Science topic

Mutation - Science topic

Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Questions related to Mutation
Question
3 answers
I am doing site-directed mutagenesis for DNMT1 protein. I used PCR master mix as my DNA polymerase. After PCR, I used DPN1 enzyme to digest my paternal plasmid (dpnl: a restriction enzyme which cleaves only methylated DNA, while mutant one will be left) . After that I did a transformation into TOPO10 E.coli. I picked up the colony and sent for sequencing, but after the sequencing, I didn't get my desired mutant site, instead, the mutant is on the next site. My desired mutant is on Thr320-C, but I get it on 960 position. Is this a problem of polymerase?
Moreover, which polymerase is good for site-directed mutagenesis?
Relevant answer
Answer
Hi,
I too suggest you to move on to a high fidelity Polymerase like Pfu-Turbo from Stratagene. Also check for amplification of your plasmid on gel prior to transformation. Normally you will find enhanced fluorescence on agarose gel.
Another suggestion is to follow the protocol from Stratagene, since I had very good results using their protocol.
Question
2 answers
In the 2002 publication from the Sanger Institute, the most common BRAF mutation found in melanoma was denoted as V599E. However, majority of publlications now refer to this as V600E. Why the difference? Was there a correction published after 2002?
Relevant answer
Answer
The difference comes from different reference sequences.
For older, long known proteins, a difference of 1 aa often comes from the fact that a lot of proteins posttranslationally lose the initiator methionine and in the old days, people used to count only the aa of the mature protein (often because the aa sequence was derived by protein sequencing). beta-Globin is a good example where the HbS-Mutation is classically called E6V while according to HGVS nomenclature it actually is p.E7V. You will also find discrepancies in reports of proteins that have a signal peptide. For instance, the classical LDL-receptor literature counts aa without the signal peptide, while in more recent papers p.1 is the initiator methionine.
But here, the reference sequence has changed, just compare NP_004324.1 and NP_004324.2.
The Nature paper is a good example of how mutations should not be reported. The authors did not mention the reference sequence anywhere.
The correct HGVS nomenclature of the mutation using the recent ref seq (NM_004333.4 and NP_004324.2) is p.V600E.
Question
2 answers
 Ideally, I'm looking for an activating mutation that is not in the Ras signalling pathway. Thanks!
Relevant answer
Answer
Pik3ca* comes to mind, the constitutively active mutant for the PI3K catalytic subunit. Jax has a conditional allele.  > http://www.nature.com/onc/journal/v33/n17/full/onc2013167a.html
Question
2 answers
Dear all,
SEQC has published a nice paper to better improve our expectations about RNA-Seq data. I am wondering if SEQC would do a similar assessment for DNA-Seq such as somatic mutations?
Sincerely,
Woody
Relevant answer
Answer
Hello Woody,
A very nice paper indeed. For your question regarding DNA-seq you may want to check out the 'Genome in a Bottle' project (http://genomeinabottle.org/).
Regards, Christoph
Question
21 answers
BRAF V600E mutation has been considered as a hotspot mutation in melanoma. Vemurafenib (a BRAF inhibitor) was shown to have improved survival rates. In the NEJM paper of Vemurafenib, patients seemed died rapidly within 10 months. However, the life expectancy of the patients were 3 months or longer. Did Vemurafenib really work? I am confused.
Besides, Vemurafenib was treated twice a day and Dacarbazine was once per 3 weeks. Is it a fair comparison?
Relevant answer
Answer
Woody:
Thanks for your feedback. But although I share your yearning for further superior outcome benefits, I would respectfully take issue with your minimal perspective.
With:
  • a significant prolongation of both the duration of disease control (median response duration was 6.7 months) and life expectancy, with median overall survival at 6 months of 84% and a 1-year survival rate of 58%
  • and for M1c disease survival at 68%,
  • and for patients harboring a V600K mutation, the median OS of 14.5 months in the vemurafenib arm of almost double that of 7.6 months in the comparator
  • exceptionally high objective response rate (48%, approximately ten-fold greater than the comparator dacarbazine)
  • symptomatic response improvement within days of starting treatment
  • consistent PFS benefit, even in compromised-prognosis patients with elevated baseline LDH levels
  • off-trial: substantial number of patients on vemurafenib treatment for over a year, suggestive of the potential for prolonged and durable disease control
the designation of important clinical advance in the treatment of metastatic melanoma is not appreciably hyperbolic, and certainly not just "better than nothing".
And I would add that we cannot:
  1. reason from that we would like to see even better results - that is inarguable - to the claim that a significant advance has not occurred (the fallacy of excess expectation), OR
  2. nor can we deduce from the observation of 20% mortality at 3 months under dacarbazine - remembering this entails 80% survival - that this represents a significant fact about the efficacy of dacarbazine rather than about the distended TTR (time-to-response) of that agent (and many chemotherapeutic interventions) before significant benefits accrue and are measurable in overall outcome.
Note in this connection that median TTR (time to response) for dacarbazine was 2.7 months (and with substantial numbers of patients exhibiting longer duration to first TTR), so we cannot confidently say that the mortality statistics reveal more about efficacy than about the natural history of high mortality in metastatic melanoma coupled with a TTR for dacarbazine of almost twice that of vemurafenib (whose TTR was only 1.5 months) [in general it is the case that given most TTRs, mortality/survival statistics at 3 months have negligible clinically meaningful relevance, and only 6 month and later stats allow sufficient time for response and significant outcome benefit, bearing in mind also that TTRs are medians and so large subpopulations may not even begin to acquire measurable benefits].
Finally, we cannot forget the context: this is just, after all, monotherapy, and combination therapy (I look forward to some positive results from the clinical trials combining it with anti-PDL1 therapy; with antiangiogenic therapy (bevacizumab); and with certain molecularly motivated promising vaccine immunotherapies) I would predict will translate to substantially greater outcome gains: the day is young.
So:
The above observations collectively suggest that although we have a long distance still to go before eroding the tragic toll of metastatic melanoma, and hence before grand festivity, a sober and dignified celebration for the literally thousands more patients who will survive, and longer, due to vemurafenib than would otherwise have, is not unseemly at this time.
However we are in decidedly strong agreement on one matter: hyperbole rarely serves the cause of science, and it would be better for the medical media to claim a significant but incremental advancement rather than "breakthrough" progress, so as not to fan immoderate expectations.
Question
8 answers
A lot of mutation methods are PCR-based and the mutations in vectors are then transferred to host cells. Are there any ways to mutate a plasmid in the bacteria in vivo? I want to make random mutations in just plasmid to express higher performance protein.
Relevant answer
Answer
You can keep plasmid containing bacterial cells with 1% ethylmethanesulphonate (EMS) for 1 or 2 hrs to generate random mutations in plasmid.
Question
9 answers
Hi friends,
I have been working with a strain of transgenic mice with a mutated gene.  The mutated region was used as the mutant forward primer.  Therefore, anytime I get a PCR product, I am unsure if it is a true het or a false positive, as both sequences would contain the mutant sequence (because it was used as the primer).    
Can anyone help me with this?
Today I am running a PCR with 2 known hets (the original mice we received) and 5 WT from different labs as controls.  Is there anything else I can do?
I've attached a powerpoint of some of my gels.  My product is ~200bp.
Thank you!
Relevant answer
Answer
       Your work is very similar our work on the MdMYB1 gene published online: 09 August 2014 in Molecular Genetics and Genomics.
      In our work, we designed an allele-specific primer for one allele, designed another allele-specific primer for another allele. When both PCR bands were found, it is heterozygous; when one PCR band was found, it is homozygous.
    You may also try to design two specific primers. When both PCR bands were found, it is heterozygous; when a PCR band was found, it is homozygous.
Question
5 answers
When discovering a new disease mutation, in what way you will benefit from its classification to somatic or germ line from the clinical point of view? 
Relevant answer
Answer
Well I guess the main difference is that germ line mutations can be transmitted to offspring - either in a autosomal dominant or a recessive manner. Somatic mutations cannot and (presumably) were  caused by a de novo mutation in the somatic tissue.
An example of a somatic mutation may include mutations that lead to cancer in the adult, an example of a germ line mutation may be Duchenne muscular dystrophy.
Obviously germ line mutations can be de novo too - in which case they are unlikely to generate a phenotype in the person carrying the mutation but are likely to manifest in the offspring only.
Question
56 answers
We knew how nature selection works within the host but, regarding this question? Please do elaborate in the view point of “Role and Mechanism (if any) of natural selection in viral evolution, outside the host”.
Relevant answer
Answer
   "Are there any patterns in the outbreaks of viral diseases?"
   Each viral disease has it own characteristics. There is a mechanism of virus entry, then the incubation period in the host followed by manifestation of the symptoms. From onset of symptoms to end of symptoms  is usually the Infectious state.  After major symptoms cease, the patient recovers. that is recovered state.
    Also, each type of viral outbreak in a population has its own pattern. Mathematical theories are available to describe disease propagation in populations. Human to human or human - vector- human propagation follow different patterns.You can search for related publications.
Question
3 answers
Is this really what happens? If so, the three lineages would give rise to layers in organs such as the colon with three distinct patterns of ancestral somatic mutations. Alternately, organs could be created by pluripotent stem cells that locally create the layers of tissue observed. In such a case local elements of layers would to some extent share a genetic pattern of somatic mutations.
Relevant answer
Answer
Dear Gnanasekaran,
The wall of intestine developes from the endoderm-derived epithelium containing specialized intestinal stem cells, mesoderm-derived smooth muscle, vasculature, lymphatics and immune cells and fibrous connective tissue, and the ectoderm-derived enteric nervous system. Therefore also the mutations may be in each cell type and  tumors of the gut can be of the endodermal, mesodermal (mesenchymal) as well as ectodermal origin.
Best regards.
Pavel
Question
6 answers
Using this method, I want to calculate dN/dS value, my file contains a root sequence, some homologous sequence with site mutations, however I got dS=0, how can I explain, is that mean this site rarely come with mutations?
Relevant answer
Answer
Use PAML or HyPhy instead... HyPhy is nicely implemented at datamonkey server, you can get all the fancy selection models tested there. Please note that getting bioinformatic only proof of selection is usually not good enough.
Question
5 answers
I would like to generate mutations in the 3' UTR of my gene of interest, to determine if my microRNA still binds to it.
Should I change all the bases (7) involved in pairing and what bases should I change them to?
Relevant answer
Answer
I would echo Thomas Andl's comment.  If you are studying the isolated 3'UTR of your gene of interest in the standard luciferase reporter assays commonly used in the field, then mutation of 1 or 2 nucleotides (preferably in the middle of the nt 2-7 'seed') is generally enough and has a lower probability of disrupting local RNA secondary structure than mutating 6-7 nucleotides or removing 6-7 nucleotides.  As you're probably aware there are lots of caveats with these assays; in particular, false negative results are easy to come by.
Question
4 answers
I would like to amplify the cDNA of my protein of interest from the Baculovirus suspension. Actually, I would like to be sure that a specific mutation is well present.
Any recommendations?
Relevant answer
Answer
Hi all,
Finally, we succeeded to amplify a band a the correct size after purifying the DNA from infected cell with a simple kit to do plasmid prep! Thank you for all your suggestions. Best. N
Question
9 answers
Our group is working on a mutant which heterozygote shows much more severe mutated phenotype while the homozygous mutant shows less difference to the wild type. What theory can we use to explain this, If anybody can give us some advice?
Relevant answer
Answer
Hi Wilson!
You are probably dealing with a dominant-negative mutation. It usually works by that the mutated gene-product dimerizes with the wild-type and causes an adverse effect. 
For example, if a protein is supposed to form a heterodimer, the mutated allele can be incorporated because it can still "hitchhike" on the wildtype. To gain a protein with a new/adverse effect is often more deleterious than a total lack of the protein, explaining why the homozygous mutant shows a less severe phenotype. 
Hope this helps you!
Ellika
Question
1 answer
Hello, is anyone aware of examples of kinase inhibitors active against mutated forms of the target that show a higher potency against the mutated form of the kinase than against the wt? If so could you please send me the reference?
Thank you
Relevant answer
Answer
There are many examples. One of the first examples I am aware of is this one:
Question
3 answers
In a reaction that follows Michael-Menten kinetics, if a mutation changes Vmax do we know what the effect would be on Km or vice versa? Is there any theoretical study or empirical evidence indicating there is a general answer?
Relevant answer
Answer
A mutation (in the amino acid sequence of the enzyme) affecting Vmax may not necessarily affect Km. This is because the amino acids involved in binding of the substrate (kf, kr)  may not all be involved in the catalytic reaction (kcat). Thus a mutation may cause drastic change in Km with little or no change in Vmax. Hope this helps.
Question
2 answers
Could anyone tell me any technique involved in detecting of a flower cell which has suffered or undergone a mutation?
Relevant answer
Answer
Greetings, exact detection depends on the kind of mutation, however there are several options. First of all, some mutations (even the small one) looks differently under UV. But you need some practice to recognize them, and of course you need to know the inner variance of the WT to avoid false alarm. Another, and quite common way is the fluorescence quenching. Then you can compare the profiles of some aktinic light and its quenching protocol, for example using Linear discriminant analysis or just Mahalanobis distance from the WT. Some mutations causes changes in amount of chromozomes, and then you can label them by some fluorescence dye (beware most of them are quite toxic) and again do the comparison, classification, and so on.
Question
4 answers
I am doing work on a Bacillus strain which has antagonistic activity against B. cereus group. The putative peptide which responsible for antagonistic activity is supposed to be a non-ribosomally synthesized peptide. A partial amino acid sequence of this peptide has been identified previously. Its N-terminal was blocked during sequencing, so I don't have total sequence of this peptide. In this case, as it is assuming a non-ribosomally synthesized peptide, some putative precursors (sizes, 130-220 base pairs) have been identified of this antibiotic peptide. As these precursors are immature peptide, so if they are expressed by expression vector plasmid in E.coli host cell, they will not produce the mature peptide with antibiotic activity. That's why I think that there is an only way to identify the precursors and ultimately the gene cluster of that protein by mutation of the precursors. And these mutation must have to do in the genome sequence without using any plasmid. The genome sequence of my working Bacillus strain is around 48Kbp and I will use my working Bacillus strain as a competent cell. So my question is, how can I do mutation of these precursors in the genome sequence without out using any plasmid? 
Relevant answer
Answer
Thank you for your suggestion. But I'm still confused that how this crispr targeting site for RNA will be helpful for making mutation within whole genome sequence of Bacillus strain? @ Amanda R Decker
Question
4 answers
I am struggling to find literature clearly exposing the relationship between amino acid contact number and protein stability. In particular, I would like to know if this on average true that mutations of amino acids with a high contact number have more impact on protein stability than mutations at low contact number amino acids. Thanks in advance for your help, as you probably guessed I am very ignorant in this subject.
Relevant answer
Answer
Proteins with high contact number are likely to be buried in the protein core while those with low contact number are likely to on the surface.
Core mutations on average will be more strongly destabilizing
Question
8 answers
Dear scientists,
I am aware that tumor exome-seq data without a matched normal will have difficulty for distinguishing somatic and germline mutations. I aim to find "important" somatic mutations from the data. I know incorporating 1000 genome project would help a bit. However, there are still too many mutations. Is there a way to redeem this kind of suffering?
Thanks,
Woody
Relevant answer
Answer
This is a indeed a challenge. We are trying to build our own "common normal" over here that uses one of our matched normal samples as a "base" and adding other common polymorphisms on top, but it is still messy. Finding significantly recurrently mutated genes or hotspot mutations across a large cohort after comparing with such a "common normal" may probably be the best current way to find your "important" somatic mutations. 
Question
1 answer
We can differentiate a hyperproducer from wild type by CTAB and haemolysis but these assays are not promising if we are screening from large number of colonies. So I need to know methods for selection of general/specific mutants.
Relevant answer
Answer
Try 24 wells agar plate that will reduce the number of plates. Also try drop collapse assay that will help to screen more samples and it is a very easy method too. 
Question
2 answers
Salis RBS calculator (Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology., 27 (2009): 946 – 950.
Relevant answer
Answer
Here's a link to a Q&A interview with Prof. Salis, and a good explanation about this tool.
By the way, The RBS Calculator is now embedded inside Genome Compiler, which is free for academics to use. 
Question
6 answers
I have recently identified a novel mutation, but want to know the age of it. Are there any good methods/servers to do this?
Relevant answer
Answer
From my very limited understanding, the age of a polymorphism (and perhaps some mutations that do not compromise fertility) may be inferred from allele frequency, as suggested from the 1k Genome Project (Nature 491, 56, 2012).
Question
4 answers
Some mutation on NGS panels but struggle to determine driver mutation or SNPs. 
Relevant answer
Answer
try to check all the mutation predictors like CHASM, FATHMM, Mutation Taster, Mutation Assessor and Pholyphen2.
You will have an idea about the mutation if can be potentially pathogenic or not. 
Question
3 answers
I would like to know if we induce some chemical based mutation in native fungi genome we can come across some new metabolites? If so how it works?
Relevant answer
Answer
There is many review on the subject either by chemical mutation or by chemical/biological induction.
If you focus on chemical based mutation look in the references from that review.
Question
3 answers
I am targeting to evolve my E. coli strain to improve its organic acid tolerance. Currently, my strain has MIC of up to 0.1 % only. Higher than that, my strain won't grow at all. It would be preferable if the method is fast.
Question
6 answers
CRISPR/CAS system usually mutated a target gene to knockout the gene expression.
Relevant answer
Answer
visit addgene, you can insert a transcription activator upstream from the gene you want to express. https://www.addgene.org/CRISPR/activate/
Question
3 answers
I am interested in looking for those genes that are expressed more than five fold higher when p53 is lost or mutated.
Relevant answer
Answer
To add another resource next to John's very good suggestion:
Especially check Supplemental Table S1 that provides a meta-analysis of p53-dependent gene regulation compiled from six genome-wide gene expression studies. Genes with scores -5 or -6 are found repressed in almost all studies regardless of cell type and treatment.
Question
3 answers
Should it be an heterozygous mutant in the same transgenic background? Could it be a regular transgenic or also a wild-type non transgenic? 
Thanks!
Relevant answer
Answer
It does seem to be tricky situation, with multiple and random insertions. In this case, the expression profile amongst different lines, can be different due to these insertions, rather than the mutant allele.
As an example, you do see Position Effect Variegation (PEV) in plants when the transgene is inserted at different position. 
Ideally, yes, in the best scenario, you should compare the homozygous mutant in the wild-type background with a simple wild-type control. This will rule out the complexities arising out of effect of the transgene.
Just out of curiosity, how was this mutation line generated? Was it some chemical mutagenesis screen you did, like ENU or was the mutation generated by UV? In either case, there will be many more random mutations in the entire genome. You might have selected for your desired mutation by some screen. Then in this case, the best control will be F2 segregating population, in which your mutation will be segregating along with other random mutation. So, you chose your mutant with other random mutations and the wild-type allele (of your desired mutant) with other mutations as a control. You can pool the mutant and the wild type pool and have the RNA seq done, where the difference would be only because of your mutant.
I hope I am not making it more complicated, but it is important to have the right control to make any conclusion.
All the best.
Question
6 answers
I am looking to do DNA sequencing for mutated genes BRCA1 , BRCA2 in lung cancer so i need best methods,to determine  Mutations in these genes .by use PCR .Technique.can some one told me about that ??  
Relevant answer
Answer
As the above researchers told that you have to amplify the product you can go for SSCP. in sccp there is no need of sequencing. if you find any mutation then go for sequencing of that particular allele.
Question
6 answers
I infect 990 uL of 5aF' cells in 2YT at an OD600 ~0.5 with 10 uL of phage stock solution that is sequence verified to have my mutation. After a 30 minute infection I move the cells to media that has the new corresponding phage antibiotic and let the cells grow overnight. Depending on my desired LC size I might move them up to a larger container with fresh media. Upon centrifuging and trying to isolate the phage I seem to only get cell contamination. I have tried this at 30 and 37C cell growth, with isoelectric and PEG precipitation of phage, with several different mutations, even with filter sterilizing before the phage precipitation! The original stock solution was isolated from 5a nonF's and seems to be ok. Anyone know why I can't isolate the phage?  
Relevant answer
Answer
Have you verified that the mutated phage is not defective?
Question
7 answers
Insertion or deletion results in a frame-shift that changes the reading of subsequent codons and, therefore, alters the entire amino acid sequence that follows the mutation, insertions and deletions are usually more harmful than a substitution in which only a single amino acid is altered.
But between insertion or deletion, which of the two is more harmful?
Relevant answer
Answer
Hi there,
I don't think any general rule can be established on the effect of single nucleotide insertion/deletion. The effect will depend strictly on the sequence considered: insertion provoking +1 frameshift and deletion -1. Impossible to anticipate unless considering a particular target.
Question
5 answers
I am using Arabidopsis thaliana gene (4-coumaroyl-coa ligase 3) At4CL3 to express through E,coli strain BL21 (De3) strain. I used Pet28a expression vector to express the protein with 6xhis tag. I checked its expression level, but there is no any sign of expression. I am sure, the Bacterial strain contain the At4CL3 gene without any mutation. Do i need to do any codon optimization? Has anyone expressed this protein using E.coli (Bl21 strain).
Could you please share any information along with REFERENCE Papers related to my problem? 
Relevant answer
Answer
I've had similar problem with my protein and we resolved it using autoinduction medium instead of IPTG. The publication of Fox and Blommel, 2009 : "Autoinduction of protein expression" might help you.
Question
9 answers
I need to detect mutations in a gene and differetiate them from PCR errors 
Relevant answer
Answer
1. The easiest is to do two independent PCR reactions. Persisting mutations in sequencing of both are genuine.
2. Only mutations in the first cycle of PCR are fully clonal, e.g. will affect 100% of the product. Subsequent mutations will only affect 1/2, 1/4, 1/8 etc of the product. If you are sequencing cloned products, this is not helpful, but if you are sequencing the PCR product directly, you can estimate proportion of mutation. Depending on your biological system, this may be taken into account, i.e. do you expect the mutation to be homozygous, pure heterozygous (e.g. germ line mutations) or mosaic of variable proportion (e.g. somatic mutations, such as cancer).
And if working against a genome reference, don't forget that some "mutations" are actually SNPs.
Good luck!
Question
3 answers
I should correct the LRRK2 mutation on my cells. But I hope to know is it better to do the correction on fibroblasts (before reprogramming  them on iPSC) or on iPSC (after reprogramming)? And if there is a protocol published on how to do the gene correction? 
Thank you for your help
Relevant answer
Answer
Hey Nesrine,
in which particular mutation are you interested? There are isogenic lines (corrected) available, maybe this would be the easier way for you, to use some that are already available in a collaboration!
Otherwise: Zfn, TALENs, Crispr/Cas9 would be the tools for your task!
But I can tell you that's quite difficult...
Best
Jonas
Question
6 answers
One example of such a phytochemical might arguably be dodecenal. Due to the nature of this compound having a lipophilic tail and hydrophilic head, the tail can sit itself in the bacteria membrane while the head acts to mix with the water around it. As a consequence, the membrane is affected in such as a way that it gets "dissolved". So, to the experts out there, can bacteria become resistant to this type of phytochemical?
Relevant answer
Answer
It is very hard to say, but obviously changing the lipidome will take very long time to evolve a resistance against such phytochemicals. Further, it will be interesting to see weather such chemicals acts equally good on Gram +ve bacteria?
Though playing around with lipid bilayer hampers many vital processes, and it is hard to get a resistance against such compounds easily.
Question
3 answers
I know that IVS means intervening sequence. But what does the 2 stand for ? And what do they mean by G[+1] -> A ?
Relevant answer
Answer
I just wanted to add a few things to the very nice explanation above.  The +1 in this particular mutation refers to the position of the single nucleotide change (G>A).  The +1 means that it is the first nucleotide of the intron (intervening sequence or IVS), in this case of intron 2.  This mutation is described in GBA (glucosidase beta, OMIM 606463), the enzyme that is deficient in individuals with Gaucher disease.  This mutation is at a splice site and results in a drop-out of exon two. The "new" code without exon two has codons one and three joined together. The result in this case is a new stop codon downstream in exon 3. The result is a very truncated protein that lacks some of the essential functions of the secondary and tertiary structure of the wild type protein. 
Question
2 answers
Is there any specific mutated strain regarding this isolation?
Relevant answer
Answer
You can do the separation via a sucrose density gradient centrifugation.  It is not technically difficult to do but generating the sucrose gradient may take a bit of time.  You will probably need a gradient of about 20-45% (w/v).  The purple membrane should probably form a band around 25% in this set up.  If you use the right tubes you can puncture the side with a needle/syringe and extract the purple membrane directly.
About a mutant strain to use, you should look into using the Halobacterium S9 strain (http://www.pnas.org/content/98/5/2521.full).  It constitutively produces purple membrane (as opposed to getting turned on after the lowering of oxygen).
How can I mutate multiple lysine residues?
Question
84 answers
I want to find the ubiquitination site for my protein of interest, but it contains 29 lysines in total. Is there a way to mutate about 5 to 6 lysines (nearby residues) in a single reaction (may be like megaPCR?). I doubt site-directed mutagenesis is not an opt method and time-consuming for 29 mutations. Any suggestions please, Thanks Aravinth.
Relevant answer
Answer
Gene synthesis is usually the best method these days with costs getting very low. You could just order your double-stranded DNA sequence with 5 to 6 lysines mutated. Usually these companies will deliver your gene cloned into their standard vector, but you can pay them $100 or so to clone it into your vector. There's one company, for example, that has a price structure such that you could order all 29 mutants for less than $4000 total. 
Question
9 answers
Dear everyone,
I want to analyse the mutation genes in Pan-TCGA, provided in the supplementary of Mutational landscape and significance across 12 major cancer types (The dataset is converted in this format, see attach). For a better understanding of the analysis of mutation genes in these certain cancer types, I want to know where could I get the control set data compared with this cancer samples.
Which means, I want to get the data of mutation genes in the whole human genome for the normal people (without any cancer) as the control set.
Can anyone  enlighten me?
Thanks,
Miao
Relevant answer
Answer
Hi Miao,
If you have the possibility to download the BAM files from cghub (you or your supervisors need to go through an approval process for it and ultimately you will receive a key file to used with gere torrent), you can just browse and select the normal samples here:
Normal sample are marked with 10 (Normal Blood) or 11 (Normal Tissue) in the barcode: TCGA-XX-YYYY-10Z-.... or  TCGA-XX-YYYY-11Z-....
Where XX-YYYY are the institute and patient ID, the rest of the barcode contains much more info (lookup at TCGA pages for it)
After selecting the samples you need you download a metadata.xml containing various file information and use it with GeneTorrent.
I don't think Level 2 data are available with normal sample information, but I might be wrong. So without permission to get Level 1 data there is no way to download patient data like germline variations and so on.
I hope this was more or less what you wanted to know.
Question
1 answer
Can Swiss-Pdb-Viewer energy scores be used to predict stabilizing mutation? Can a decrease in total energy in SPDV be used to infer stabilizing mutations? Please add some references.
Relevant answer
Answer
Even though swiss-pdb viewer allows you to mutate the protein, I'm pretty sure it is not optimized for predicting the mutational impact on stability (i.e. mutational delta-delta-G). There are other tools especially suited for that, e.g. http://foldx.crg.es/
Keep in mind that the the correlation between the best prediction methods and experimental delta-delta-G values is quite low (around 0.5) partly because of very large experimental errors... so you should be careful regarding the use and interpretation of your predictions.
Question
6 answers
I want to search for non-competitive inhibitors for my protein of interest. There are so far no allosteric site published about this protein, but it has been reported that even after the orthosteric site been mutated, the protein activity was also suppressed while inhibitor presented. My question would be:
1) Do all proteins practically have allosteric sites? Does the above fact indicates the protein I am working on has one?
2) How can I suggest/discover one?
Thank you.
Relevant answer
Answer
A particular protein may or may not have allosteric sites that participate in its normal function. A chemical compound may inhibit the function of the protein by binding to a part of the protein other than its active site, even if that location plays no functional role normally. In some cases, a compound may inhibit an enzyme in a non-specific way, meaning that it does not bind in a 1:1 stoichiometry. For example, the compound may form aggregates that the protein sticks to, causing inhibition. In other cases, the compound may act as a denaturant.
Question
11 answers
I want to correct a single nucleotide transversion with Cas9. The mutation is heterozygous so I have one copy of the correct allele. Do I still need a homologous ssDNA donor sequence or can I just use Cas9+ gRNA only?
Relevant answer
Answer
Marek, you probably think that the wild type copy can be used as a template for correcting the transversion on the other allele.  But unless your CRISPR can distinguish the wild type and mutant allele, both alleles will be cut. Even if you do make such a specific CRISPR, having extra copies of wild type sequence in the donor DNA should largely enhances the correction rate. 
Question
5 answers
ssu1(fc73) mutation is an SNP, I would like to know if anyone has verified it by a different way than sequencing. I couldn't find a restriction enzyme to do it by now
gggattctggaaaCcaacgcttctga is ssu1 wild type
gggattctggaaaTcaacgcttctgat is ssu1 (fc73)
Relevant answer
Answer
Dear Ole, thank you very much for your help! by now, after studying the possibilities, we have decided to go for sequencing. We'll see, I will keep on mind all the suggestion
all the best,
Elena
Question
25 answers
I want to know that what is the role of mutation and crossover probability in GA. Because in one iteration of GA requires selection, cross over and mutation and evaluation.
Relevant answer
Answer
Crossover and mutation perform two different roles. Crossover (like selection) is a convergence operation which is intended to pull the population towards a local minimum/maximum. In an interesting aside, crossover is not one of the original genetic operators; Holland's original thesis used only selection and probabilistic mutation.
Mutation is a divergence operation. It is intended to occasionally break one or more members of a population out of a local minimum/maximum space and potentially discover a better minimum/maximum space.
Since the end goal is to bring the population to convergence, selection/crossover happen more frequently (typically every generation). Mutation, being a divergence operation, should happen less frequently, and typically only effects a few members of a population (if any) in any given generation.
Question
1 answer
In diabetic patients, there was a mutation in Ec-sod gene.  If we do same experiment with diabetic rats using the primers of human patients, then what will be possibility of getting mutation in ec-sod gene of diabetic rats. 
Relevant answer
Answer
I AM NOT GENETICIAN/ I AM EPIGENETICIAN.
EH SIDIBE TROPICAL ENDOCRINE EPIGENETICIAN POBOX 5062 DAKAR FANN 99000
How can the mutation in any protein or gene be measured?
Question
20 answers
I need to know the concept of mutation. How it can be measured?
Relevant answer
Answer
There are various computational methods to classify mutations and correlate them with phenotypic characteristics. First you need to sequence the gene/DNA or download sequences from database according to the need. You can look for SNPs, point mutations, Frameshifts, stops etc. In fact, mutations of the genes has been correlated with  the function of the encoded proteins.
Question
3 answers
Hello
 I am trying to genetically characterize strains of influenza virus, and after sequencing, I do my alignments CLUSTER W, and I get the phylogenetic trees for each gene.
I want to detect cites mutations (antigenic shift) on the HA epitope.
So, it be possible for any of you tell me how I can do this part?
thank you
Relevant answer
Answer
Fuzzy matching will detect  HA epitope variants easily. We did it this way in the recent work (Dalmau et al, 04/2014, AIDS).  You could also use pattern matching packages, such as prosite scan. If you are not familiar with pattern recognition packages and you do not know any programing you could isolate the HA epitope alignment regions as  follows: 1. Open the alignment in Word; 2. set font to courier and document size to 50% (otherwise the alignment might look disarranged); 3. search for the HA epitope (control/apple F); 4. select and delete residue columns  before and after the epitope sequence (in apple you select columns holding the option key). 
Question
3 answers
When using variants calling method to call mutations on Saccharomyces cerevisiae, how can I know if the called mutation is a true one? Are there some tools or database which could help?
Relevant answer
Answer
To know what is 'true' you need to define first of all what you believe to be 'true' mutation. Checking in IGV is a good idea. Also you can use a likelihood cut-off, if you use freebayes. It is also a good idea to filter out your reads after mapping to the reference for the mapping quality (>20)
Generally there can be a lots of pitfalls along the pipeline, and it can be helpful if you can describe your experiment in more details. This will help you to formulate what is 'true' and what is not. Did you do any crosses ? Do you expect single mutation? or multiple ones?
Question
5 answers
I have carried out mutation on single amino acid residue in a native protein published in RCSB. Then, for achieving native structure of a mutated structure I carried out MD simulation. Now I have all pdb of the entire span of a few nanosecond MD simulations. I want to check change in position of a single amino acid residue by RMSD change. Please suggest some methods.
Relevant answer
Answer
In antechamber should be possible or if you want to calculate the RMSD between two structures you can make by an atom-by-atom procedure using the maestro schroedinger graphical intereface, it is free for academics.
Or you can edit the pdb file of the two structures, delete everything but the residue and then use a openbabel
Ciao
Rino
Question
6 answers
I've been recently using DNA sequencing technology to search for intronic and exonic mutations/variations/polymorphisms present in gene of interest. How do I find its chromosomal locations? I can find the position of the variation (substitutions, deletion, insertion) according to the reference gene by using a software. But the nomenclature given by the software and by mutation databases far different then each other. Hence, I have lots of intronic variations of which I do not know whether or not they are already defined and their effect is already described.
Relevant answer
Answer
Have you ever try to see at ensembl site (http://www.ensembl.org/index.html). There are, generally, all isoforms described, and if you try in configure this page, at left part of site. You can ask to show SNPs, and on top you can find links with all isoforms and their structure. Good luck!
Question
15 answers
I am interested to induce a mutation in some lilium species because of very low variation and susceptibility to soil conditions. I want to use Sodium Azide as a mutagen but don't have any experience with effective dosage of this mutagen. I will use seeds, callus and scales as explants and after treatment with sodium azide, I will culture them in MS medium for better germination and higher success.
Relevant answer
Answer
In addition to the clear description by Kornelia Polok, I suggest not to use tap water for seed imbibition but reverse osmosis water as Chlorine or Chloramine in tap water can be very stable and react with the later added NaN3. Best to establish the suggested 'kill curve' using RO water all the way through. After the NaN3 treatment and before sowing the seeds, make sure that you thoroughly wash the treated seeds. Go for at least 8-10 washing steps using plenty of tap water. Here the tap water is better than RO as you want to get rid of any active NaN3.
Any suggestions about the protocol of injection of 4-hydroxytamoxifen in mice to induce cre-mediated recombination?
Question
5 answers
I am going to inject 4-hydroxy tamoxifen in mice. Does someone have a method for preparation? Has someone tried a suitable dose before?
Relevant answer
Answer
Hello Rania! Curious whether you were successful at this? What doses and recombination efficiencies did you get? All the best Harald
Question
3 answers
How many folds can a uvrD mutation rate be increased by using a biological mutagen?
Relevant answer
Answer
I have no experience with mutation rates in E.coli. However we have carried out extensive mutation studies with repair deficient strains of S.typhimurium. In these strains, induced mutation rates are always dependent upon the conditions used including the batch of cultured material although protocols are adhered to as similarly as possible. With a well behaved assay, induced mutation rates are concentration dependent below concentrations that are toxic to the bugs themselves. It is mandatory to use a reference to get background mutation rates and in the case of S.typhimurium assays this can be used to gauge the sensitivity of the particular batch under the particular conditions and can be used to standardise results between batches. In our work we have always tested a standard substance in our class of mutagens in parallel with any other test chemical from that class. The dose-response of this standard has been used to scale dose-response results for unknowns in different tests thereby overcoming the variability in sensitivity. In this manner we have been able to correlate test results in the same strain over many years with many different test batches. I would imagine, similar strategies would work in mutation studies with E.coli. One other point is that the induced reversion rates in different strains will be inherently different. In the case of S.typhimurium, TA100 detects point mutations whereas TA98 detects frame-shift mutations. The response of the latter is very much muted relative to TA100. A similar situation is probable with different strains of E.coli
Question
3 answers
Is UV the best way or not? How much time need for best efficiency? Could you explain for me the protocol?
Relevant answer
Answer
Question
2 answers
Does anyone know the part of the genome that could be easily affected (mutated) by crude oil pollution that I can sequence to check for variation between animals/fish from crude oil polluted and non-polluted communities?
Question
230 answers
I am trying to do a Site-directed mutagenesis for a single AA change. I am using the stratagene protocol with phusion for polymerase. My PCR protocol is
1 98 C for 30 second
2 98 C for 10 seconds
3 60 C for 30 seconds
4 72 C for 2 min 10 seconds ( I have a 4.2kb plasmid)
repeat 2-4 20 cycles
5 72 C for 5 minutes then 4 C
2 hour DpnI digest.
Purify them transform 3 ul into Top10 cells
So far I have gotten colonies every time. I have tested to make sure DpnI is working as well and when I use just parent template, I get no colonies.
My problem comes when I do the sequencing. Most of the time the mutation is not present. I have had one where some kind of weird frame shift happened. I have even a stranger result where I get the sequencing back and the site I want mutated has a mix of signal. It typically has a big peak and then a smaller peak of about 25% the big peak. The big peak is no mutation and the smaller peak is the mutation. I have used that same plasmid that gave me the mixed signal to re transform and send more colonies for sequencing and haven't had any luck getting a pure sample of mutated one.
So anyone got any input on what to do? Anything at all would be great.
Relevant answer
Answer
Hi Josh,
This is a very common problem in SDM because of the design of the mutagenic primer pair. The fact that they are complementary to each other reduces the possibility of the mutagenic primers to bind to the template. Hence, one way is to design the mutagenic primers to have extended 3'-ends/3'-overhang, so that the annealing region between the mutagenic primer pair is essentially shorter. This ensure a lower annealing temperature for the primer pair and ensure higher chance of annealing to the template.
Hope this helps.
Best wishes,
Jason
Question
3 answers
I would like to compare my experience with the isolation of coagulase-negative staphylococci after linezolid therapy, and consequent linezolid-resistance based on several mutations occurring in domain V region and/or L3-L4-L22 proteins.
Relevant answer
Answer
Very interesting observation. In my experience most mechanisms of microbial drug resistance are generally multifactorial in nature. There is an article that you might find interesting if you haven't read it already reporting similar findings in an ATCC strain of S. aureus. I have attached the article to this message.
Question
14 answers
We know that pre-core and core promotor variants of HBV are HBe Ag negative and it is also known that HBe Ag clearance or seroconversion can result from mutations, but are there any HBV with negative HBe Ag (specially in the seroconverted group) which are not resulting from mutations?
Relevant answer
Answer
HBeAg negativity at seroconvertion is measured by detection of available free antigen.Please note that no commercial ELISAs measure the immune complexes which contain both antigen and antibody.Seroconverted HBeAg negative conditions are actually antibody excess state rather than antigen excess state before seroconversion.
Question
15 answers
Is DNA sequence information sufficient by itself to solve this problem?
Relevant answer
Answer
To reply to James' suggestion that the recency of the passerines is supported by evidence that they have replaced non-passerines:- 
It is true that the passerine radiation of more than 5000 species is extraordinary, but I am not aware of evidence that this has been achieved by replacing non-passerine species, which are characterized by a radiation that is well-defined in time (Tertiary) and is remarkable for its expansion rather than its reductions. 
The argument about similarity between passerines is also problematical if it is based upon your experiments with naive observers and bird skins. One of the prominent features of passerines is their behavioral specialisations, including song, which can convincingly differentiate passerine species that are convergently similar in external appearance."Similarity" is a generalization with the implication that the 5000+ are not good species. It ignores differentiation that goes far beyond external appearance alone.
Question
13 answers
I am planning on comparing how diferent mutations function on a global transcriptome. For that I cannot use diferent cells (one mutated but not the other) as these cells would be genetically different. I have been reading and looking on internet and I could not find any protocol to induce specific-site mutation on gDNA from human cells. One choose should be to create a knock-out and then to transfect with mutated knock-in but I am working with enhancer regions.
Is there any protocol useful for this experiment?
Relevant answer
Answer
Maybe try in cellulo before in vivo (knock-in strategies). You can generate a virus with a reporter gene under the control of your enhancer (+/- mutation). See if the reporter gene changes expression in a stimulus and motif-dependent manner. Much faster turn around time than knock-in. If successful, then you can decide whether to pursue David's knock-in suggestion or go whole hog and do genome editing.
Question
12 answers
I need to identify the presence of particular mutations in the patients blood sample. As the sequencing of PCR product of the gene is a costliest thing, I would like to know the other methods which can be used to identify particular mutations.
Relevant answer
Answer
Hi,
I know my friend is using High Resolution Melt to detect SNPs. But it is quite hard to optimize and you need termocycler for qPCR.
I was once thought to use PCR reaction with primer 3' ending exactly on expected point-mutated nucletide. So the PCR would work only with one isoform. But I have nevet tested it. Maybe someone will verify this idea.
Best Regards,
Dawid
Question
14 answers
I have a gene of interest that increases cell motility in cancer cells. I have introduced a point mutation in it (changing only one amino acid) which leads to reversing its motility enhancing effect. How can I identify whether this change is due to the effect on signalling transduction or just a change in the structure of protein rendering it inactive?
Relevant answer
Answer
Hi Maham,
Is your mutant a dominant negative or are you expressing your mutant in knockout cells for your gene of interest???. If the second, Firstly I would check if the mutant protein is being translated by western blotting because your mutant protein could be missfolded and be degraded, and the effect on cell motility you see will be probably due to the fact that the protein is really absent. Once you test this you have many ways to address your problem. As Hussain says, you can check if your protein has lost its ability to bind known partners. If the protein has been crystallized you can test in silico if your change alters the structure of your protein. Perhaps the aminoacid you have change is placed in a conserved domain of your protein with known function. You can also study if the mutant is affecting the transduction of a signal; in this case look for in the literature signalization pathways that control cell motility and how to evalute if they are working properly.
Good luck!
Question
1 answer
I want an available technique.
Relevant answer
SSRs is a strong and reproducible test
Question
4 answers
DNA repair can identify and correct damage to the DNA molecules that encode its genome. Then what does our genetic system do when a bad mutation happens? Since mutation can't be fixed, is it possible that a second mutation could reverse the harmful effect?
I was reading a paper which showed that if a deleterious mutation followed a beneficial mutation then the epistasis between these two mutations were mostly protective.
Anyone know if there's any other studies which have made similar claims?
Relevant answer
Answer
The second paper discusses what you were talking about
Question
6 answers
I'm specifically interested in the following mutations:
Murine cell line with a p.K120M mutation
Human cell lines with p.E285H or p.E286K or p.R175H mutations
As far I know, the literature suggests that depending on the site of mutation, different p53 targets can still be induced while other targets not. On the other hand, what are the potential effects of these mutations on transcriptional independent cell death by p53?
Any literature suggestions are also welcome.
Relevant answer
Answer
Question
16 answers
In mutation breeding work, we use PEG to screen the drought tolerance mutant in rice
Relevant answer
Answer
Dear Myat, Generally field screening is followed for submergence tolerance studies. One article was published in 1990 on glass house method of screening. You can see the article for more information. The article is 'Submergence tolerance of rice – A new glasshouse method for the experimental submergence of plants' in Physiologia Plantarum Volume 80, Issue 4, pages 642–646, December 1990.
There is another procedure done at Paddy Breeding Station, Tamil Nadu Agricultural University, India for submergence screening. I don't know whether it is published or not, but you can try.
The evaluation of rice genotypes for submergence tolerance was performed under green house conditions. Rice plants were under normal conditions with six pots for each variety. After 21 days, a set of three pots for each variety was submerged in 1.5 m height plastic tanks filled with water. Plants were monitored at every 3 days interval (3rd, 7th, 10th, 14th days after submergence and 10 days after de-submergence) and leaf samples were collected for carbohydrate estimation. After 14 days of submergence, pots were taken-out from the tanks and evaluated for their level of tolerance. Recovery ability of genotypes was assessed after 10 days of de-submergence.
Please update your results. Thanks.
Question
1 answer
A Chinese family was reported with a heterozygous cytosine insertion in exon 10 (c.1546_1547insC), inducing a frame shift mutation of MEN1 in the proband and the other two suffering members of his family. This mutation was linked to a novel single nucleotide polymorphism (SNP) in intron 3 (IVS3+18C>T). What is the significance of the new found IVS3+18C>T of MEN1?
Relevant answer
Answer
I'm not clear about what you are asking exactly, so my answer is rather speculative. The c.1546_1547insC sequence variant (mutation) is relatively common in MEN: about 2.7% of cases. It may have been demonstrated that the IVS3+18C>T variant is found in most or all alleles harbouring the c.1546_1547insC variant. The correct term for this co-occurrence of these two variants is "association" rather than linkage. The simplest explanation for their association is that the disease-causing variant first occurred on an allele already harbouring the IVS3+18C>T variant. This latter variant may have no functional consequences, but that would have to be tested.
Question
5 answers
I want to use Modeller for modeling a chimeric protein with two known templates, but I have some problems with the command line. I don’t know how to write it. Is there anyone who can help me?
For example I want to use from amino acid 1 to 35 from template A and from amino acid 30 to 60 from template B and again from amino acid 55 to 100 from template A.
Relevant answer
Answer
Download and use Easy modeller.It provides GUI to the command line modeller on Windows OS.Hope your problem is solved:)
Question
38 answers
I read somewhere that mutation probability should be nearly 0.015 to 0.02. I wonder how this mutation rate will make any difference to the original chromosome?
Relevant answer
Answer
Before answering your question, let me briefly describe some basic and important concepts.
As you probably know, we should always accomplish a proper balance between exploration and exploitation ability of the searching/optimiser algorithm. Exploration (simply but not precisely) means searching search space as much as possible, while exploitation means concentrating on one point (hopefully the global optimum).
In GA, mutation operators are mostly used to provide exploration and cross-over operators are widely used to lead population to converge on one the good solutions find so far (exploitation). Consequently, while cross-over tries to converge to a specific point in landscape, mutation does its best to avoid convergence and explore more areas.
Obviously, we prefer to explore much more in the beginning of the search process (to ensure the population coverage and diversity). On the other hand, we prefer more exploitations at the end of search process to ensure the convergence of the population to the global optimum. There is just an exception; when population converges to a local optimum, we should (if we can) increase the population diversity to explore other areas.
According to the above facts, too high mutation rate increases the probability of searching more areas in search space, however, prevents population to converge to any optimum solution. On the other hand, too small mutation rate may result to premature convergence (falling to local optima instead of global optimum).In other words, too high mutation rate reduces the search ability of GA to a simple (and dummy!) random walk while a too small GA (without any other facilities such as niching or crowd-avoiding to preserve diversity) almost always fails to a local optimum.
As Larry Raisanen mentioned, the best value of mutation rate is very problem specific. You can try several values in linear or bidirectional manner. Remember, as Colin Reeves wrote, this value also depends on the nature and implementation of the algorithm.In my opinion, however, there is no constant best mutation rate for most of the real world problems. As I mentioned before, searching algorithm demands different exploration-exploitation ability in different stage of the search process. Hence, a more dynamic mutation rate, as Paulo Gaspar proposed, is more preferred. I believe you can find more complex methods which adaptively tune the mutation rate according to the problem and the state of the current population comparing with the previous ones.
Question
7 answers
Keyword: TILLING - PCR - mutation
Relevant answer
Answer
If we are speaking about a human mutation, typically a homozygote change is a deviation from the wild-type as you look at the sequencing chromatogram using a visualizing software like Mutation Surveyor for instance (like G to C); if the mutation is heterozygous, you will see a double peak, the wild type and the mutant (like G to G/C). You can then use a number of tools to confirm that besides sequencing. You can use a restriction enzyme after PCR amplification (the mutation can either abolish or create a restriction site), in which case the homozygous loses the wild type band completely, while the heterozygous still has the widl type band besides the mutant. Other old tricks are ASO and ARMS (you can look them up), heteroduplex analysis on a PAGE etc.
Question
3 answers
reg eE.coli strains
Relevant answer
Answer
The Coli Genetic Stock Center at Yale http://cgsc.biology.yale.edu/
Follow this link http://cgsc.biology.yale.edu/MutationQueryForm.php and put in "Name" : hfq , there is 2 strains.
Question
2 answers
By mutating a DNA binding site for a protein, I seem to have created a new binding site for some other protein. This speculation is based on a new phenotype being observed. Now I want to know if there is any software that can predict a protein binding to the mutated sequence.
Relevant answer
Answer
Thank you !! Yes it is a transcription factor in enterobacterial system. I have done GC rich 4 base pairs substitution. The mutation is downstream of +1. When I cloned it into a plasmid that carries transcriptional terminator at the end of the sequence, the host bacteria (MG1655) shows very slow growth in culture. The colonies on the plates are very small too. The mutated site is very important for my work. By DNase I footprinting I have confirmed that sequence as the binding site for a transcription factor under my study. Yes you are right. It is possible that formed mRNA might be inhibiting something.
Question
26 answers
I used Imutant, SIFT, POLYPHEN. Apart from them could someone suggest some other software and server for snp analysis.
Relevant answer
Answer
Amino acid substitutions can have many consequences (on protein stability / activity / folding / splicing / ...). If you want to do complex analysis, I recommend you to use tools such as SNPEffect (http://snpeffect.switchlab.org) or HOPE (http://www.cmbi.ru.nl/hope).
You mentioned three individual applications for different purposes: I-Mutant (stability predictor), SIFT (activity predictor) and POLYPHEN (pathogenicity predictor). In my opinion, dependence on single tools is not the best strategy because inaccuracies of these tools are still quite high. I prefer to use metaservers, i.e.:
If you want to know more about the tools focused on prediction of activity / stability, I recommend you these reviews / performance evaluations
Question
3 answers
Particularly in non-small cell lung cancer, there's a population of patients who carry mutations in the epidermal growth factor receptor gene. These patients are much more likely to respond positively to small molecular tyrosine kinase inhibitors than those with wild-type EGFR. What is the mechanism that underlies this differential response to anti-EGFR therapy?
Relevant answer
Answer
Mutations such as L858R and in-frame deletions in exon 19 of EGFR (all in the kinase domain of EGFR) confer over activation of kinase activity mainly by disrupting autoinhibitory interactions. This conformational change results in the the preferential binding of these small molecule inhibitors over the natural partner, ATP. Wild-type EGFR is not affected so. The result is a dampening of EGFR signaling. Tumours such NSCLC with these activating mutations in EGFR become "addicted" to this signaling pathway and thus these EGFR mutant patients respond best to these small molecule inhibitor therapies.
Question
4 answers
I am working on a gene which meets some mutations (2). We would like to know if the mutation affects the protein function. Someone has suggested MacroDox software. Does it work? What's your suggestion?
Relevant answer
Answer
Dear mahshid,
You need to perform molecular dynamic simulations on wild and mutate protein structure.
Best,
Question
1 answer
It might be an important predictor of outcome for young patients with pituitary diseases.
Relevant answer
Answer
https://www.ncbi.nlm.nih.gov › NCBI › Literature › PubMed Central (PMC)
Question
1 answer
I am trying to modify a mutation assay I have had success with in other suspension cell lines - PIG-A and have encountered some difficulties that I am hoping to troubleshoot with you all. PIG-A is a transmembrane (GPI) anchor, which functions to tether a variety of cell surface molecules to the cell surface. A null mutation in the PIGA gene results in the loss of this transmembrane anchor protein, and also the loss of all of these tethered cell surface receptors. Hence PIGA mutants can be detected by flow cytometry by looking for the absence of two or more of these cell surface receptors (to ensure that mutations in the genes of the cell surface receptors alone are not counted). I have had previous success with this assay in a lymphoblastoid cell line and generated some excellent mutation data which is about to be published. I am trying to adapt the assay for a myeloid cell line (HL-60), but am encountering problems.
The two GPI-anchored cell surface receptors I am looking for are CD55 and CD59, both of which are highly expressed on HL-60 and show significant binding with fluorochrome-conjugated antibodies.
As well as this, I am concurrently using an antibody to bind CD45 as a positive control and 7-AAD to exclude dead cells.
All antibodies show excellent binding, but even in 500,000 cells, I am not picking up a single one which appears to be a PIGA mutant (CD55 and CD59 negative). I have pre-treated the cells with an Fc Blocking agent to prevent non-specific binding of the antibodies and have checked the isotype controls to make sure there is no non-specific binding. I have also treated cells with radiation at a dose which I know should cause significant mutation as a positive control - and cannot see any PIGA mutations here either (8 days post treatment, which initially caused around 70% cell death). I would absolutely expect to see at least 5-10 PIGA mutant cells in 500,000 events, and far more in the radiation treated cells.
A few things I have considered:
I am using too much antibody and it is nonspecifically binding to everything causing false positives (I shall titrate it this afternoon and try with less antibody).
My compensation for the assay is incorrect and I am not seeing negative cells due to leakage from other channels (NB: All cells I use in the assay are EGFP+)
PIGA mutation is fatal in HL-60 but not in the previous lymphoblastoid cell line I have used.
HL-60 have a very low basal PIGA mutation rate and I have not left it long enough after the radiation treatment to allow the cells to fix the PIGA mutations and lose cell surface expression of CD55 and CD59.
Please note in attachment (gating strategy for PIGA) - CD19 is the control marker used in the lymphoblastoid cell line and is now CD45 in HL-60.
I realise that this is a quick summary of a not incredibly simple assay, which many will be unfamiliar with, so please do ask for more information/clarification if you think you might be able to help, i'll try to respond quickly.
Many thanks for any help - I'm at my wits end with this assay - there is no theoretical reason why it shouldn't work, but I am definitely not picking up any mutants at all.
Additionally - if anyone is interested in the assay - there has been a publication about it here (with different cell types to that I am using) http://www.ncbi.nlm.nih.gov/pubmed/20034593
Relevant answer
Answer
Dear Victoria, I don't have direct experience with HL-60, but I am working with a cell line that seems to need 3-4 weeks to fix the mutation, and I know that several cell lines need at least 2 weeks... maybe this is the case for you as well?
Question
24 answers
I'm trying to detect BRAF mutation by using melting curve analysis with SYBR green allele-specific PCR and melt-curve analysis - BRAF T1796A F CGCGGCCGGCCGCGGCGGTGATTTTGGTCTAGCTACCGA; BRAF wild type F GTGATTTTGGTCTAGCTACTGT; BRAF R TAGCCTCAATTCTTACCATCCAC. PCR condition :the PCR reaction was carried out with mutant forward (20pm), wild-type forward (20pm), and reverse (20pm) primers at 50 C for 2 min,
95 C for 2 min, and 40 cycles of 95 C for 15 s and 60 C for 60.
A 17-bp GC clamp was incorporated at the 5' end of each mutant primer to
increase the melting temperature of the mutant alleles by 5 C
wild-type samples produce single melt peaks at 80jC, whereas mutant samples produce either single peaks at 85 C or peaks at both 80 C and 85 C.
But I am getting getting peak at 83 in wild type and mutant sample .
Relevant answer
Answer
ok
Question
9 answers
I am planning to make some mutant p53 cell lines using the CRISPR system and homologous directed repair to introduce the mutant gene. What is the best way to determine if the mutant is homozygous or heterozygous?
Relevant answer
Answer
PCR might not discriminate if the alteration is point mutation. Isolate DNA from those cells and amplify the mutant region using PCR primers that are common to both mutant and WT p53 and sequence it. The mutant nucleotides will be half the size in intensity (peak height) and will have twin color, if it is heterozygous. If it is homozygous, the peak will be of single color for that nucleotide and will be of equal height as of adjacent nucleotides. See attached figure below.
Question
3 answers
I want to mutate an ALA to a CYS using COOT software, but I couldn't achieve my desired coordinates by clicking 'simple mutation' button. I found another button in COOT 'mutate and auto fit', but it asks for a map. Does anyone have an idea on what the map is and how I can generate one?
Thanks in advance.
Relevant answer
Answer
First, Coot is a software intended to crystallographic model building and correction. So, when Coot asks for a map for fitting a residue's position, it is an electron density map in .mtz format that is required.
If you just want to mutate a particular residue, click on the "go to atom" or F6, then chose your residue. Coot will automatically center its view on the selected residue. Then, click on the "simple mutate" button, click on the residue you want to mutate, and choose by which residue you want to mutate it.
A problem can come from this, which is that there is a supplementary sulfur on the new side chain compared to Ala, and coot won't be able to optimize the position of this new atom. You can try then the "regularize zone" button on this particular residue (this option doesn't require a map), but you can't be sure that the obtained position for this new atom is realistic or not... If you want to move only this atom by yourself and choose its position, you can also do it with the "Edit Chi Angles" tool, which will allow you to rotate around the Ca-Cb bond and thereby move the sulfur without moving anything else...
Hop this helps, good luck
Question
1 answer
I need this for correlating mitochondrial mutations of male infertility cases with mitochondrial haplotypes.
Relevant answer
Answer
Hi,
I think the best for you would be to check on Mitomap: http://www.mitomap.org/MITOMAP
Good luck!
Question
3 answers
I am having a problem in site directed mutagenesis. I am just trying to put one mutation in my protein and the sequence is 170 aa. Some portion of the sequence is fine after sequencing, but I found repeating sequence in the N-terminal area of the protein. During PCR, I used 59 C as an annealing temperature. Can anybody help me out in this issue?
Relevant answer
Answer
It is better if you give some details about your strategy used for site-directed mutagenesis.
Probably you may have designed primer pair with some complementarity towards 5'end carrying the desired mutation along with end primer.
What template you are using to create the desired mutation Is WT insert or plasmid containing the WT insert.
Have you performed the sequencing from both the side of your insert and getting the same problem.
Question
8 answers
What are the 'transformation' activities that can be considered adaptation but not mutation and vice versa?
I am currently developing a theory for the business model evolution. I am considering recalling the generic structure of the evolution theory to the paradigm of entrepreneurial firms evolution. The purpose of this question is metaphorical and not merely to enhance the conceptualization of my theory but more importantly I will support my theory with a full fledged differential equation modeling simulation. Hence I am intending to follow the generic mathematical definition of the evolution processes. Below in the comments you will find full details about the context in which I am using the evolution theory, and full description for the notions that I want to match it with evolution theory.
Relevant answer
Answer
It is difficult to answer, since the question is a bit vague.
Mutations are stochastic events that happen to individuals in a group. It can be a genetic mutation or it can be a change in a strategy. This depends on the context. The key point is that the mutation happens independently and stochastically.
Depending on the success it confers to the mutant (i.e. the individual carrying the mutation), it can be considered adaptive (mutant has more success than non-mutants), neutral (no difference between mutant vs non-mutant) or deleterious (mutant is less successful than non-mutant). Adaptation is what follows when in a population a successful mutation appears and eventually becomes the main state (succesful mutants take over).
Sometimes people refer to adaptation also as the outcome of the adaptation process. In this definition a mutation is any evident change (regardless of its effect on success), and adaptation is a change that made the group thrive in a given circumstance or environment.
I suggest you include a bit more of context. In this way you could probably get a more comprehensive answer.
How to avoid inbreeding problems when a species begins?
Question
12 answers
If there are a couple of individuals of a new species: how do they give birth to offsprings that will make a population without endogamy problems?
Relevant answer
Answer
Inbreeding isn't always bad. Theoretically, if there are no deleterious heterozygous mutations in a new population, the fitness of homozygous carriers won't go down.
Question
4 answers
Relevant answer
Answer
my knowledge tells me that it is very hard to induce mutations in plasmids as they are highly stable ,,, my guessing is any dose that will do it will be lethal to genomic DNA in bacteria
Question
3 answers
How does p53 signaling network affect cancer development? How is it that certain mutation in DNA are repaired effectively and others are not even with the involvement of p53 protein?
Relevant answer
Answer
Generally speaking, p53 pathways are "off". Stress signals (spindle damage, hypoxia, rNTP depletion, ribosome biogenesis, etc.) activate mediators in a complex network that can result in a number of "outputs" (from apoptosis to inhibiting other pathways such as the IGF-1/mTor). The central, most important component to understand is the core regulation (i.e., p53 & MDM2).
Question
2 answers
I constructed a mutation involving a loop deletion. Deleting a loop from a structure creates a hole in the polypeptide chain. I need to know how do you do a loop closure for this kind of structure. I can't remodel this mutant structure as it will change the entire structure and will differ from the wild type structures and will affect the stability as I need to proceed with MD simulation later.
Relevant answer
Answer
I think people use MODELLER for this kind of task, but I haven't done it myself.
Question
7 answers
I have been working with mutation breeding so I would like to know the easy way to calculate LD50 of mutated agents.
Relevant answer
Answer
It depends on what you are using as a mutagen and on the plant part.
In general for seed it is 50% inhibition of germination and if you are using vegetative parts it is 50% reduction in growth
I have some publication that you can look at
Software to predict the stability change of a membrane protein after mutation?
Question
45 answers
In other words, I would like to predict the change in free energy (ddG). I know that Rosetta can do it, but I'm looking for alternatives that also work for membrane proteins. I'm specifically looking for something else than MD simulations. Thanks for your advice!
Relevant answer
Answer
Haven't seen any but that doesn't mean it doesnt exist. Reasons why its harder to create one: 1. The machine learning techniques like I-Mutant need to be trained separately on membrane protein data. 2. there is a lot less experimental data on membrane proteins because the experiments are much harder 3. The knowledge based potentials used in programs like FoldX and DFire would have to be reparameterized for the membrane. The program would also have to recognize which part of the structure is in the membrane. Rosetta is the only one I know of that does this. There is some effort going on to get DFire at least to work with membrane proteins. Mutation induced structural variation in membrane proteins http://link.springer.com/article/10.1007%2Fs40242-013-2427-x
Question
1 answer
-
Relevant answer
Answer
Slippage occurs when the growing strand temporarily dissociates from the template,In case of homopolymers it can reassociate at a different spot - say, one nucleotide forward or back from where it started. This will make every individual band becomes a family of closely-spaced peaks giving a 'roller coaster' look to the chromatogram. Which is often regarded as slippage.
Question
7 answers
As given by some primer designing websites.
Relevant answer
Answer
'Basic' probably refers to the 2(AT)*4(GC) formula. 'Salt-adjusted' probably refers to that formula plus a correction term (I think it is 16.6*logM in the case of monovalent cations) for the variation in Tm with salt concentration. 'Nearest neighbor' is a model where oligonucleotides are treated like sequences of dinucleotides, with experimentally derived thermodynamic parameters for each nucleotide pair (this accounts for stacking effects, the influence of sequence, rather than composition, fraying, mispairing, etc). Nearest neighbor is by far the most accurate.
Please remember that Tm calculations always make a number of assumptions, the first of which is to assume that annealing or dissociation is a two-state process (which it is not, especially as sequence length increases). Also remember that association exhibits first-order kinetics, and so Tm will change with primer concentration.
Question
1 answer
Sometimes genetic mutation or changes in gene expression is not sufficient enough to explain the disease risk. It is necessary to consider some other factors too such as epigenetics (gene modification though it is not changing the nucleotide sequence), environmental factors (behavioral, social, food habit) etc. How these things are correlated and how strong is the correlation?
Relevant answer
Answer
The answer is more complicated.
There are more players in this question, namely, the genome.
Using cancer as an example, we have discussed the relationship among these players.
see the paper:
Genetic and epigenetic heterogeneity in cancer: a genome-centric perspective
Question
55 answers
I have found an SNP in a gene under my research. In mutationtaster, it appears to be disease causing. How can I check for amino acid change caused by single bp change? Any online tool?
Relevant answer
Answer
You can insert the sequence in "Expasy" (http://web.expasy.org/translate/) to check amino acid change. Make sure that you insert the right frame when you check the native sequence before putting your mutated sequence.
Good luck!
What is the best way to measure mutation rate resulted from mutagenic gene transfection?
Question
60 answers
Mutagenic gene was transfected to 3T3 cells, gene expression was confirmed, what is the best way to measure mutation rate? * Please consider that cells can be manipulated by transfecting/infecting more genes and markers
Relevant answer
Answer
Hello Mohammed. You could consider using the HPRT selective media assay (using 6-TG as the selective agent)- but this only works with some cell lines, and is only really suitable with fast dividing cell lines, I'm not familiar with 3T3 cells I'm afraid. Also, a newer assay which is much more versatile is the PIGA mutation assay, which uses flow cytometry techniques to look for the presence/absence of surface markers on each cell to determine mutation frequency. I have successfully adapted this assay to a haematopoietic cell line to great effect. To take into account mutation rate - i.e. number of mutations per cell division, you would need to measure the cell doubling times of these transfected cells as soon as your mutagenic gene was expressed - as well as doing one of these two assays.
Question
9 answers
Can a phage transform a non virulent bacteria into a virulent form. Are there any examples?
Relevant answer
Answer
Many examples. Eg diphtheria toxin and cholera toxin genes are encoded by phages.
Question
27 answers
I am planning to do a sequencing of a surface receptor on B cells and If I'll manage to find a novel mutation, I would like to know how to classify it as a pathogenic or harmless? (Simplest Way)
Relevant answer
Answer
Many mutations have already been linked with disease, others are known to be benign. If the variant is novel, then look in the parents or other family members if possible.
If the mutation was carried by the parents and they are not affected, it is not likely to be pathogenic. If it is novel then more likely to be disease-causing.
If there is no family information, then there are a number of online tools available. No tool is perfect! You need to use a number of different tools and take a consensus view.
Page with explanation and links to some tools:
Pathogenic-or-not Pipeline:
Individual online tools to predict pathogenicity
Tools to predict effect of intronic variant on splicing:
Question
5 answers
How can I understand the presence of mutation in an organism if I couldn't make sequencing and if I don't observe its effects on phenotype?
Relevant answer
Answer
**If you have no phenotype but cannot sequence, where would you start? You could theoretically do whole genome sequencing if you suspect a mutation but have no clue in which gene.
**Anyhow, a clinical phenotype (observations and manual tests in doctor's clinic for example) or a biochemical phenotype (mRNA and protein expression using microscopy, rtPCR, WB etc) is generally present before anyone suspects a mutation. Thereafter the person can target a few genes and sequence them. If he/she identifies the mutation and in which gene, the person can use in silico analyses to predict pathogenicity. To strengthen genotype-phenotype correlations site-directed mutagenesis can be used.
Question
2 answers
I need a database in that you can search for specific influenza mutations searching in you own sequences, maybe using similar tools like BLAST or something like that.
Relevant answer
Answer
Influenza Research Database - Sequence Similarity Search (BLAST)