLP (e.g. matK-RFLP) for assessing genetic diversity of that plant species? How many restriction enzymes can I use for this?
I am doing phylogenetic reassessment of some closely related plant species with some chloroplast and nuclear markers.
Can I use PCR-RFLP for discriminating species complex at lower taxonomic level??
Relevant answer
Answer
Be very wary of a measure of diversity that is based entirely on a single type of lab marker.  What the conservationists and breeders should really be concerned with is functional diversity, which often can only be clearly and reliably expressed in real-life environments, in 'common-garden' experiments.  While there is typically a broad agreement between marker diversity and functional diversity there can be exceptions which depend on the taxon, the functional traits involved and the marker type.
Choice of marker type can depend on several factors, including: available equipment, cost trends in marker types, and (if known) how well different marker types reflect functional diversity in the particular taxon/taxa.
  • asked a question related to PCR-RFLP
Question
3 answers
I am doing RFLP of the PCR products of PDE4D gene SNP 45. Thus, I need to know the restriction enzyme for its digestion.
Relevant answer
Answer
it appears to be hpych4iii please check the  attached sequence and restriction site from neb cutter
paul
  • asked a question related to PCR-RFLP
Question
2 answers
Dear all
I need your advice, I'm working on genomic DNA from hepatocellular carcinoma patient. I make screening for specific single nucleotide polymorphism using PCR rflp . I use the restriction enzyme (Hpy99I) for cutting my DNA after PCR but it cut only 3 samples out of 50 sample. When I have read about this enzyme, I found that it can be blocked by methylated DNA. I want to know how can I make sure that It is not blocked by methylation
Relevant answer
Answer
I assume that you have isolated genomic DNA, and have produced PCR product using this DNA. A PCR product will not methylated, even if the genomic DNA is methylated, because you do not have any methylases in your PCR reaction mixture. If you use Hpy99I on genomic DNA, it will not cut the site where CpG methylation occurs. However, in your case, the reason why your PCR product is not digested by Hpy99I is possibly because of a mutation in the restriction site in the genomic DNA. When you amplify this region by PCR, the mutation carries over and the restriction enzyme cannot recognize it.
  • asked a question related to PCR-RFLP
Question
1 answer
i'm getting 190bp PCR-RFLP band, can you help which I couldn't find in any other research paper related to the subject and also I'm getting another 200bp band which is also new for me.
Further question, is the C allele has a 212bp band, because I'm still confirming?
Kind Regards
Relevant answer
Answer
Dear student,
to answer your question I should have more information: which gene and which region of DNA are you looking at? I suppose CSN1S1. If so, the C allele CSN1S1 should be characterized by a band of 223 bp.
Kind Regards
RAMUNNO L., COSENZA G., RANDO A, PAUCIULLO A, ILLARIO R., GALLO D, DI BERARDINO D., MASINA P. (2005). Comparative analysis of gene sequence of goat CSN1S1 F and N alleles and characterization of CSN1S1 transcript variants in mammary gland. Gene, 345 (2), 289-299. ISSN: 0378-1119, doi: 10.1016/j.gene.2004.12.003; ISI: 000227363200015; SCOPUS: 2-s2.0-13644266892
RAMUNNO L., COSENZA G., PAPPALARDO M., PASTORE N., GALLO D., DI GREGORIO P., MASINA P. (2000). Identification of the goat CSN1S1F allele by means of PCR-RFLP method. Animal Genetics, 31 (5), 342-3.ISSN: 1365-2052, doi: 10.1046/j.1365-2052.2000.00663.x; ISI: 000165797800018; SCOPUS: 2-s2.0-0033625991
Erratum. Animal Genetics  32 (1), 54-54. ISI: 000169325000020; SCOPUS: 2-s2.0-0034965790
  • asked a question related to PCR-RFLP
Question
4 answers
Hi everyone,
I have got this question for you. I have been working on a sheep lactoalbumin (LALBA) gene to seek for polymorphism via PCR-RFLP. My sequence has been digested by several enzymes (by HindIII) in a cyber molecular lab (www.restrictionmap.org) but in real all PCR bands could not be digested. In other words, there was no polymorphisms. Indeed some dude has explained this case but unfortunately, I am not able to reach out his answer to my question. Could anyone help me please? Thanks and my kind regards,
- Hasan KOYUN, PhD (Animal Molecular Genetics)
Relevant answer
Answer
Probably it's a stupid suggestion, but did you include a positive control to make sure your HindIII was cutting properly?! Otherwise, can you exclude the possibility that there are indeed no polymorphisms? You could give your PCR fragments for sequencing to be sure.
Best,
Cindy
  • asked a question related to PCR-RFLP
Question
10 answers
Why I did not get good digestion for phage DNA? I need to determine the diversity of phage isolates, and the approximate genome size from the fragments generated from RFLP. My concentration of phage DNA is 338.97 ng/µl & 1.93 at 260/280 nm. I used 1µl EcoR1 (NEB), 1µl (50x) buffer, 5µl DNA and 3µl Mill Q water for 10 µl reaction. 
Relevant answer
Answer
Hi Nattan, your reaction mixture should contain 1uL of 10X  buffer for 10 uL total reaction mixture. If you use 1uL of  50X buffer, you should bring the total volume to 50 uL. H2O should be 43 uL in your reaction mixture, You might have to add more DNA in this case.
  • asked a question related to PCR-RFLP
Question
13 answers
Dear experts,
I have done RAPD gradient PCR at different temperature by using takara pcr master mix without additional Taq DNA Polymerase and dNTPs. There is only one band upper ladder all the temperature (36-45 °C). RAPD primer synthesized from sigma.
Herewith I have attached gel image for your perusal.
Relevant answer
Answer
Hi, 
First, I agree with Jetty Ramadevi that the PCR conditions may false. I suggest using the following RAPD program that I used many many times and it works perfectly with all kinds of PCR machine brands and almost all DNA types whether from animal sources, plants or microbes. 
94°C - 2min     (1 cycle) Initial denaturation
92°C - 1min
36°C - 1min     (40 cycles)
72°C - 2min
72°C - 10 min (1 cycle) final extension 
I also suggest to adjust the reaction components as: 10pmol/µL of single primer, 25-50ng of genomic DNA.
 Good Luck !!
  • asked a question related to PCR-RFLP
Question
5 answers
We had already run PCR RFLP for a 1000 km line of forest habitat. Average distance between each habitat is about 250 km. Our target was 3 chlroplasmic region in a kind of plant. We really appreciate your help if you have any suggestion for color trend in segments (1,2,3 & 4) of bar plot.
P.S: the result has been captured by STRUCTURE ver. 2.3.4 
Regards,
Mahmoud
Relevant answer
Answer
Dear Dr. Seyed,
I think, you can do some statistical analysis like F-test.
Kindly enclosed some papers reveal some ideas may be help.
Good Luck! 
  • asked a question related to PCR-RFLP
Question
9 answers
We have undertaken a study to identify the potential SNP’s associated with PCOS in Indian Population. We selected few previously known SNPs and carried out PCR-RFLP method to identify the gene polymorphism. We need to check whether the polymorphisms show any deviations from Hardy-Weinberg Equilibrium (HWE). When we read the literature, we came to know that the deviations from the Hardy-Weinberg Equilibrium (HWE) or the Linkage disequilibrium (LD) can be estimated with the help of χ2 test. But we don’t know how to prepare or what all things to be considered while preparing the data sheet for the analysis and how to interpret the results? If anybody is willing to help us, we will be very grateful to them.
Relevant answer
Answer
All previous answers are suitable, but be careful to test HWE equilibrium on controls only. Do not test on patients as a variant strongly associated with the disease would sometimes show deviance from HWE in patients sample. Deviance from HWE in control subjects may result from genotyping errors, from stratification of the control sample...
You can also use the Haploview software to test for HWE in your control population (http://www.broadinstitute.org/scientific-community/science/programs/medical-and-population-genetics/haploview/haploview).
Regarding HWE deviance you have some papers about it:
Am J Hum Genet 2005 76:887-883 A note on exact tests of Hardy-Weinberg equilibrium.
Am J Hum Genet. 2005 Jun;76(6):967-86. Epub 2005 Apr 15.
Rational inferences about departures from Hardy-Weinberg equilibrium.
Eur J Hum Genet. 2005 Jul;13(7):840-8.
Hardy-Weinberg equilibrium in genetic association studies: an empirical evaluation of reporting, deviations, and power.
Ann Hum Genet. 2007 Sep;71(Pt 5):701-3; author reply 704. Epub 2007 Mar 27.
On the usage of HWE for identifying genotyping errors.
  • asked a question related to PCR-RFLP
Question
20 answers
i have made a gel electrophoresis for a 7 samples after double arms pcr . the guide paper mentioned that the amplicon is 117 bp but i have seen more than one band in each well
Relevant answer
Answer
Try to play around with the annealing temperature. Alternatively,  you can purify the expected band from the gel and try to sequence it.
  • asked a question related to PCR-RFLP
Question
1 answer
Primers were designed for LALBA gene based on coding squence (Exon 5) and for RFLP PCR product was cut EcoRI.
We have only seen two digested DNA bands on agaraose gel for 65 animals upon genotyping?
Relevant answer
Answer
I don't think that by means of only single restriction enzyme you would expect to find polymorphism specifically when you intend to investigate only one gene.
There are some critical issues that you have to settle before carrying out the experiment: (1) Is the LALBA gene polymorphic enough to yield patterns of variation? (2) Does the restriction site of the used enzyme (EcoRI) bare mutation hot spots within the analyzed fragment?
I would advise you either direct sequencing or choice of more than one enzyme that would allow to detect variability (or diagnostic enzymes). If  published sequences of the gene in question do exist in gene bank, you could apply RestrictionMapper on them and try to identify the suitable enzymes that could enable you detecting polymorphism within the gene. On the other hand, if there are no clear signs on hot spots variability within the gene that can be revealed by one or two enzymes (diagnostic enzymes), I would suggest that you choose different enzymes whose restriction sites could cover the whole sequence and which revealed signs of polymorphism; by doing so, you could increase your chance of finding variation patterns.
I hope this could help, good luck!
  • asked a question related to PCR-RFLP
Question
4 answers
I am studying the association of certain SNP with a specific disease, and due to several reasons I will use PCR-RFLP method for SNP genotyping, now I have two options:
a- To design and optimize my own PCR-RFLP method .
b- Or use previously optimized method
Which option is good for my research originality?
Thank a lot
Relevant answer
Answer
Either, but check wich options of endonucleases will cut/not cut your SNPs. You might find several options including isoschizomers that are cheaper or work better. Also worthed is to try the new enzymes that do the job in 15minutes.
  • asked a question related to PCR-RFLP
Question
5 answers
I need a list of best RAPD primers for bacteria.
Relevant answer
Answer
For  RAPD you need to test as more primers as possible using 2-3 strains and select the best  ones for all the rest bacteria. You can use as well primers in pairs.
It is better to take BOXA primer and maybe  REP and ERIC - they were used in many experiments. . If you digest DNA with rare cutters before RAPD, you will have more reproduciable results. Anyway, it is better to apply single adapter AFLP instead of RAPD - this method is suitable for agarose gel.
  • asked a question related to PCR-RFLP
Question
11 answers
Actually, I need this thermal cycler device in my lab. But the faculty budget for the devices this year and the next year is finished. Some colleagues advised me to search for other universities that have several used devices to give one to my faculty as a gift from university to a university
Relevant answer
Answer
Might be worth it to check out this web site of equipment donation program:
  • asked a question related to PCR-RFLP
Question
4 answers
it is my first time to use this technique (tetra-primer arms pcr). i want to know every thing about it. especially the percent of outer primer to inner primer. how can you calculate annealing temp for the four primers. i want to know whether i will use two annealing temp or just one. i want to know how to prevent primer dimer
Relevant answer
Answer
I'm have the experience to design tetra ARMS-PCR primers. This all contain 4 of primers (2 pair of primers) and it use for SNP genotyping. 
the percent of outer primer to inner primer 
I would say that, for the amount of primer that you should add, you need to optimize it first. For example I add just the four primers at 0.2 uM (same concentration) in the final concentration then perform the PCR and Gel electrophoresis to see the expected pcr product and then I estimate the primer concentration via the previous result and you should perform the PCR condition as a gradient as well (the annealing temp using between the four primer)
or you use this formula if the shorter product was to little RI/FO >1 and/or FI/RO >1  or  RI/FO <1 and/or FI/RO<1 if you got non-specific band
how can you calculate annealing temp for the four primers
You may not concern the Tm of your primer that much because from my experience those programs that use to calculate Tm of primer they will show you in difference Tm primer, for example: Program A is 55 where as Program B is 53 or Program C is 56 . This varies due to differences in calculation formula of the program. To solve this problem
1 use only one program 2 try to design the primer that give the similar Tm of four primer 3 Perform The Gradient PCR for example if you primer got Tm like this 52, 53.5, 52.7 and 51.9 you should do the gradient between 50 to 54 something like this 4 add just the concentration of primer by estimate from your previous result or the formula above  
i want to know whether i will use two annealing temp or just one
You can use both, this due to how you set the PCR condition. I use to set as four annealing temp too. One annealing temp also work in some target. The other target may need the Touchdown PCR too so it depend how you got your result and try to adjust from your result it would be better.
i want to know how to prevent primer dimer
It very hard to prevent the primer dimer. I think you should be concern your expected product first then you will concern about primer dimer later because sometime I also can not get rid of primer dimer if I'm do that my expected product will gonna gone. You can adjust primer concentration and you may estimate via the first result again.
Good luck
I hope this may answer all of your question and I send some paper about tetra ARMS PCR to you too
  • asked a question related to PCR-RFLP
Question
10 answers
I will do a tetra primer ARMS-PCR reaction. I will use four primers for each sample.
The four primers are different in melting temperature. I want one annealing temperature suitable for all the four primers.
Relevant answer
Answer
Hi,
In general I would suggest to separate them especially if their melting temperature are so different.
But if you really want to mix them, first when you design the primers you shouldn't make their temperature too different (5oC different is the common guideline) otherwise it would be a bad idea to mix them because either you lost one of the product or getting some unspecific bindings. Then I would suggest the gradient to find the best temperature for them, but you could start with 5 degree below the lowest Tm primer.
Goodluck!
  • asked a question related to PCR-RFLP
Question
25 answers
I did a DNA extraction, but I am not sure if the rehydration step was good or not.
The kit instructions told me to keep the DNA at 60°C for 90 minutes, but I only kept it there for 30 minutes.
Relevant answer
Answer
It depend on how big is your DNA (genomic or plasmid) and how dry it is. If your DNA is over dried, it's more difficult to dissolve completely. Bigger DNA will be more difficult to dissolve than smaller DNA. High temp and longer time will help ensure complete dissolving of your precious DNA. If this happen, it will not affect much in your PCR since usually PCR only need very small amount of the template. But keep in mind if you try to measure OD 260 nm of the uncompletely dissolved DNA, you may not get accurate quantification estimate. Make sure there is no visible pellet in your tube. In contrast, if your DNA is not dried enough, the time and temperature for dissolving is not a problem (your DNA will be completely dissolve in no time), but the residual ethanol will have bad effect in your PCR, it can inhibit your PCR reaction.
  • asked a question related to PCR-RFLP
Question
7 answers
I want to know the typical conditions for DNA rehydration.
How can I get rid of any remnants of ethanol?
Relevant answer
Answer
Hi Noha,
Ethanol is volatile, so if you have a pellet it will be white when wet and become transparent when it is dry.
To rehydrate DNA just leave it in buffer TE or water (TE will protect it better because it has EDTA, which will chelate Mg++, which is a cofactor of DNAses, and because it is pH'd at 8.0). If the DNA is fresh, a few minutes is fine. You can improve rehydration by heating at 60-65C for 5 min. If it is extremely dry, leave it with the TE overnight in the fridge.
From the kind of questions you have asked recently you are new to molecular biology. Welcome! I think that it would be great for you to read some basics and learn more, in excellent books and manuals like the 'Molecular Cloning' (see http://www.molecularcloning.com/) or the 'Current Protocols' (http://www.currentprotocols.com/WileyCDA/). These cover basic and very advanced aspects of molecular biology and I am certain you would find them useful in your research.
Cheers,
Ruben
  • asked a question related to PCR-RFLP
Question
17 answers
I have a DNA sample and I don't know is it good or bad, I will do PCR for it.
I want to be sure that the bands that will appear after PCR are the wanted amplicon and not a primer-dimer. I need a positive and negative control in my PCR but I don't know how to make these controls in PCR.
Any help would be gratefully received. 
Relevant answer
Answer
1. Use 3 PCR tubes to explain:
1. tube 1: water+ all PCR components (negative control)
2. tube 2: your DNA + all PCR components
3. tube 3: a DNA template + all PCR components (positive control; you know this DNA template will definitely be amplified a target fragment you want, do you have this kind DNA sample?)
2. If your intended target PCR size is 500 bp., when you run a gel after PCR, you will expect to see: tube 1: no band on gel, tube 2: 500-bp band on gel, and tube 3: 500-bp band on the gel.
  • asked a question related to PCR-RFLP
Question
3 answers
I want to know the difference between PCR-tetra primer ARMS, PCR-AS, and PCR-CTPP. I want to use the most simple one in the genotyping.
Relevant answer
Answer
All three are used for SNP genotyping/ allele calling. You can look at the description of each in following literature's and protocol to use them are also in same literatures. Good Luck.
  • asked a question related to PCR-RFLP
Question
4 answers
Could anyone suggest a concrete protocol based on PCR or RFLP to determine paternity of two male dogs in the presence of litter that was brought  from two known males? I mean pure-breed dogs when mother and both fathers are known and there is a need to detect which baby depends to which father.
Relevant answer
Answer
Dear Modestas,
Canine parentage kit is available for example from Finzymes, package for 100 reactions. In attachement you have panels of markers for parentage recommended by ISAG (included in Finzymes kit). To do parentage testing you need Genetic Analyzer, termocycler and other small devices and... a little expierence in laboratory work and data analysis. So, a good choice could be to order tests outside or to start cooperation with scientific laboratory. 
  • asked a question related to PCR-RFLP
Question
2 answers
I want to know the optimum conditions for having good results for tetra-primer ARMS-PCR
Relevant answer
Answer
First of all, you have to know what are the melting temperature of each primer. After this, you are able to start your experiment design. In the Tetra-primer ARMS technique, the primer balancing is one of the most important steps for having good results. Ye et al., indicates that a proportion of 1:10 for each outer primer/inner primer is the best balance. Other important step is the melting temperature used in the PCR cycles. You have to favor the melting temperature of the inner primers (It is suggested that the inner primer have a melting temperature lower than the outer primers). You can also, change the magnesium concentration of your PCR buffer and try some kind of touchdown PCR if the standardization of your PCR is difficult. I suggest that you read the Ye paper for mare information (http://nar.oxfordjournals.org/content/29/17/e88.full.pdf+html). But, the most important step in the etra primers ARMS-PCR is the primer design. You have to be sure about the specificity, location of the miss-match and the 3' pattern in your inner primer. You can also read a paper that I published where the Tetra primers ARMS-PCR was used to genotype a polimorphism in the bovine kappa-casein (http://www.funpecrp.com.br/gmr/year2013/vol12-4/pdf/gmr2523.pdf).
  • asked a question related to PCR-RFLP
Question
8 answers
What is touch down PCR? Whats its significance and how to interpret the results?
Relevant answer
Answer
It is particularly useful in increasing the specificity of PCR and at times quite handy in case of multiplexing.
Touchdown PCR uses a cycling program where the annealing temperature is gradually reduced (e.g. 1-2°C /every second cycle). The initial annealing temperature should be several degrees above the estimated Tm of the primers. The annealing temperature is then gradually decreased until it reaches the calculated annealing temperature of the primers or some degrees below. Amplification is then continued using this annealing temperature.
To be specific, generally results in specific amplification of desired PCR product without optimizing the PCR protocol.
1. Determine the melting temperature (Tm) of the primers (for the purpose of this protocol we will use 60C).
2. Set up a PCR machine with touchdown program (5 degrees higher than the Tm, that reduces ½ a degree per cycle until it reaches 5 degrees lower than the Tm).
  • asked a question related to PCR-RFLP
Question
4 answers
I need to covert binary codes that obtained from molecular markers such as RFLP, RAPD, SRAP, ISSR, etc. to something like barcodes. Is anyone can help? Is there any way or software? 
Thank you
Relevant answer
Answer
Dear Farhat
In fact if u had scored all ur binary data along with their obsereved amplicon sizes (molecular weight of amplified product) then through MS-Excel u can create a barcode.
  • asked a question related to PCR-RFLP
Question
5 answers
I am a new researcher that is trying to order generic primers that will find as much protozoan DNA in a sample as possible for sequencing. Some target species of interest include (but are not limited to) Cryptosporidium parvum, Giardia lamblia, and Toxoplasma gondii. Are there any known primers that could isolate a large variety of protozoan species? Thanks for any help.
Relevant answer
Answer
I've recently been amplifying protozoa from environmental samples and I think your best bet is to go with universal 18S. Other markers like COI, 28S, ITS etc. are much less common for protozoa in the databases. Which primer set you use is also largely dependent on how you're planning on obtaining sequence data: if you're attempting to culture then sequence, you can get away with amplifying the whole 18S region (but I wouldn't recommend culturing). If you're using subcloning, or high-throughput sequencing, you will need much shorter amplicons. EukA(F) and EukB(R) produce a 1800bp (give or take) amplicon, Euk 608F and Euk 1000R produce around 400bp. There are lots more though, you can also check out the PR2 database at http://ssu-rrna.org/index.html, or just google "universal eukaryotic 18S primers".
  • asked a question related to PCR-RFLP
Question
10 answers
I am going to use PCR-RFLP method for identification purpose. Is it necessary to have replications in the experience? Either in different clones or in amplification or in digestion?
Relevant answer
Answer
RFLP is a qualitative test giving you the answer yes or no. So you will not need replicates. Replicates are needed for quantitative experiments.