Mollusca - Science topic

The "konokono", from the local language in Mauritius and Rodrigues, is a really well known seafood delicacy (small to medium size sea mollusk with a shell). However, I really did not manage to find any scientific related information based on this local name (and we are not here speaking about a snail which lives in Africa and is called also konokono in swahili language).

I join here pictures of one same specimen, supposed to be a konokono.

I am looking for the scientific name of this mollusc species.

Any help would be really appreciated, thank you.

Hi all,

I am looking for type material of fossil terrestrial gastropods described by August Reuss. Specifically I want to find the syntypes of Vertigo callosa Reuss, 1849 from the Early Miocene of Tuchorice (CZ). Reuss worked, amongst others, in Prague and Vienna, and parts of his collections (microfossils) were purchased in 1891 by the Natural History Museum in Vienna. However, the mollusks aren't there, and I couldn't find any information on their whereabouts, apart from a few author's statements that the collection "might be lost". It remains uncertain though if anyone actually made a serious effort to locate it.

Any hint or suggestions would be most welcome!

Best wishes,

Thomas

Dear fellows, the GenBank lists only 3 vouchers for Theodoxus fluviatilis in Crete, from Stylos springs SE of Chania, and from the outflow of Kournas lake, SE. of Georgioupoli.

But the Theos from the "Almyros" karst springs of Georgioupoli and Gazi are not documented. It is said here and there, but without evidences, that they belong to fluviatilis; but their opercula show features that are, IMHO, somewhat different from those of average fluviatilis.

Any infos about these snails, somewhere?

Attached: three images of the Theos from Gazi and Georgioupoli, collected in the springs and in a river in the vicinity.

Thanks for any help!

1: foot. 2: anterior cephalic lobe. 3:posterior cephalic lobes held erect. 4: pallial exhalant siphon; taper fits adapical angle of aperture. 5: glans of penis? 6: rectum and anus OR female opening/vagina?

I have used Fretter and Graham as a guide but features on a live specimen differ from those on their dissected dead specimens. [ F & G, 1954. Observations on the opisthobranch mollusc Acteon tornatilis (L.) J. Mar. Biol. Ass. 33(3)].

Dear Colleagues:

These papers are very old. If you have a copy, please share with me.

Kind regards.

Subhronil

List:

=======

Kapitza, A. A. New species of lower Cretaceous inoceramid from lower Priamur. 65-77. In: Poyarkova, Z.N. (ed.). Biostratigraphy of the south of the Far East (Phanerozoic). DVNTS AN SSSR, Vladivostok. 139 pp.

M. M. Astafieva. 1989. On the representatives of the genus Maitaia (Bivalvia). Paleontological Journal 23(3):11-19

Keller, S. (1982). Die Oberkreide der Sack-Mulde bei Alfeld (Cenoman-Unter-Coniac). Lithologic, Biostratigraphie und Inceramen. Geol. Jahrb., 64, 3-171.

Heinz, R. (1932). Aus der neue Systematik der Inoceramen. Mitteilungen aus dem Mineralogisch-Geologischen Staatsinstituts in Hamburg, 13, 1-26.

Marwick, J. (1953). Divisions and faunas of the Hokonui System (Triassic and Jurassic). Geological Survey of New Zealand, Palaeontological Bulletin, 21, 1-141.

Chen, J. (1987). Early Jurassic marine bivalves from Guangdong-Nanling district, southern China. Bulletin of Nanjing Institute of Geology and Palaeontology, Academia Sinica, 12, 23-94.

Please can you name the red marks labelled 1 and tell me their function?

The specimen has the roof of the nuchal cavity removed. The visceral hump still has the mantle but some viscera have burst out. Am I correct in thinking that the spheres labelled 2 are balls of food in the stomach before being compressed in the intestine into faecal rods?

From Mersey Estuary, England. Shell length 41.6 mm.

Could anyone help me in identification of these species growing in China's coastal wetlands? I attach some photos. Thank you.

Is their specific threshold for discriminating species similarity based on Mitochondrial DNA Percent similarity Identification particularly for Mollusk? What is specific DNA barcode (BLAST) Threshold or standard similarity to ascertain if the two species belongs to the same genus or if they belong to similar or different species?

I regularly have low DNA concentrations on the vetigastropod tissues I extract. I have tried fresh tissue and older/museum tissues. We use the Thermo Scientific GeneJET Genomic DNA Purification Kit.

Heating the elution buffer and using less buffer to elute does help, but concentrations are still quite low. Downstream applications are PCR and sequencing.

Super desperate and would appreciate any suggestions on how to increase the yield from extractions!!

Hi All,

I am trying to amplify mitochondrial 16S gene for marine snails (Calliostomatidae) and other vetigastropods, but I only get primer dimers or nothing on the gel. These primers have worked previously in my lab and in numerous other publications. The DNA concentrations are low, but they have amplified for COX1 using the Folmer universal primers.

I am using the Palumbi 16S universal primers (Forward: CGCCTGTTTATCAAAAACAT and Reverse: CCGGTCTGAACTCAGATCACGT). We bought new primers in December 2023. I resuspended them and have tried multiple aliquots. I've tried gradients 45-55 and 55-65 and a touchdown PCR starting at 59 (-1 C/cycle for 10 cycles) and final annealing at 48 for 20 cycles. I've tried the standard, ammonium, and combination 10x buffers. All reagents are from Apex (not a hot start taq), except for the dNTPs.

Our usual protocol is: 2.5 uL of 10x standard buffer, 1.25 uL of MgCl2 (50mM), 0.5 uL of dNTPs (10mM), 1 uL of both primers (10uM), 0.2 uL of taq (5 units), and 2 uL of DNA. This does work for Folmer. Denaturation at 95 C for 4 min, 35 cycles of 95C for 30 seconds, 50C for 30 seconds, and 72C for 30 seconds, and final extension at 72 for 10 min.

I'm desperate and would love to hear any suggestions/tips on how to fix this!! I also unsuccessfully tried ethanol precipitation to increase the DNA concentrations, so tips on that would be appreciated too. Thank you

while attending class my professor asked us to count benthic species,and in my counting i mentioned sea snails,certain i have read multiple times that their classification is "univalvia" since their shell is made from a single piece,unlike the two shells of BIvalvia. Now howerver,i see the term is used as arhaic?

Last weekend I took a photo of this cave-dwelling snail in a northern peruvian cave (1200 metres above sea level). Could you please help me to identify the Genus and Family? Thank you very much.

I have a E.Z.N.A.® Mollusc DNA Extraction Kit that has never been opened, but was bought in November 2018 and stored at room temperature the whole time. Is there any hope that the RNase A solution included in this kit is not completely degraded and can still be used ?

This mollusk is similar to the species Corbicula tibetensis. Or Corbiculina ferghanensis may also be. What do you think?

I'm having trouble obtaining a well-defined band of the COI gene in mollusk (Aulacomya atra) adductor muscle samples, despite using 35 cycles and TBT-par. Other mitochondrial and nuclear genes amplify smoothly using the same samples, such as the mitochondrial 16S gene and the nuclear 18S and 28S genes. What recommendations would you provide to optimize the PCR and achieve a clearer band?

Hi

Is this gelatinous mass familiar to anyone? Which genus/ species does it belong to? It was found in Norway in shallow waters close to shore, and has the consistency of nemerteans/ molluscs. It is about 2 cm in diameter. When cut in half, most of it is just gelatinous mass. However, roughly in the centre is 20-30 tiny eggs. Could it be the egg mass of e.g. nemerteans/ nematodes or molluscs?

Looking forward to your response.

Kind regards, Halldis R.

Dear colleagues,

On an expedition in the southern Sargasso Sea, subtropical Northwest Atlantic, I encountered repeatedly specimens of the photographed heteropod, never (so far) being bigger than 65 mm. In all cases, it has been the same species/morphotype. I greatly appreciate your expertise in identifying this species.

Plankton samples were collected in the top 300 m of the water column with a 500 um mesh IKMT.

Your input is much appreciated!

Cheers - Florian

We want to adjust minimum collection sizes of bivalves for pedestrian collection in mangroves

they are from a mangrove ecosystem in the Gulf of Oman.

Dear colleagues,

We are currently looking for the type material of Paul Oppenheim's 1919-work "Das Neogen in Kleinasien" (Zeitschrift der Deutschen Geologischen Gesellschaft 70), specifically of Neogene non-marine Mollusca from the Denizli Basin. Oppenheim himself wrote in the work that the material is deposited in the Museum für Naturkunde Berlin, but it can't be found there. It couldn't be located in the Hebrew University of Jerusalem, storing large parts of Oppenheim's collection, either.

Does anyone know of other places that stores parts of Oppenheim's types?

Kind regards,

Thomas

These snails came with lavender (Lavandula sp.) imported from Italy to Norway. The snails are certainly not a species native to Norway. Due to the size and my initial impression, my first thought was Cornu aspersum, which is recently introduced here, but these have different patterns than the ones we typically see. I'm aware that most snails vary considerably in colour and patterns. The neat Cepaea-like lines on the underside of one threw me off particularly. The largest one is approximately 26 mm wide and 18 mm tall. The smallest is around 16 mm wide and 11 mm tall. My guess is that the smaller one is a juvenile specimen. The smaller one is also slightly damaged, which I believe is why it seems to have an open umbilicus.

Edit: They might be Eobania vermiculata. Can anyone confirm?

Dear environmentalist in Bangladesh,

I would be happy to know where I can get the FTiR microscopy facility and the already developed protocol for micro-plastics characterisation in biological samples in Bangladesh?

Also suggest any transcriptomics marker to analyse in fish and molluscs.

Thanks in advance.

Hello Everyone,

I'm looking for good references that established relations between arctic zooplankton bugs' biovolume and equivalent carbon mass. Specifically for jelly organisms (Hydrozoa, Ctenophora...).

Basically, DM (dry mass) conversion to CM (carbon mass) was averaged for each group such as gelatinous organisms 15% of C, molluscs 35% of C and crustaceans 40% of C (Cotté et al., 2022), if we consider water volume for each group (considerably higher for jellyfishes).

I have only biovolume in my case (µm3 to mm3).

If anyone has good literature for common arctic zooplankton species, I would be gratefull.

Thanks in advance

I am trying to identify the snail of the attached image. It was photographed in Cuatro Cienegas, Coahuila, Mexico by I. Domínguez.

Based on the shell sculpture, this snail resembles to the banded snail Mexithauma quadripaludium, but I have not found any information about if there is a white morphotype of this species, like the case of another endemic snail Mexipyrgus churinceanus.

I would like to identify this specimen, any help with this is welcome. Thanks for your help and comments.

A description of Mexithauma quadripaludium can be consulted on page 72 from the following document:

I am running this code (below) to add error bars onto my bar chart, i am trying to to work out the standard deviation (sd) of shannons diversity index

The code works up until the second/third last line

This error code keeps coming up

"Error in shannon - sd : non-numeric argument to binary operator"

but this is my data...

Exposed Crustacean 0.000000 0.00000000

Exposed Mollusc 1.199625 0.13291129

Exposed Seaweed 1.513125 0.42093822

Sheltered Crustacean 0.025500 0.07212489

Sheltered Mollusc 1.156750 0.26763341

Sheltered Seaweed 1.848125 0.27264128

anyone know where im going wrong?

We have obtained some electron micrographs showing what appears to be developmental stages of some type of small eukaryotic organism colonizing/parasitizing the tissues of mammalian hosts. Samples tested included sterile deep needle aspirate of subcutaneous nodules, filtered lysed whole blood, and urine sediment. The hosts may have a unique genetic defect allowing them to become infected with eukaryotic parasites, or, the putative parasite may have efficient strategies for suppressing the hosts immune response.

We are curious about the identity of this possibly novel organism. None of us in the research group have more than basic knowledge of invertebrate taxonomy, but based on the presence of organized calcified “tube or shell”-like structures, we are hypothesizing that it may be some type of polychaete or mollusk? The opinion or thoughts of anyone skilled in such classification would be very appreciated. Thanks!

Fishes. molluscs which are living in salty marine water donot suffer from exo-osmosis why? Are there any defensive mechanism acing against osmotic pressure caused by marine salty water?

Or, the osmotic pressure of fish cell is higher than external water? or there any protective covering covering the body of marine creatures?

Hi everyone, I am looking for animal data sets that can be compared to the plant datasets from Smithsonian plots. The Smithsonian tree plots census plants in a local community (a plot) above a size threshold; size is measured by stem DBH, and plants are identified to species. I am looking for animal datasets that are similar; that is, they need to contain most of the individuals in a given community (say, mammals or insects or fish) ID'd to species or morphospecies; and they need to have all of the masses of the individuals (not just averages for the species). So far I have found some good small mammal trapping data sets from LTER in the USA, and some tree canopy fumigation datasets for insects. What kind of data are available for large mammals, insects, spiders, molluscs, fish, birds, reptiles, amphibians, etc.? I am looking for datasets of any size, location, and timescale. Thanks so much.

The gill of this B. plumula is visible below the raised mantle. In addition there is a tripinnate feature which extends further out onto the area of encrusting pink alga. Can anyone tell me its name and function? Or is it a malformation?

The drawing in Thompson (1976) Biology of Opisthobranch Molluscs V. 1 shows the gill as a simply pinnate plume. Is there a published paper with a detailed dissection of B. plumula?

Please click the image for a clear view of the feature which is partly hidden on the preview.

Hello all,

I am about to start a project which is to identify a newly isolated bacteria as a causative pathogen to mass summer mortality in a marine mollusk. Briefly, this is a full-factorial design experiment that will involve bacterial infections (control/injection) with temperature treatments (ambient/ elevated), resulting in 9~12 treatment groups consisting of 10 animals. And I plan to sample the animals at different sampling time points (6-time points) which will end up with hundreds of animals (450~500) that need to be sacrificed for blood sampling. In this particular experiment, I am also attempting to determine a bacteria load after the animal challenge test.

Can someone suggest a suitable approach to quantify and detect bacteria in the presence of blood cells since we know if we use qPCR as a bacteria quantification method, it will not differentiate between live and dead bacteria? Another way of doing this based on literature is plate counting (in duplicate, around 3-4 serial dilutions of blood samples per animal) will also not be a doable method, just too many plates to spread, incubate and count, time-consuming and labor-intensive (according to a massive number of samples)?

Thanks for your assistance.

My question is about the inconsistency between the species authorship date and the journal publication date that appeared since Zoobank came into use.

I would like to extend my question with the following example:

Szabo et al. published a paper entitled "Gastropods from the Jurassic neptunian sills of Rocca Busambra (north-western Sicily, Italy): Patellogastropoda, Pleurotomarioidea, Scissurelloidea, Fissurelloidea and Eucycloidea" in Papers in Palaeontology. They registered their species to Zoobank in 2019, when the online first view was published. So when I refer a species from their publication, I cite the species as following "Trapanimaria gattoi Szabo et al., 2019". Their paper is included in an issue and printed in 2021. So when I cite their paper, I add the citation in the reference section as following "Szabó, J., Conti, M. A., Monari, S., & Wendt, J. (2021). Gastropods from the Jurassic neptunian sills of Rocca Busambra (north‐western Sicily, Italy): Patellogastropoda, Pleurotomarioidea, Scissurelloidea, Fissurelloidea and Eucycloidea. Papers in Palaeontology, 7(1), 27-110". This creates an inconsistency between the date of species authorship (2019) and the date of end-text reference (2021).

I wonder how other researchers solve this date inconsistency in their manuscripts.

Thanks in advance.

The article can be reached here:

Zoobank link for the publication:

Dear colleagues!

Have you ever seen a program which is able to select the most suitable pairs of group-specific primers from a set (more than 5 pairs) of proposed ones?

Suppose in my lab I have several pairs of primers for different groups of organisms (polychaetes, fish, mollusks, echinoderms) and I want, instead of ordering new ones, to select from them those that are absolutely accidentally found to be specific to... crustaceans.

In other words, a bulk search among available primers that have never been tested for specificity to a particular group.

Dear marine biologists,

Thank you in advance for helping me in identifying this Mediterranean limpet. These beautiful limpets were collected from Lebanese rocky shores, Eastern Mediterranean Sea.

I need to know which species is this? Patella caerulea, Patella vulgata, or Patella rustica / lusitanica?

Thanks :)

I am investigating microplastics in a marine mollusc and would like to obtain an initial particle count by digesting the animal tissue. I am looking into procedures and reaching out to authors with experience in this process for a simple and effective method.

All species collected from (subtidal & intertidal) of Qatari waters of Arabian Gulf, ( the size of the species between 5mm -10 cm long and between 5mm -5 cm wide). All the pictures were taken by me.

At some bays, a decrease in dissolved oxygen is observed in the natural habitat of molluscs and other benthic invertebrates. I assume that there is a good correlation between the reduction of dissolved oxygen and the volume of organic matter contained in waste and effluents from anthropogenic activities.

I share benefit from your opinions.

I read some articles on mollusc and fish diet analysis. The formula for percentage frequency of occurrence stated above:

%F0 = Nei/Ne x 100

and percentage numerical abundance :

%NI : Ni/N x 100

especially in mollusc. I want to know how is the calculation for Nei, Ni and N take place, is it an individual organisms count under microscope slide or do we need to used specific device or equipments such as haemocytometer or sedgewick rafter to count the number of the cell per area before we can fill in the Nei, Ni and N in the formula?

Thank you.

I and my coauthor have recently completed a paper on the mollusks found in a shell mound in Marin County, northern California. We're both paleontologists and are looking for someone with experience in California archaeology to review our paper. We are not plugged into the archaeology community and can surely benefit from expertise in that discipline. Thanks Chuck Powell.

Hi all,

found unusually small razor clams from bottom set gill nets. The valves are elongated and the shell is fragile. Sizes are less than 7 cm in length and 0.9 cm width. Can anyone confirm the species of this Solen?

Best

Deepak

Whoever has worked on abalone...

I have been trying to extract DNA from the blackfoot abalone (attachment muscle) and the amount of the extract is very low, no matter how much Proteinase K I add, the amount of tissue I use and the final elution buffer. Is there anyone out there who has worked on abalone who has a working protocol to use ?

Thanks

Full history is in the project description, but briefly- a team of other veterinarians/colleagues and myself have stumbled across a case of multiple animals that have similar symptoms and are co-housed. Their presentation suggests an infectious disease, but no known infectious agent could be found despite thorough work-up. However, cytology samples from clean aspirates of subcutaneous nodules and urine filtrate (they have bloody urine) seems to be showing repeated structures that do not appear mammalian in origin. We seek to understand if these structures are some type of very organized artifact, or if they instead suggest that there may be some very unusual/novel type of organism (Annelid or Polychaete esp.) causing/involved-in these animals illnesses. Thank you for your time. Invertebrate Taxonomy Parasites Mollusca Polychaete taxonomy Annelida

This type of slug abounds in my garden, located at 2,350 meters above sea level in the Andes of northern Peru (Chachapoyas, Amazonas department). Any idea to which family and genus it belong?

Dear Marine Biologists,

Do you have any experience in collecting plasma of abalone that you could give me some advice? I see 2 different methods from publication:

· cut adductor muscle in each animal with a scalpel, and collect hemolymph from the blood sinus (Zhou et al., 2015)

· collect from the pedal sinus using a 1 ml syringe with a 27-gauge needle (Venter et al., 2018a).

Which method is better? If we cut the adductor muscle, hemolymph may get contaminated with mucus?

Many thanks.

Thao

For example,

"Taxonomy and Systematics of Molluscs"

or "Systematics of Molluscs"

Full history is in the project description, but briefly- a team of other veterinarians/colleagues and myself have stumbled across a case of multiple animals that have similar symptoms and are co-housed. Their presentation suggests an infectious disease, but no known infectious agent could be found despite thorough work-up. However, cytology samples from clean aspirates of subcutaneous nodules and urine filtrate (they have bloody urine) seems to be showing repeated structures that do not appear mammalian in origin. We seek to understand if these structures are some type of very organized artifact, or if they instead suggest that there may be some very unusual/novel type of organism (Annelid or Polychaete esp.) causing/involved-in these animals illnesses. Thank you for your time.

Invertebrate Taxonomy Parasites Mollusca Polychaete taxonomy

Annelida

I am looking for a pdf versión of the Part K. MOLLUSCA 3 (Cephalopoda General Features, Endoceratoidea, Actinoceratoidea, Nautiloidea, Bactritoidea) Treatise on invertebrate paleontology.

I work in the Institute of Zoology Academy of Sciences of Moldova. My main activities are: collecting, handling and determination of freshwater macroinvertebrate up to species level (Mollusca, Crustacea, Ephemeroptera, Trichoptera, Chironomidae) according to the standardized hydrobiological methods. I have diferent species in collection, the preservation of the samples has been made by adding of 70-96% ethyl alcohol. I use of SteREO Discovery.V8 (Zeiss) and upright microscope Axio Imager А.2 (Zeiss) and ZEN modules: Measurement, Extended Focus , Time Lapse. I have a theoretical experience in PCR and DNA sequence analysis.

I would be interested to participate in the STSM COST Action: CA15219 and would like to ask you, if anybody is interested to collaborate with me as a Host professor?

Hi Everyone,

Does anyone have experience in working with haemocytes of P. vannamei or P. monodon? Could you please suggest me any effective method to prevent cell clumping when taking haemolymph out from shrimp?

Thank you so much.

Thao

I am planning some fieldwork in Algeria to assess the conservation status of freshwater bivalves (Unionidae), I can only find old 19th century published records, and it would help me to plan the field work.

I will be thankful for any eventual records you might have.

Kind Regards

Manuel

Dear colleagues,

Could someone refer me a researcher who can identify this species of parasite in freshwater mollusks?

We have some specimens and can to sent for analysis if necessary.

Dear colleagues,

I would like to join the group. My experience is largest on Mediterranean species, as well Iberian and Macaronesian taxa.

In the past I have asked several times to join the IUCn Mollusc Specialist Group, without answer. I think my experience could add something.

All the best,

Cristian R. Altaba

I am looking for articles dealing with the calcium uptake in marine mollusks such as cephalopods, bivalves or gastropods. Specifically, whether the Ca comes from sea water or from food sources.

Thank you in advance!

I want to need some information regarding those selected molluscs families for the geographic distributional range from Indian to Pacific Ocean.

I mainly focus on Marine Molluscs of Class Bivalvia, Gastropoda and Polyplacophora respectively.

Thanks !

Kind regards, Saedul

Do anybody have "Monograph of Living Chitons (Mollusca: Polyplacophora)" by Piet Kaas and Richard A.Van Belle

please I want to know the best method or protocol for DNA extraction for animals (molluscs, leeches, turtles, fish, snakes) ?

Does anyone know first-hand or know of a recorded observation as to what hemocyanin (the oxygen-binding molecule in the blood of most arthropods and mollusks) smells/tastes like? I know that hemocyanin is copper-based, but in some respects does not resemble copper visually (blue of green) due to the surrounding molecule. I know that vertebrate blood is often described as having a coppery taste despite being iron-based, so I was wondering what hemocyanin would taste like. Does it taste anything like the taste of crab, squid, or other hemocyanin-using organisms?

I have 195 gastropod (Buccinum undatum) samples that have been extracted using the phenol-chloroform method and the same 195 extracted using the ENZA Mollusc DNA extraction Kit. Individually, I have had varying success with the methods. However, when combined I can choose 195 good High Molecular weight extractions that are suitable.

I will be doing library preperation using 195 samples for ddRAD (ApeKI and BamHI) and I am wondering if it is alright to use DNA extracted via different methods to construct a single library?

I am extracting DNA from Gastropod tissue using the E.Z.N.A Mollusc DNA kit. However, I am waiting for the kit to arrive and I was wiondering if anyone knows Can I homogenise samples using Liquid Nitrogen and then store them (7 days max) before adding them to the ML1 buffer and incubating?

If this does not affect the quality of genomic DNA then it will save me alot of time.

I have attached the EZNA Mollusc kit protocol

I encountered this gastropod in sediment taken by a bottom grab on the summit of the Great Meteor Seamount (NE Atlantic) in about 300 m depth. The figure is from a sub-adult, adult specimens have one more whorl and reach a height of about 2.5 mm.

Please note the unusual protoconch with reticulated sculpture and the concavely curved lip.

I would be happy with a family that would fit.

Leon Hoffman

I am currently conducting a meta-analysis on the lipid profiles of mollusks fed different algae diets (with distinct lipid profiles). I am looking for any relevant articles or reports, specifically with data for the different fatty acids detected in mollusks (i.e., from fatty acid analysis) and any mention of their algae diets (i.e., the type of algae).

Currently working on marine macro-invertebrates (especially molluscs, echinoderms and crustaceans) from gleaners' catch for my thesis and need help in taxonomic identification and confirmation. Thank you.

W. Kobelt (1881) in Catalog der im europäischen Faunengebiet lebenden Binnenconchylien used abbreviated references to earlier literature. What could mean abbreviations "Kstr." and "Mon. Alb."? Bot h obviously refer to works with many illustrations (see the attached sample pge).

I have found numerous eggs on the lower side of stone in fast flowing river section (Latvia, geographically central part of the Europe). What species lay these eggs? Ancylus fluviatilis (Mollusca)? Other mollusc? Caddishflies (Trichoptera)? Something else?

This ovigerous mass was 4 meters deep, on a soft seabed but also near hard seabed, probably produced by a gastropod mollusk, can anyone tell me if there is an atlas of the eggsmass of the gastropods?