Mouse Genetics - Science topic

The average length of transcripts on the mouse chromosome Y is generally shorter than those on other chromosomes due to the unique characteristics of the chromosome Y.

Chromosome Y is the smallest and least gene-dense chromosome in the mouse genome, with only a few hundred protein-coding genes. Most of these genes are involved in male fertility and the development of male characteristics. In addition, chromosome Y lacks most of the repetitive sequences and transposable elements that are present on other chromosomes, which can lead to the production of longer transcripts.

It is also worth noting that the gene expression patterns on chromosome Y are different from those on other chromosomes. Chromosome Y is generally expressed at lower levels than other chromosomes, and the genes on chromosome Y are often expressed in a tissue-specific manner. This may contribute to the shorter average length of transcripts on chromosome Y.

Overall, the shorter average length of transcripts on chromosome Y can be attributed to the unique characteristics of the chromosome and the patterns of gene expression on the chromosome.

Hey Salvador,

Its been awhile since I worked with mouse retina RNA extraction and I'm locked out of my old lab protocol I developed. From my memory I used a 250 uL proteinase K digestion for ~10 minutes on frozen tissues, afterwhich I added 750uL of TRIzol LS and further dissociated with bead beating. I followed the standard TRIzol extraction protocol since I found I obtained better total RNA yields. I used an overnight incubation at -80 during the precipitation (which could have just yielded more ribosomal RNA) but I was just doing rt-qPCR. I don't have any published protocol since I left that lab prior to any publications on the approach and no one picked up the project. As I said, this is from my memory of ~6 years ago so you'll definitely have to troubleshoot some. That said, at the time I found that yields by conventional TRIzol extractions yielded better extractions than column based on total recovery, but that could easily be skewed by ribosomal RNA.

Sorry I can't provide you with a more refined protocol to follow!

I'm already on testing that. With instead of final narcosis and blood taking from the heart I will test blood taking from the tailveine without narcosis pre and post treatment. Maybe I will see the same changes then... or maybe not. To be continued....

But it's kinda ruin my effect on the treatment.

assumption is that you are talking about mouse embryonic stem cells? i had to deal with this problem 22 years ago and used subcloning method, karyotyping subclones and injecting them https://pubmed.ncbi.nlm.nih.gov/17828574/. The most likely cause is not the media but small genetic changers (microdeletions, mutations) accumulating during targeting, where the resulting mouse ESC culture is heterogeneous (genetic mosaicism), so subcloning and testing individually several subclones of the same targeted clone may be one way of increasing your luck. 2nd assumption i use is that your mouse ES cells are targeted/genetically modified? Because if they are not, i strongly recommend just thawing earlier passage and injecting them, to reduce chances of mosaicism, which increases with passages. The best approach to quickly generate mice with 100% contribution of injected cells is using tetraploids (tetraploid blastocysts, technique from 25+ years ago, where you fuse embryo at the stage of 2 blastomeres, they produce tetraploid blastocysts, which cannot produce a mouse due to being tetraploids, but can be recipient of normal ES cells, so if mice develop after injection into tetraploid blastocyst -they consist 100% of injected cells. Consider these 3 approaches. Good question

You could try Clover Biosciences based in Houston, TX, they offer free sample shipping to out of state companies as well

Dear Nadia,

For which time point are you interested in survival rate? Generally, we have 0%-1% death rate from birth to weaning, 0% death rate between weaning and week 11, after week 11 until week 19-20 we have 20%-30% death rate. Hope this can help.

please find this article. Hopefully, you will get the answer.

u must have a control group (that untreated with mutagen) then u can calculate mutation frequency (is mean signature or not) but calculate the frequency of mutations only does for in organism itself from mutation individuals number and survival individuals number.

hello,

so Elisia D Tichy the antigen retrieval is important to step and did you do permeabilization withTriton X100 ? and please did put primary for 24h or like other 1h in-room temperature? I try to do co-staining brdu+pax7 until now it not succeed

As an update, I'm not sure these will ever be 100% reliable. For us, it's been mostly reliable. That's why we genotype at weaning and after sacking, just to make sure. Originally, we were using the suggested PSEN1 primers with the internal controls about 4 years ago. I got us to switch to APP when the PSEN1 stopped working reliably. It's a struggle that's compounded by issues we were having with DNA extraction. I think the key is having a stable positive and negative control, as what a "positive" band for the 5XFAD mutation is not 100% consistent from week to week sometimes. Our main issue was that the internal control wouldn't show up in every lane, preventing us from knowing what a WT was and what reaction just didn't work. Another issue I found is that you can get a positive 5XFAD band (in a WT animal) if you simply load in too much APP/PS1 primer into the reaction which again, is why the positive and negative controls are so key. For what it's worth, this is the protocol we're using:

5xFAD primers:

oIMR3610 5’ AGGACTGACCACTCGACCAG 3’ - APP

oIMR3611 5’ CGGGGGTCTAGTTCTGCAT 3’

oIMR1644 5’ AATAGAGAACGGCAGGAGCA 3’ - PSEN1

oIMR1645 5’ GCCATGAGGGCACTAATCAT 3’

oIMR7338 5’ CTAGGCCACAGAATTGAAAGATCT 3’ - IL-2 Precursor (internal control)

oIMR7339 5’ GTAGGTGGAAATTCTAGCATCATCC 3’

Prepare PCR master mix (X # of samples + 1-2) (5XFAD APP)

4.0µL Water (PCR Grade)

10µL RED Extract-N-Amp PCR Reaction Mix (Sigma R4775) (Kit – XNAT2)

1.0µL Internal Control Primer (IL2) For (oIMR7338) (75µM stock)

1.0µL Internal Control Primer (IL2) Rev (oIMR7339) (75µM stock)

1.0µL APP Primer For (oIMR3610) (30µM stock)

1.0µL APP Primer Rev (oIMR3611) (30µM stock)

Add 18µL master mix to 2µL extracted DNA solution

Use 5XFADAPP program on PCR

94°C 2 min

10 cycles of: 94°C 20s, 66°C 15s, 72°C 10s

25 cycles of: 94°C 15s, 66°C 15s, 72°C 10s

72°C 2 min

Hold at 4°C

Prepare PCR master mix (X # of samples + 1-2) (5XFAD PSEN1)

4.0µL Water (PCR Grade)

10µL RED Extract-N-Amp PCR Reaction Mix (Sigma R4775) (Kit – XNAT2)

1.0µL Internal Control Primer (IL2) For (oIMR7338)

1.0µL Internal Control Primer (IL2) Rev (oIMR7339)

1.0µL PSEN1 Primer For (oIMR1644)

1.0µL PSEN1 Primer Rev (oIMR1645)

Add 18µL master mix to 2µL extracted DNA solution

Use 5XFAD program on PCR

94°C 3 min

35 cycles of: 94°C 30s, 58°C 1min, 72°C 1min

72°C 2 min

Hold at 4°C

The more basic the biology is, the more choice you have in which model to study it in. If you're studying cytoskeletal dynamics, you can literally go anywhere from synthetic biochemical systems to humans. But your question is always going to come with an idea of how to answer it, and that approach will come with technological challenges that narrow your choice down. After that, whatever is most convenient (i.e. materials or skills already present in the lab) gets used.

You can change.

You can take further suggestions from technical service from jax lab:

TECHNICAL SUPPORT:

micetech@jax.org | 

1.800.422.6423 (US)

1.207.288.5845 (International)

Yes. If you follow starting your preparation as described in the protocol you will obtain 3 discreet BM fractions: the bulk buffy coat suspension, the hematon spheroid units and the endosteal compartment. You may convert these fractions into single cell suspensions, without loosing cells due to clumping or remooving the most important physiologically aggregated hematons by filtration. We optimized a mixture of enzymes which can be applied in security, which is not the case when You use Trypsine, which is extremely harmful (because desitegrate an important fraction of differentiated cells clumping together with MSCs, HSCs etc).

We used the Limiting Dilution Analysis (LDA), which documented that the frequency of MSC is ten to 20-fold higher in the hematon fraction, compared to the buffy coat.

The aim of our studies that time was not to isolate the MSC fraction in pure forme, but you may follow any currently used methods described in the litterature (FACS or culturing your cells in specific growth medium), with security.

I add two publications that you may find useful, but do not hesitate if you have further question.

Good luck with you research.

Istvàn

Thank you all for your answers. Per Riccardo's suggestions I ended up using the UCSC Table Browser and even got directions from Christopher Lee at UCSC that worked will. Thus, I just wanted to post those directions in case it helps anyone else who may end up on this question. Below are the directions from Christopher;

If you have a whitespace delimited file like so: chrX start end

then you can upload that file as a BED format custom track (http://genome.ucsc.edu/FAQ/FAQformat.html#format1), and then use the Table Browser to select your custom track and the "output sequence" option to download the sequence corresponding to each region.

The following is a brief step by step, using "chrX 150000 200000" as an example input BED: 1. Head to the Custom track upload page: https://genome.ucsc.edu/cgi-bin/hgCustom, and select your organism of interest (Mouse mm10) 2. Use the upload file button or paste your BED input file directly into the text box, the click submit. 3. On the resulting "Manage Custom Tracks" page, select "Table Browser" from the "view in" dropdown and click go. 4. The mm10 assembly and your uploaded custom track should be pre-selected, so you should be able to just change the "output format" dropdown to "sequence", and click "get output". Optionally, if you would like the resulting output in a file you can enter a file name into the "output file" text box and the next steps will download to a file. 5. On the resulting page select any extra formatting options you would like and the click "get sequence", which will result in FASTA format output, for example:

>mm10_ct_UserTrack_3545_0 range=chrX:150001-200000 5'pad=0 3'pad=0 strand=+ repeatMasking=none NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Best Regards and thank you all again for your help,

Max

Hi Abbas,

Both testosterone and DHT do their actions by binding to the androgen receptor. There is an androgen receptor knockout available through Jackson lab. The stock No is 018450.

Good luck!

Yasir

Hi Anastasia,

Can you send me a PDF file of this paper? Thank you

I agree with Dinglan on the subject. We run LNCaP xenografts commercially (http://altogenlabs.com/xenograft-models/prostate-cancer-xenograft/lncap-xenograft-model/) and since LNCaP cells are androgen sensitive, is is necessary for the mice to be sexually mature for the experiment to be run successfully. With regards to other factors, 3-week-old mice are fine, but because of the androgen sensitivity, 10 weeks is an early starting point (as we do with nu/nu mice).

Following

Hi Alaa,

if you have a general knock-out, one problem might be that it affects the development of certain organs, causing embryonic lethality. In that case, you will never obtain homozygous knockout mice. In that case, you could use a conditional knockout to only inactivate the gene in the tissue / cells that you are interested in.

You can use all kinds of methods to analyze your knockout mice:

You could analyze their behaviour (open field, rota-rod, Watermaze, footprint analysis...), check their development (size, weight, life span...), perform clinical chemistry analysis (of blood, urine, ...) and do histopathological examinations using various different stainings and markers.

At the end of the day, what you analyze will depend on your reserch question (e.g. role of your gene of interest in muscle development) or obvious phenotypes (e.g. weight loss, seizures, ...).

Best,

Sebastian

Annie, ab14745 from abcam recognizes both human and mouse mtCOI. You should not boil your samples, though. There were some other human-specific antibodies from abcam. I believe, some of their mtCO2 worked quite well. I can look that up

we ended up going with the zebra printer. We don't really use the barcode, but we print the stickers all the time.

thanks so much for the ideas!

Hi

Does anyone know if there is an antibody to recognize Y chromosome specific proteins expressed in somatic cells from males?

I was recently informed that a paper published in early 2017 in Nucleic Acids Research precisely mapped the integration site of the same villin-cre transgene I was asking about (B6.SJL-Tg(Vil-cre)997Gum/J) to a specific portion of mouse chromosome 17 (chr17:55,466,255 to be specific). This paper by Cain-Hom et al. also showed that the copy number of this transgene is around 16, that there is a small DNA deletion around the site of transgene integration, and that mice homozygous for this transgene are viable. The authors of this paper also mapped the integration sites of 6 other widely used cre transgenic lines using the same technique. A link to the paper can be found below.

Hi Dan,

First of all, contact your supplier in order to know whether you're able to breed them at your facilities or not. Sometimes you need a kind of contract.

I would avoid breeding Cre homozygous mice one to each other. For expanding your colony, you would need to know which is the background of your Cre line (ie C57BL/6J, 6N, etc.). Once you know this, I would recommend breeding a Cre mouse (male or female, homozygous for Cre) to a background mouse (X strain) (I'll suggest permanent mating: keep always a male, eg Cre male, together with 2 females, eg C57BL/6J -- This guideline on colony management would be of great help for you:http://www.criver.com/customer-service/education-training/companion-guides). Then the 100% of the offspring will be HT for Cre. Afterwards, you can further expand your colony by breeding HT Cre mice (Cre/-) to their background (-/-); 50% of the subsequent offspring will express Cre (Cre/-), while the remaining percentage don't (-/-). You will need to genotype each animal in order to identify the ones who carry Cre.

I hope I've helped!

Fiona

Hi Hani,

I thought that Genecopoeia with following link is great.

 Dear Peter, the Rosa 26 CreERT2 works quite well in most of the tissues except the brain. However,  recombination in some alleles is more efficient than in others. See: DOI: 10.1152/physiolgenomics.00019.2007

Best

Emilio

Thanks for the advices.

Best.

RR

I have not worked the knock-in PV-cre mice. But since PV is expressed at different levels in corresponding to the activity of this type of interneurons, any behavior results with this KI mice should be considered to be a combined effect of the PV haploinsufficiency in the whole brain. I doubt that the heterozygous PV-cre mice may also have some degree of deficit in learning or fear acquisition. 

Many mutations in the gene encoding superoxide dismutase 1 (SOD1) have nearly complete penetrance in humans. These include: A4V, G37R, L38V, G41S and many more. Here complete penetrance is defined by symptomatic disease in 90% of mutation carriers by the age of 70 years old. Penetrance of other putative disease causing mutations in other genes is murkier. C9orf72, TDP43, etc., have not been as well characterized as SOD1, but indications are that penetrance is generally less complete and disease phenotypes can vary from ALS to frontotemporal dementia. 

Mouse models which over-express mutant human SOD1 tend to have 100% penetrance, but this is likely because they express many copies of the toxic transgene. It is known that disease severity in these transgenic mouse lines is transgene copy number dependent; more copies of the SOD1 transgene result in more severe disease.

Our labs at ALS Therapy Development Institute have worked with approximately 60,000 B6.SJL-Tg(SOD1*G93A)1Gur mouse to date. Virtually all of those confirmed high copy SOD1 mice have ultimately succumbed to an ALS-like phenotype unless humanely sacrificed prior to reaching their disease endpoint for research purposes or due to technical experimental error (i.e., failure to recover from anesthesia, etc.).

Okay, Thank you for your answer.

hi

one thing to do is first test the primers for an in silico PCR (try on the UCSC or NCBI tools). if the in silico amplification is right, at the good size and position on genome, the PCR protocols are to be checked, but also quality of primers (false production?).

fred

Here are two papers describing different methods for achieving what you want.

The first method has you run basic primers for amplification of target gene along with a tailored DNA fragment that competes with your target. You run these together in your PCR reaction and your band intensity alludes to zygosity. This method is a little more vague as far as sensitivity goes, but will still work as a general guideline.

The second method has you design a quad-set of primers around your genomic and flanking DNA sequences, and your bands would correspond to zygosity (1 band null, 2 band homo, 3 band hemi). This is my preferred method, since the results are fairly obvious.

Thank you both. very helpful

As far as I know, there are no whole brain inducible lines. However, you can cross mice to Nestin-Cre to perform whole brain deletion or to CamK2a-Cre to perform forebrain (starting from postnatal day 14) deletion of your target gene. Unfortunately, the Nestin-CreER will only target dividing cells and therefore its domain will be restricted to the adult neurogenic zones in the mouse.

The entire mouse colony was moved to a room on the far side of the vivarium, and no seizures have been observed in the new room. We believe it is an environmental effect, potential due to the presence of an MRI machine directly below the holding room.

Thank you Jetty. I am familiar with all of thee papers; I am looking for anecdotal experiences with making cKO using CRISPR that have not been published.

Dear Genny,

I have my BTK ko mice and don't really see big difference in the survival compared to WT mice. I even have some survival experiments, but the mice are not pure Btk ko, so i can not say about survival of the pure BTK ko colony.  

Although BTK ko mice have less mature B-cells, which must lead to higher infections rate. I don't see very big difference in Litters number (usually 7-9). I have my mice in SPF Animal Facility.

Hope that i can help you with your questions,

Oleg

If this strain is from Jackson, it is a hemizygous PF4-Cre transgene. Therefore, you will only see a yes or no expression pattern. Good luck!

To be honest, the jackson protocol looks very abnormal protocol to me

One time I was feeling very difficulty in one of PCR, I tried touch town, Anealing 65C to 58C and decreases slowly, I am am enclosing that protocol, you may try on the similar to modify from 68 to 50 for your experiment, please see page 2 of enclosed protocol. Good luck

Injections (every 24h for 5 days) should work better. there is a very good publication about cre/lox mice methods available here at ResearchGate. They used TAM injections

We used 4OH-TAm.

Thank you for your responses. I have found literature showing that you should indeed test the animals with just the promoter present (CaMKIIa) as well as the wildtypes in experimental designs. 

Hello, this is not really a protocol, but a basic HowTo...

Left ventricle is the biggest part of the heart, so you can collect it in a "just remove everything else" way. When you have the heart, take small scissors and cut away all the small parts that are "hanging" from the heart (if you can lift it with the tip of your scissors, then it should go away). That way you should get rid of the aorta and both atria and you will get firm egg-shaped thing. One side will be a bit softer and bulging. That's the right ventricle. 

From the where-aorta-was side insert scissors and cut down so the right ventricle will open. Remove that and you have only left ventricle left. 

Small curved scissors are sufficient, if available spring-type micro scissors are better for removing the tiny bits. For basic anatomy-learning purposes, some people found it helpful to leave the heart for several hours in formaldehyde, which makes it stiffer.

Thank you all for the suggestions.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

BMC Genomics20078:275

DOI: 10.1186/1471-2164-8-275

Hi Nicole,

Thanks so much for your answer!

We use an ELISA for HMGB1 but that doesnt tell you the oxidative state

Try FImpute!

Thanks a lot for the link! have never really used the ensembl site before, it seems to summarise the gene info quite nicely.

there h2afv is listed as a paralogue, btw

If you go through the literature, you will find that all the reasons you listed, and some additional ones, could play a role in influencing blood glucose levels.

Asking others for opinions without defining the strain of mice (or the mutation) is practically an exercise in futility.

Best,

The Axin2-nLacZ knock-in works great, but, admittedly, I never compared it with staining for actual canonical signaling, let alone in the intestine. Still, it's a really good reporter. 

In my personal experience, transgenic lacZ reporters are mostly unreliable. Even in wild-type mice, I get very inconsistent expression patterns. LacZ knock-ins always worked and always gave consistent expression patterns, while lacZ-negative controls stayed negative. 

This may help: http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0023139

Never tried any of the GFP versions, but if the same knock-in strategy was used, I would not expect major differences versus the lacZ version. 

I do not disagree with the opinions above, but motor behavior and weight can vary significantly even in inbred strains. Although some favor inbred strains for genetic homogeneity, it may also make results less generalizable and can occasionally produce unusual GxE interactions.. This is why we do clinical trials in humans with diverse genetic backgrounds.  When backcrossing, you may also find that fertility or pup survival suffer greatly.

Hi Yang. Random integration using CRISPR in mice seems to be rare. GeneCopoeia provides CRISPR transgenic mouse services, and in our hands 1) The frequency of correct donor insertion is about 3-5%, and 2) We almost never see random integration. This makes sense. If CRISPR is working, the frequency of integration will be stimulated by several orders of magnitude, so if you are screening about 100-200 mice, then the ffrequency of random integration will be below the levele of detection. This is opposed to cell lines, in which a selectable marker is placed on a donor plasmid. In that case, you are selecting for cells that are drug resistant, and the only way they can survive is to integrate the plasmid, whether randomly or correctly. That is why people can still detect drug resistant cells in control transfections of donor but no CRISPR. If you want to know more, visit us at http://www.genecopoeia.com/resource/technical-and-application-notes/, where we have technical literature on genome editing topics.

 Dear Beatrice,

Thank you so much for your inputs. I will go through these and then i will see what can be done.

Thanks again.

Best regards,

Abhijit

Hi David. Sure, we can have a TC next week. Best you send me an email and then we try to Setup a date for a scype conference: markus.gerhard@tum.de

Best, Markus

Dear Peng Liu, I can only confirm what Kai Schönig already said: Impossible to know what effect an overexpression or a deletion will have on the development of an embryo, although studies in other animal models might give some insight. But keep in mind that genes are often duplicated in mice compared to flies, but fish have more isoforms than mice, so often the specific function of each gene is difficult to deduce from knowledge gained in other animal models...

Conclusion, best approach, as Kai says, is to make the gene inducible. Think at the LacZ or YFP Cre reporter mouse lines, they have a short CDS terminated by a stop codon flanked by two LoxP sites before the real start of the gene CDS (LacZ or YFP). Unless you cross the line with a Cre deleter mouse line, there will be no protein expression, independent of the promoter activity. With this mouse you can use a general Cre-deleter line deleting in the germ-line and check the effect of overexpression during embryonic development, but if you have lethality, you can still cross your silent overexpressing line with a tissue-specific Cre line or a Cre-ERT2 (for example Rosa26-CreERT2) line where the Cre is allowed to enter the nucleus only when you provide tamoxifen, a synthetic estrogen analog.

Not sure about mESC, but it does not matter in germline stem cells.

Thank You all

Happy to see that. Good luck!

 Thank you Russell.  I saw R&D's Ab, just wondering if anyone has used it before or any tricks with the staining.  

Hello Caitlin,

Overall it seems the PCR conditions for your floxed gene is suboptimal. Although the PCR works well for the cre, it may be related to the quality of the DNA. But since DNA quality is good enough to amplify the cre, the best way would be to tweak your PCR protocol.

1- ,If you are not using such a protocol already, I would suggest to use Touchdown PCR protocol. We use that and it works like charm. The only difference with a regular PCR protocol is that you set the annealing temperature to 65°C and then decrease the annealing temperature by 0.5°C every cycle over 30 cycles.

2- If above does not work and if you have the sequence of the floxed gene, design new primers. Ideally, you would like to have some primers to amplify both the floxed and wt allele or a primer pair that gives 2 products of different length so tha you have a kind of dual validation.

Hope this helps

Nick

Hi Miranda,

If you have used CFSE at a concentration of (0.5ug/ml) for in vitro assays, the cells will survive. If you go beyond this concentration, CFSE (even 1.5 ug/ml) is very toxic to the cells and that by itself will kill all your Teff cells and hence you cannot expect any proliferation. So I wonder at what concentration you did your CFSE labeling. If you repeat the assay, please stain CFSE at 0.5ug/ml and not at any higher concentration. Your assay set up looks good. So I doubt only the CFSE labeling concentration. Also you could check the Treg suppression inspector page (Miltenyi Biotech) which gives a detailed description of assay setup. Wish you all the best!

 @Joern Pezoldt

Thank you very much, it's helpful! 

I can't comment to the exact expression in this exact generation but we do have the MTMG mice Stock# 007676 (Backcrossed to C57Bl/6J) crossed to a number of different transgenic and knockout lines in our lab and the transgene functions well in all and has done for multiple generations. The transgene is knocked in to the ROSA26 locus so the chance of it getting silenced is incredibly low and not something to get too concerned over. One thing that you may want to check before ordering is whether the pCA promotor that regulates the expression of the transgene is indeed active in your tissue of interest because expression is definitely variable depending upon tissue.

One thing I would exercise caution on is the Stock# 007676 or 007576 (Backcrossed to C57Bl/6J or FVB respectively). The FVB stock Stock# 007576 has a terrible infertility - a lesson we learned the hard way although I'm pretty sure the one that you are mentioned is the good breeder. 

You can outsource the work to Indian / Chinese companies

Spleen is notoriously rich in nucleases, so the spleen needs to be homogenized immediately in the lysis/chaotropic agent immediately after dissection/removal from the animal.  Do not wait at all between the time the spleen is removed and the time it is homogenized in whatever nuclease-inactivating solution you are using.  A good link for supportive info can be found here:

Hola Luci,

although it is true that excessive GFP expression can sometimes lead to toxicity (but it is not a peculiarity of GFP, any protein expressed at too high levels, whether endogenous or exogenous, will create problems such as wrong compartmentalization, aggregation, storage in nuclear bodies and eventually toxicity), we do have several lines expressing GFP or GFP-tagged proteins in homozygosity. Classical example is the Thy1-GFP lines, we have one of them and the animals are pretty much fine in homozygosity. Of course the promoter is important, as Fred says. An actin or CMV or PGK promoter might be excessive, the RS26 promoter I cannot say, since we have the reporter mouse that does not translate the GFP unless it's crossed with a Cre line... So you'll have to check your promoter, and if there is no information about it's strength you'll have to test  yourself the survival of the mice and, as far as you are immediately concerned, mating behaviour of the mice, since you are expanding the colony. For the experiments themselves, unless you are only interested in the expression pattern by IF, I would never use the mice in homozygosity...

The other problem, as mentioned by Fred, would be genotyping the mice, so to understand if you obtain homozygous mice or not. The long way would be to use genetics, a mouse whose entire offspring with a wt counterpart carries the GFP is by definition homozygous. Other possibility is what we do when we don't have a knock-in with known insertion site, qPCR. In practice we use the standard genotyping PCR, but we run it with SyberGreen in parallel to a control gene and we normalize to a sure heterozygote control mouse. After calibration with the control gene, the ratio against the heterozygote will be around 1 for other heterozygotes or around 2 for homozygotes (of course around 0 for wts). It is not perfect, but reliable enough... There are more sophisticated methods to genotype by qPCR!

Mating brothers and sisters is a contradictory issue. All inbred strains, such as the C57Bl/6, derive from only two progenitors by mating all the offsprings among themselves. Of course this is against nature, but that's how genetic variability is kept reduced and controlled so to help standardize experimental results across different labs in the world. In general I have to say in laboratory practice mating brothers and sisters reduces fertility, so we do sometimes do it, but we also refresh the lines against pure C57, as Fred also mentioned. If you have a way around, I would suggest to avoid it as a continuous practice, but you can probably safely do it once in a while if it is necessary...

Good luck.

Hi Claudio, no wonder that rRNA and actin mRNA change in cancer, these cells have high translation metabolism, are highly motile and highly replicating... I bet also GAPDH would be increased. I don't think it is an easy task to find a good calibrator/internal reference gene in cancer, syrian hamster or not...

If you have the availability in hamster, you might want to try TBP (the TATA binding protein) or LDH (the lactose dehydrogenase... if you are sure your system does not go into hypoxia...)... These genes should be pretty invariant in most conditions, because the TATA boxes are a fixed number in the genome, and are used quite independently of the cell type, although small variations can be found, and LDH will be expressed in function of produced lactose, which is generally pretty low, unless one lacks oxygen...

Good luck.

Yes but results probably will not fully supported human data. Can you use a full human BAC with several Kb to include human promoter and full DNA seq with the variant there?

We did it but for brain delivery (see the attached article).

I guess that the same procedure can be used (even more easily) for i.p. delivery.

Best regards

Robert

hello Hua,

I have to add to Sebastian's answer some corollary observations derived from personal experience because, in certain cases, which parent carries the Cre matters.

In example, the Sox2-driven Cre is expressed in the maternal ovocites and this could lead to autonomous loxP sites excision already in the ovocytes. In this situation, we ended end up with pups carrying deleted allele even if they are Cre negative in the genotyping. We struggled quiet a lot before understanding the reason. 

I totally agree with the fact that you should first go back to the original paper (if no one around already did) and get all the information about your Cre line (construction, expression pattern, etc).

Temperature! Make sure that whatever you place on your sample is at the same temperature you will use for imaging. If you store your oil or cover-slipping fluid cool, it has more gas dissolved in it than when you measure you get bubbles.

I keep everything at room temperature and place my fluids on the sample, then wait at least an hour before placing the coverslip. 

Thank you very much Dmitry, your answer's been really helpful!

Dear Ali check these papers:

Stearns SB, Benzo CA. A longitudinal and comparative study of some structural and hormonal alterations in the endocrine pancreas of spontaneously diabetic and streptozotocin-induced diabetic mice. Acta Anat (Basel). 1983;115(3):193-203.

Coleman DL, Schwizer RW, Leiter EH.Diabetes. 1984 Jan;33(1):26-32. Effect of genetic background on the therapeutic effects of dehydroepiandrosterone (DHEA) in diabetes-obesity mutants and in aged normal mice.

Regards

Fernando

Expressing human genes in mice generally does not promote an immune response and is rarely a problem.  The only circumstances under which you might stimulate an immune response is if the protein is secreted or has an extracellular domain and is different enough in sequence to be recognized as foreign.  Most transgenes are either expressed inside the cell, cytoplasmic or nuclear, and thus are never seen by the adaptive immune system. Or, the transgenic proteins are similar enough to the endogenous mouse homologues so that they would be recognized as self.  

If you are giving it by oral gavage, the drug does not need to be fully dissolved. You can give a suspension. In the linked paper, they suspend lomerizine HCl in distilled water with 5% arabic gum

Have you looked at the NCBI site ? There are many resources which allow to align multiple gene or protein sequences to each other.

Thank you. I have not been successful with the resources at my institution. I have used a rabbit model instead...any thoughts on that?

please contact dr zahid ali shah sb

Why not simply measure the ventricle volume for wild type and knockout and compare the sizes for a quantitative answer to your question?

I attached a link with methods that could help.

You can try BL6 mice.