Science topic

Molecular Microbiology - Science topic

Explore the latest questions and answers in Molecular Microbiology, and find Molecular Microbiology experts.
Questions related to Molecular Microbiology
  • asked a question related to Molecular Microbiology
Question
6 answers
Hi, 
I'm trying to disrupt some genes of the genome of E. coli. For achieving this, I'm following the protocol of the P1 phage in which this phage transfers genetic material from one strain to another. The recipient strain is from the keio collection, so I don't have any problem with the selection of the colonies which were succesfully trasduced.
But after the confirmation of the disruption with the antibiotic screening and PCR, I tried to remove the Kn resistance using flippase. The flippase is a recombinase that recognize FRT (Flippase recognition target) sites and removes all the flanked area.
This plasmid must be electroporated and then grow it at 30°C, because it has a temperature sensitive ori.
I have done all of this but I have not obtained any transformant. Do you have any clue of why I don't get colonies? Can you give me some tips?
Relevant answer
Answer
Mercedes Vazquez Can I as you what plasmid you are talking about? Is it pCP20?
Many thanks?
  • asked a question related to Molecular Microbiology
Question
5 answers
Hello everyone,I have been trying rescue cloning experiments as per the protocol suggested by http://www.epibio.com/docs/default-source/protocols/ez-tn5-lt-r6k%CE%B3ori-kan-2-gt-tnp-transposome-kit.pdf?sfvrsn=8
but inspite of trying multiple times I am not able to get any colony on the plate.
Can anyone help me with this ?
Relevant answer
Answer
Hi Abhishek,
Did you get it to work? I am using the transposome kit and the pir-116 cells now. I had no luck so far, but the control DNA works in the cells though. Do you have any recommendations?
  • asked a question related to Molecular Microbiology
Question
8 answers
Hi,
I want to predict operons on entire bacterial genomes (already annotated). I used to use operon-mapper ( https://academic.oup.com/bioinformatics/article/34/23/4118/5040321), which is great but it has been "under maintenance" for weeks now and I really need one now.
MicrobesOnline doesn't support private genome hosting anymore and I think that the DOOR website is now down.
If you know any other tool, online or not, that would allow the genome-wide prediction of operons in complete, annotated bacterial genomes, that would be of great help to me.
Thanks
Julian
Relevant answer
Answer
You can try annotating your genome with tools like PROKKA, PGAP or RAST. And look at the predicted genes and other features
  • asked a question related to Molecular Microbiology
Question
7 answers
I have prepared PBS buffer and components for M9 medium and I store it in freeze, I do not use it if it is more than 2 weeks old. From time to time I check the sterility of these solutions and plate these solutions on N agar plate, also with a control plate. This is third time I saw something growing on PBS buffer, it was just autoclaved 3 days ago. Does somebody have any idea, which bacteria can grow on 10x PBS buffer
Relevant answer
Answer
What ive seen is that in rare cases after an autoclaved high conc PBS (phosphate-buffered saline) solution has been stored cold, it can result in precipitation which may create the impression of contamination.
Cold stored PBS ( ~ 4C // -20C) should not accommodate general lab microbial contaminants to grow. Firstly, essential C and N sources are lacking and the potential of psychrophilic microbes being present under general lab conditions is highly unlikely. It's more likely that the contaminant got into your Soln when it was being carried or handled or during the frequent contamination checks and remained stationary. PBS is stable indefinitely, I have a100 mM stock for about 14 months at 4C and it was sterile, no precipitation.
Don't lose sleep over it. A way to prevent this from happening in the future is to make small aliquots of PBS that are enough for your general use, completely cover them in a single layer of foil and autoclave. I am in a Bacillus lab, and the likelihood of spores being present on surfaces is quite high. Thus far i have had no contamination issues even with my nutrient-rich buffered media.Spray the foil (if you really worried about contamination, first with 10% bleach ) and then with 70% EtOH the foil and remove it before you want to use your PBS and it should be stable and sterile. Bleach and EtOH are not sporicidal w.r.t. Bacillus but for general microbes, it should be okay.
Try it out and let RG comments know ?
  • asked a question related to Molecular Microbiology
Question
7 answers
I try to optimize the conditions for both liquid cultures (in Bio reactors) and agar cultures.
Relevant answer
Answer
Hello,
If you want to grow them in rich media, YPD or synthetic wort media work fine. If you are after some physiological characterization in bioreactors where you would like to do carbon balances or other metabolic analysis, then you might go for a more defined media like YNB with maltose or glucose as carbon sources.
With regards,
Rosa
  • asked a question related to Molecular Microbiology
Question
4 answers
As part of a research project i have obtained plant root samples that are currently frozen. I need to isolate bacterial DNA from the plant root, however i first need to remove the possible bacterial biofilm from the plant root as the bacterial DNA is of interest, not plant root DNA.
Any advice would be greatly appreciated
Relevant answer
Answer
I agree with Debapriya Sarkar in this question but you can also use some commercially available kits, e.g., FastPrep DNA isolation kit for bacteria
  • asked a question related to Molecular Microbiology
Question
6 answers
I try to use the isolated colonies of Neisseria gonorrhoeae in chocolate agar for DNA extraction, but due to their clumping when I put them into liquid to make them dissolve, it perturb me for extracting DNA in a large collection of sample.
So how about the easiest way to doing that? Can I use the LB broth instead of fastidious or GCBL broth? What's the condition? Need I grow them in 5% CO2?
Thanks for your suggestion.
Relevant answer
Answer
N. gonorrohea is a fastidious bacterium, difficult to cultivate in liquid medium due to susceptibility to pH and divalent cation concentrations and a tendency to autolysis. Traditional broths (e.g. nutrient broth, tryptone soya broth, BRAIN HEART INFUSION) may allow limited multiplication of N. gonorrhoeae, but typically require inocula in excess of 10^5 CFU mL^−1 to achieve dense growth consistently
  • asked a question related to Molecular Microbiology
Question
9 answers
I have read in some papers that carvacrol can be diluted in Tween 80 (1%) and distilled water. I have tried this but carvacrol wasnt fully dissolved. After that i tried to dissolve carvacrol in Tween 80, water and ethanol. Is that right? Has anyone done this? I want  to use this mixture for epicutaneous administration in mice.
Relevant answer
Answer
For both, in vitro & in vivo study, I have dissolved carvacrol in DMSO.
  • asked a question related to Molecular Microbiology
Question
12 answers
Severe acute respiratory syndrome coronavirus 2, formerly known as the 2019 novel coronavirus, is a positive-sense single-stranded RNA virus. It is contagious among humans and is the cause of coronavirus disease 2019. I am trying design a model of multi epitope subunit based vaccine by immunoinformatics approaches.
Relevant answer
Answer
Following
  • asked a question related to Molecular Microbiology
Question
2 answers
I am wanting to treat BMDM or iBMM with commercial purified Flagellin. I have looked at papers and it seems to get a decent response you have to transfect it in. Does anyone have protocols for transfection into primary cells and concentrations, time etc?
Also has anyone just put purified flagellin onto cells and seen a decent IL-1b induction via ELISA
Relevant answer
Answer
Hey, I am also trying Flagellin induction, but am unsuccessful till now.. Just to ask, did it work for you? If yes, then how?
  • asked a question related to Molecular Microbiology
Question
4 answers
I'm not sure how to achieve this in a microtitre plate or petri dish, I did think by electrophoresis, but is there anything else I can use and voltage?
Relevant answer
Answer
Hello, really electrical current is an important parameter to disrupt biofilm, if you use electrophoresis DC voltage 100V with about 250mA current it will definitely disrupt biofilm but also remember about superoxide radical (toxic oxygen), which can kill your microorganisms. Unter DC voltage you will have toxic oxygen which can be decreased by superoxide dismutase or catalase.
  • asked a question related to Molecular Microbiology
Question
6 answers
I am planning to create biological databases for mutants, bacterial, strains and plasmids. I want to use FileMaker pro but I am a new user and I do not know how to create my first file. A template would be of great help to see how modifying it and adding entries. Thanks to everyone.
Relevant answer
Answer
Hello guys! I am looking for the same!! Could anyone help me with that?
  • asked a question related to Molecular Microbiology
Question
7 answers
Is where any new conformation for the conclusion made by A. Hubber?
Hubber A, Vergunst AC, Sullivan JT, Hooykaas PJ, Ronson CW. Symbiotic phenotypes and translocated effector proteins of the Mesorhizobium loti strain R7A VirB/D4 type IV secretion system. Molecular microbiology. 2004 Oct;54(2):561-74. doi:10.1111/j.1365-2958.2004.04292.x
"Nevertheless, the comparisons between R7A and MAFF303099, including the identical mutant phenotypes of the respective T4SS and T3SS mutants on L. leucocephala, strongly suggest that the type IV and type III systems are interchangeable. Over the course of evolution, bacteria can adopt either, perhaps with functionally redundant effector proteins, to translocate proteins to eukaryotic hosts."
Relevant answer
Answer
I agree with Alex Ignatov above “In theory, it might happen after gain/loss of T3SS in bacterium with T4SS (or v.v.) - so, it should be a rare event most probable for rapidly evolving group of strains.” Also, I am wondering about the different signals used for secretion of effectors in T3S and T4S and how they evolved.
  • asked a question related to Molecular Microbiology
Question
18 answers
I want to use the 16s rRNA method. Can I use genomic DNA as a template in this method?
Relevant answer
Answer
Dear all
Genetically, genes are named based on their products/functions. Therefore, there is no gene with the name of 16s rDNA. Also, 16s rRNA sequencing doesn't indicate if the RNA or DNA is used as template. Therefore, 16s rRNA sequencing can be performed based on DNA or RNA templates. Then, you should also check the downstream technique (e.g. genomics/transcriptomics).
I think some authors use the term of 16s rDNA to make clear the ambiguity by mentioning that they have used DNA as template.
Genome extraction ----> 16s rRNA gene amplification/seq. (16s rDNA)
RNA extraction -----> 16s rRNA RNA amplification/seq. (i.e. for gene expression profiling)
Best
  • asked a question related to Molecular Microbiology
Question
6 answers
The pic given is the RNA isolated from Klebsiella pneumoniae using trizol reagent. Can any one please tell me what is the bulky band at the bottom? If it is sheared rna please suggest me a way to overcome it. Even trying with all precaution about rnase I am getting that band.
Relevant answer
Answer
See attached
  • asked a question related to Molecular Microbiology
Question
6 answers
Hi all,
I want to attach live e.coli (MG1655) on microbeads by charge. I found two options:
  1. Aliphatic Amine Latex Beads (Thermo, A37370)
  2. Amidine Latex Beads (Thermo, A37328)
Both are positively charged and in the size I want. But one is hydrophilic and other is hydrophobic. Does hydrophobicity matter on e.coli attachment? My guess was that cell surface of the e.coli is hydrophilic but I found few papers attaching e.coli on hydrophobic surfaces so I started to wander. 
Also, if I decided later to put lipopolysaccharides on the surface on beads, which of two beads would be easier? What would be the protocol?
Thank you for your time!
Relevant answer
Answer
Negative charge and hydrophobic
  • asked a question related to Molecular Microbiology
Question
4 answers
We are taking up a work on milk from peri-urban areas of Guwahati city. Although there are some literature on detection of M. bovis in milk samples, I am interested on application of molecular based techniques as well as other rapid methods. How far is it possible to detect M. bovis in milk by PCR? Other than PCR, is there any sensitive and specific rapid test for detection of M. bovis in milk samples?I shall be very happy to have the answers for food safety. 
Relevant answer
Answer
We are taking up a work on milk from peri-urban areas of Guwahati city. Although there are some literature on detection of M. bovisin milk samples, I am interested on application of molecular based techniques as well as other rapid methods. How far is it possible to detect M. bovis in milk by PCR? Other than PCR, is there any sensitive and specific rapid test for detection of M. bovisin milk samples?I shall be very happy to have the answers for food safety. 
  • asked a question related to Molecular Microbiology
Question
6 answers
Hello everyone,
I have almost completed my MS thesis degree. i worked on sRNA expression and silencing of virulent gene of avian Pathogenic E coli, hoping to publish my work soon. I want to pursue my education in the field of antibacterial therapy, virulence gene expression and antibiotic resistance. I am working on research proposal and there are many ideas like "antibiotic resistance gene variation with respect to drugs and virulence gene adoption analysis". i need some suggestion about ideas and latest project ongoing related to it. it will also be good to know if some one suggest quality lab for antibiotic resistance work. Thanks
Relevant answer
Answer
Sanchari Kundu Thank you Mam. i will look into it.,
  • asked a question related to Molecular Microbiology
Question
6 answers
Hi, 
I'm looking for primers specific to Enterobacter cloacae complex or the entire Enterobacter species. The idea is to distinguish its members from other enterics by PCR. Does anyone know a sequence of such pair? 
I found multiple ready-to-use qPCR kits, but it's too advanced for what I need and there obviously is no info on the primers used. Can anyone help please? Thanks!
Relevant answer
Answer
I also need to quantify this bacteria, and the blow primer I found in this article https://patents.google.com/patent/CN102952881B/en
Hope it can help.
forward primer F: 5'-CATGACACCGGTGTTTCCCCAGT-3 '; reverse primer R: 5'-CGGTCGGTGAAGCCCAGAACCACTA-3'.
  • asked a question related to Molecular Microbiology
Question
3 answers
Hello everyone,
I am hoping to observe adhesion microscopically using staining. I have been doing adhesion experiments on 96-well polystyrene plates but I want to be able to visually observe the attachment.
Has anybody successfully done this? What type of microscopic slide should I be looking for?
Thank you for your help.
Relevant answer
Answer
I have had communication with another researcher regarding the procedure, with which he checked with BCA.
For both of us, what worked was to bind commercial mucin to a NUNC maxisorp plate using acetate buffer (pH 5.0). A drying step was utilized after incubation with the mucin.
Take note that different approaches for mucin binding to the wells are different as the composition and concentration of mucin complexes used are different. But maybe the above steps may also be helpful for you, especially with the drying step.
Here is the link to our paper that details the approach we have used:
Best,
Valerie
  • asked a question related to Molecular Microbiology
Question
4 answers
Why lactobacilli have intrinsic resistance toward Vancomycin?
Relevant answer
Answer
It's well-known that in several species of LAB, the terminal d-alanine residue is replaced by d-lactate or d-serine in the muramylpentapeptide, preventing vancomycin binding and therefore becoming resistant to this antibiotic.
Regards
  • asked a question related to Molecular Microbiology
Question
2 answers
I am trying to prepare 2-ketogluconic acid from 2-ketogluconic acid hemicalcium salt hydrate (Sigma). I found a protocol in: SWANSON, Britta L., et al. Characterization of the 2‐ketogluconate utilization operon in Pseudomonas aeruginosa PAO1. Molecular microbiology, 2000, 37.3: 561-573. :
"A calcium-free solution of 100 mM 2-ketogluconate was prepared as follows: 1.45 g of 2-ketogluconic acid salt was dissolved in 48 ml of distilled water, heated to 70 °C for 10 min and 12 ml of 10.5 M potassium phosphate buffer (pH 7.0) was added."
It seems to me it is implausible to prepare a 10,5 M potassium phosphate buffer, because it would require dissolving more KH2PO4 and K2HPO4 then it is plausible. What would be the correct concentration of the potassium phosphate buffer to obtain the desired solution of 100 mM 2-ketogluconate? Are there other easy ways to obtain such a solution?
Relevant answer
Answer
I would proceed according to the protocol. The phosphate buffer is given in excess to make sure that all the calcium is precipitated. The reaction would not be at 100% efficiency if it was conducted at stoichiometric ratio. Solubility of potassium phosphates is relatively high (150g/100ml for K2HPO4 at 20C). I suggest heating the buffer solution to dissolve it completely.
  • asked a question related to Molecular Microbiology
Question
12 answers
And good day. I just want to ask. Is it anyone of you facing coagulase negative Staphylococcus aureus before? Actually I test my Staphylococcus aureus isolate for clot formation (coagulase test) by slide test and tube test (4 hour incubation at 37°C degree) and still it not shown any clot formation. Is it any possible s? Aureus exist as coagulase negative strain? Thank you.
Relevant answer
Answer
Mr Uelinton
You need to use other primer for coa gene amplification, because of there are many primers couldn‘t amplify all coa alleles due to it high polymorphism gene
  • asked a question related to Molecular Microbiology
Question
6 answers
I want to study genetic diversity of Uropathogenic E. coli  .I  DNA extraction methods for E.coli by boiling.but i don't band in elektroforez.
Relevant answer
Answer
Dear Zeynab Faraji and everyone with the particular interest,
The RAPD is a very demanding technique, as it requires a lot of precision and the right PCR conditions to be maintained. Firstly, if the RAPD is failing, I would suggest to perform the gradient PCR. I had assessed RAPD with DNA extracted by boiling method and the results were really great, of course, after performing the gradient reaction and finding the best conditions.
In addition, another cheap, repeatable and more reliable method for the genetic diversity of UPEC is ERIC-PCR.
Good luck.
Rūta
  • asked a question related to Molecular Microbiology
Question
8 answers
I used sucrose as a substrate for lactic acid fermentation by Bacillus sp.. But, I could not find the data that showed me about theoretical yield of from sucrose. Thank you very much.
Relevant answer
Answer
Theoretical yield of lactic acid for homofermentative organisms is 100% (1g lactic acid per g glucose). That is 2 moles lactic acid per mole of glucose. For xylose, it is 1.67 moles of lactic acid per mole of xylose.
BUT, in the presence of carbonates used in neutralisation during fermentation, these yields can be up to 120% (>100%), due to the utilization of the carbonates as extra substrate.
  • asked a question related to Molecular Microbiology
Question
28 answers
Microbial lag phase is very important stage of bacterial growth to understand the physiological and regulatory process responsible for adapting to new environment. But very less is know about this phase of microbial growth. As per textbooks, lag phase allows the adaptation required for bacterial cells to new environmental conditions. This stage include the repair of bio-molecular damage and the synthesis of cellular components necessary for growth. This shows cells are metabolically active during lag phase, but are they just repairing and synthesizing bio molecules?
Relevant answer
Answer
Chronologically-
1) Alireza Mordadi - No quorum sensing is not a neither a signaling mechanism nor it regulates the deterministic factor for cells size determination or trigger for cell division. It is the mechanism which overall related with the population density in a particular environment. Basically it is radar homolog in bacteria. It might indirectly involve in the aforementioned, but not directly. Therefore, recommending quorum sensing (a wider topic) for a specific question is not supported.
2) Jay Sperry - since the discussion was not related to the biofilm but a bacterial growth in normal growth protocols, so I tried to relate the your previous comment to the context. And again it does not fit well, as you mentioned only one bacteria without mentioning any biofilm formation. "E. Faecalis forms biofilm after 14-15 days of incubation"(PMID: 27095620). So, what happens meanwhile, do cells divide or they remain in lag phase? And if we talk about E. faecalis biofilms, "SEM showed E. faecalis growth at all times" (PMID: 27095620).
Nevertheless, biofilms are special microbial structures, where the conventional growth curve does not applies. Therefore, involving biofilms in this discussion is like comparing apples and pears.
* I agree with your comment that bacteria might have different physiological growth phases, and it has been considered previously in the discussion above. Each species has its own growth rate and ofcourse cells requires time, a certain cell size and mass to initiate the division. But should we call it lag phase?
  • asked a question related to Molecular Microbiology
Question
1 answer
Recently, I have been used the RED system to delete the target gene in EPEC. According to the paper, the primer uesd to amplify the selectable marker (cat) is flanked by 50 bp of tir sequence.(Campellone K G, Giese N, Tipper O J, et al. A tyrosine‐phosphorylated 12‐amino‐acid sequence of enteropathogenic Escherichia coli Tir binds the host adaptor protein Nck and is required for Nck localization to actin pedestals[J]. Molecular microbiology, 2002, 43(5): 1227-1241.) Specifically, the primer provided in this paper were:
1. P-tir5'KO ATGCCTATTGGTAACCTTGGTAATAATGTAAATGGCAATCATTTAATTCCGCGGCCGCATGAGACGTTGAT 2. P-tir3'KO TTAAACGAAACGTACTGGTCCCGGCGTTGGTGCGGCATTTACAGAACTTAGCGGCCGCTTTCGAATTTCTGC
  Since I have no experience in gene deletion in EPEC, I have some confusion about the design of primers. I thought the sequence of P-tir5'KO should begin with the initiation codon of tir and cat, which were splited by Not1 site ; the reverse sequence of P-tir3'KO should be from the stop codon of tir and cat. However, there are no results when I use these sequences to blast. Therefore, I am very confused. Would someone please give me some help about the design of primer used to delete the targeted genes?
  Thanks very much.
Relevant answer
Answer
Hi Yaun,
Not necessarily. You design primers to amplify fragments constituting missing part of the gene. The hooks of 50 bp each are for anchoring it to the rest of the DNA. In the simplest case,
hook left- fragment left- fragment right-hook right
Length of the hook is determined by the recombination system. Without RED, you need 1 kb on each side of the gene (hook length) plus marker (kan/amp) to select for the right clone. With RED, you need 50 bp on each side of the gene and marker.
For in vitro systems, you will need linear DNA designed as before with the selection marker and typically a exonuclease inhibitor. You can do it by electroporation without RED using 1 kb hooks.
best luck,
Wes
  • asked a question related to Molecular Microbiology
Question
9 answers
I want to know What´s the best method for microbial DNA extraction of banana roots because i need microbial root DNA of banana for metagenomic studies. 
Relevant answer
Answer
I have utilized CTAB with great success in extracting fungal DNA from leaf litter at a very low cost. The MOBIO powersoil kit has also worked very well with leaf litter.
  • asked a question related to Molecular Microbiology
Question
6 answers
The requirement for updated and modern researches regarding the use of real time PCR in the detection of metallo-beta-lactamases in klebsiella pneumonia and pseudomonas aeruginosa...
Relevant answer
Answer
Are you doing direct detection from samples? If not, it's as simple as ordinary detection using primer based detection, rt master mix, no probe, non template control, and your positive control or standards, etc. You can also quantify using your standards to comparatively determine the quantity of the genes in your samples. This would be done automatically by your thermocycler, but you have to determine and insert the copy number calculated using the avocadro constant for your standards. Qualifications are only reasonable for sample based detection and less irrelevant for isolate based.
  • asked a question related to Molecular Microbiology
Question
5 answers
I am working on a virus that we have in a bluescript vector. The end goal is to rtPCR patient data but to test the primers I'd like to use our viral genome without blue as some of the primers will span the blue vector as well making the product 3kb longer. 
So I tried to cut it, run on a gel, extract the viral band, then ligate that. Then I run that against the cut viral band and an uncut plasmid that is approximately the same size as the virus, assuming the major band on the uncut plasmid to match the size of a single viral genome religated and supercoiled. Then extract just that band. Doing PCR though anything that spans the cut site isn't amplifying. The virus was put into the vector with the same cut site on both sides (BamH1)
Either way I can use the original in bluescript, but I'd like to have matching sizes between the test PCR and the background transcript in the patient data as a supplemental picture. My question is after doing T4 ligase, will denaturing the DNA break the strands at the BH cut site? Is there an easy way to ensure it doesn't break apart? We can't transform cells since we don't have a selection marker after cutting out bluescript.
Relevant answer
Answer
Second update: I heard back from the lab that they figured out what may have been the problem. The BamHI HF batch we used apparently may have been the problem as he finally sat down to do some more basic troubleshooting. I would be surprised if it was a HF vs nonHF problem and not a batch problem of the HF enzyme, but they ordered a new nonHF version and it worked fine. I think that was one of the only steps we didn't try before moving to infusion cloning since it was clearly cutting.
  • asked a question related to Molecular Microbiology
Question
4 answers
Some experiences to share with new molecular tecniques on diagnosis infectious diseases
Relevant answer
Answer
At this time, the classical approach in infectious disease diagnostics is still culture based for the majority of indications. For some indications, molecular assays are available and these are being increasingly used in the laboratories. Many companies already offer multiplex panels for a syndromic diagnostic testing approach. At this year’s ECCMID conference, we have seen a lot of cartridge multiplex PCR or nucleic acid amplification formats, enabling to test for diarrhea pathogens, respiratory pathogens, etc. Saying this, my first answer is yes, the future in infectious disease diagnostics is molecular microbiology.
However, nucleic acid amplification techniques, most likely even in POC settings, will serve as first line diagnostics, followed by culture were necessary. I therefore don’t expect a complete replacement of clinical microbiology by clinical molecular biology. However, certainly the clinical microbiology lab will undergo dramatic changes in view of the shift to molecular techniques on one side and to automation systems for culture (i.e. WASPLab, Kiestra TLA) on the other side.
  • asked a question related to Molecular Microbiology
Question
4 answers
In order to gather knowledge regarding state of the art tag sequencing methods used in the field of microbial oceanography, I am looking for on going projects of marine microbial observatories/recently published studies regarding time series of marine microbial communities.
Thanks in advance!
  • asked a question related to Molecular Microbiology
Question
5 answers
Dear colleagues,
Does anybody know something about spores of Enterocytozoon Hepatopenaei especially with regards to its stability against chemical disinfectants and UV light?
I would be appreciate for any information/links/articles or thoughts about this issue.
I have already found that it is quite new organism and there is not much researches dedicated to this problem.
Thanks!
Relevant answer
Answer
I will recommend to read the latest article detailed below:
doi:10.1016/j.aquaculture.2018.02.039
Bioassay for spore polar tube extrusion of shrimp Enterocytozoon
hepatopenaei (EHP)
  • asked a question related to Molecular Microbiology
Question
3 answers
Need a topic to study on RNA from human blood where i can utilise QIAamp RNA Blood MINI KIT?
This may sound a bit strange but I am looking for a good study topic where i can utilize Qiagen Qiaamp RNA Blood Mini Kit for some good use.
Hello Everyone
The thing is i am working in a district government hospital as a Microbiologist. Here along with routine sample analysis we are also developing a molecular microbiology lab where we are developing protocol for identification of human pathogens and detecting drug resistance. We have a QIAGEN QIAcube, Rotor Gene Q, QIAxpert, Serum HPLC and PCR at our disposal.
Now during our initial setup we had asked QIAGEN to provide all the necessary kit which would be required by our lab. That's where they provided us with 4 Boxes, 50 reaction each of Qiagen Qiaamp RNA Blood Mini Kit. We are not sure where to put good use of it. We are still not studying human blood RNA. We do study viral RNA but for that we use QIAamp Viral RNA mini kit.
Now since we have this RNA Blood kit, we are planning to use it for some useful purpose which would help further development of our laboratory. We have an attached pathology lab where we can get blood sample for any disorder.
So i need help from you on suggesting me based on your experience
a) a topic which i can look upon or
b) a target RNA in human blood for disorder/Cancer or
c) Any Viral RNA which can be recovered by Qiagen Qiaamp RNA Blood Mini Kit from blood or
d) Any other suggestion
by which i can utilize RNA Blood Mini Kit
Limitation: I am looking for a single or may be just 2 RNA target to study. We have Reverse transcriptase kit and Q-PCR at our disposal. We can also purchase primer for a any target CDNA. Designing a single probe for Q-PCR is possible but i don't have budget for multiprobe study. If the target gene could be studied by SYBR green kit than that would be great.
Thank you
Limitation: I am looking for a single or may be just 2 RNA target to study. We have Reverse transcriptase kit and Q-PCR at our disposal. We can also purchase primer for a any target CDNA. Design probe for Q-PCR is possible but i don't have budget for multiprobe study. If the target gene could be studied by SYBR green kit than that would be great.
Relevant answer
Answer
Hi Mustafa,
First, you need to select the disease based on the sample availability. And then the second step will be to identify the gene targets for RNA experiments, this can be done in silico using the publicly available gene expression datasets (however this requires bioinformatic skills). Other way to narrow down to the targets may be to find out some good publication (literature survey) which have identified novel target genes for the particular disease but the experimental validation is yet to be done on human samples and use these target genes for your RNA experiments after acknowledging that particular article.
Hope this helps.
  • asked a question related to Molecular Microbiology
Question
9 answers
I am using a protocol with 16 hours of stimulation with LPS (100ng/ml) and then 24 hours of treatment with my samples. I remember that I found an article where did such a thing, but I can not find it. I need it for a quote, but in all the articles I've read recently is made a cotreatment with LPS and samples to be tested.
Relevant answer
Answer
Dear Milena
1. How many cells must be plated to obtain an optimal stimulation?
Our lab found 20 000 cells per well in 96-well plate as most optimal but that it doesn't mean it is the best option for your experiment
2. What parameter do you use for normalize Nitrite results?
I am not sure I understand, but we simply perform Griess assay with a standard curve and then normalise to the sample treated with LPS only.
3. With is the solvent for LPS and Do you sonicate LPS?
We buy one from Sigma and dissolve it in PBS, store small aliquots in the freezer and never reuse aliquot which has already been thawed up.
4. Do you see some morphological changes in activated raw cells?
Only if the LPS concentration was so high that it was toxic. Otherwise not.
5. During LPS treatment do you use FBS?
Yes
6. Do the cell passages influence LPS stimulation?
Yes, the best cells are of low passage number and after passage 10-15 we observe loss of NO production
Good luck
Kaja
  • asked a question related to Molecular Microbiology
Question
5 answers
Hi, is it right how I sterilize these items:
1. Pipette tips box: Close the box and autoclave or should I open it slightly to allow steam to penetrate.?
2. PCR tubes/microcentrifuge tubes: Place it in glass beaker and cover with aluminium foil.
3. Mortar and pestle: Wrap with aluminium foil and oven dry for 2-3 hours at 200 degree celsius? Can I autoclave?
4. Stainless steel (forceps, scissors etc): wrap in aluminium foil, then autoclave or oven dry at 180 degree Celsius?
I read somewhere on internet that for items like PCR tubes that are DNase or RNase free, it is not necessary to autoclave, but with our lab condition, I am not confident with it sterility, and I opt to autoclave it again.
Relevant answer
Hi Iffah,
Here are the answers for your questions, based on my experience working in the lab:
1. Close the box properly, make sure no water can go inside the box then autoclave it. You can also use tape to make sure it is sealed properly.
2. Yes, that's what we usually do.
3. Wrap them with aluminium foil, autoclave it, take them out and let it sit in the oven until it is dried.
4. Yes.
Although the microcentrifuge and PCR tubes are DNase and RNAse free, they are not sterilise. We usually autoclave all these items especially if you are working with biological stuff that can easily contaminated.
Hope it helps.
  • asked a question related to Molecular Microbiology
Question
2 answers
in my knowledge, there are three identified external death factor for bacteria, is it true?
those have a limited range action, is there a broad range of them?
Relevant answer
Answer
I discuss about other things. EDF is a quorum sensing signals that starting programmed cell death in bacteria and it isn't extra cell toxin. EDF in some way caused unstable toxin-antitoxin complex in bacterial cell.   
  • asked a question related to Molecular Microbiology
Question
5 answers
I recently performed a DNA extraction for a microbiome project from cotton rectal swabs and urine pellets using phenol-chloroform. Briefly:
1. Swabs were incubated with a mutanolysin/lysozyme enzyme cocktail for 1h @ 37C
2. Added glass beads, phenol:chloroform:isoamyl alcohol (25:24:1) and 20% SDS, then agitated (TissueLyzer/bead beater) and centrifuged @ 14k rpm x5 min. 
3. Aqueous layer transferred to a clean tube, and added 3M sodium acetate and ice-cold isopropranol at -20C overnight.
The next day, no pellet! I pulled off the supernatant carefully (assuming there might be a pellet I couldn't see) and re-constituted in water, ran a PCR and a 1% agarose gel but no DNA bands! I ran the sample on the UV-Vis (Nanodrop) and got nothing (no peaks, no DNA). 
I also tried UV-Vis on the supernatant and got what looks like a phenol peak at 270 and also a second peak at 260, which I think is DNA (see attached). 
My interpretation is that the aqueous supernatant (with NAOAc and isopropanol) still has both phenol and DNA in it, the former being a technical error I suspect. I've tried adding more NAOAc or isopropanol or even repeating the phenol-chlor extraction with aliquots of this supernatant, but to no avail. 
Does anyone have suggestions on how to pull the DNA out of this solution?
Relevant answer
Answer
organic extraction can be tricky. try PureLink microbiome kit- it has protocols for swabs and other 
  • asked a question related to Molecular Microbiology
Question
2 answers
I am performing a 16S microbiome study, and have sent my samples to a lab for NGS using illumina MiSeq, until our own MiSeq here is up and running. I have received pictures of the preliminary microbiome PCR gel (25 cycles) and there is a strong band of the expected length (approx. 300bp) in all of the samples analyzed. A second PCR was then performed with sequencing adapters added, which displayed very faint bands on the gel, at a slightly higher molecular weight (due to the adapter integration).
I asked the sequencing company whether this was due to reduced number of cycles at the library prep stage and they confirmed that this was the case, with only 5 cycles to avoid PCR bias. Is this enough, or are more cycles than 5 usually used? The genomic DNA used for PCR template 16S amplification was extracted from the fish gut, and measured between 50-300ng/ul with Qubit analysis.
Relevant answer
Answer
This is a late answer, but I have had success using 10 cycles. I have seen as low as 8 cycles. I have heard there are new Illumina primer barcodes that can be used in 1 step instead of 2 step PCR, which would save a lot of time and money. However, I haven't found them yet.
  • asked a question related to Molecular Microbiology
Question
6 answers
I cloned my gene of interest in pET-22b vector. I could transform DH5α E. coli strain. But I am not being able to transform expression strain of E. coli. My transformation protocol is; thaw the competent cells for 30 mins in ice after adding vector, heat shock for 45 sec at 420C, place back in ice for 2 mins, add 500 µL SOC, incubate at 370C and then transfer to LB plate. And I am using ampicillin at concentration of 150 µg/ml. So, why do I get bacterial colonies for DH5α but not for other strains?
Relevant answer
Answer
It may be helpful to read the book at the link.
  • asked a question related to Molecular Microbiology
Question
4 answers
I need to know the purification quality of these kits
Relevant answer
Answer
If you are worried about the purity of your sample, there are commercial products available to remove contaminating human DNA and significantly amplify signal:  https://www.researchgate.net/publication/298064100_Broad-Range_Microbial_DNA_Isolation_from_Clinical_Specimens_for_Universal_PCR_Diagnosis
  • asked a question related to Molecular Microbiology
Question
1 answer
Designing a circuit in E. coli that expresses GFP when carbon monoxide is present via a modified CooA protein and modified lac operon. RFP is then expressed when there is no carbon monoxide. I need to break down the other when one is expressed so that the signals do not interfere with each other but struggling to find a protein that will break it down.
Relevant answer
Answer
There are GFP variants that have been made unstable by adding a short peptide tag that targets them for degradation so they don't hang around in the cell for very long. I've never worked with them personally, and maybe someone's improved on it since this paper, but it's probably a good place to start. It also seems like the easiest option for modifying existing constructs. 
  • asked a question related to Molecular Microbiology
Question
5 answers
I'm isolating P. aeruginosa from an oil spilled soil using Mineral salt medium, thereafter go on to isolate the PCA from the organism but am not getting positive result, which other way should I go about that? I also want to know know the chemosynthetic way to produce this compound, PCA antibiotics. Thanks
Relevant answer
Answer
Thanks a lot, Marielsa Gil. I found your recommendation and directions very helpful. I Will get back to you on the progress soon. Thanks once more.
  • asked a question related to Molecular Microbiology
Question
4 answers
If I want to lyse bacterial cells and extract bacteriocin, should I add DNase I to the suspension? will it have any effect on the concentration of bacteriocin or DNase I will only cleave DNA?
Relevant answer
Answer
The role of the DNase is to reduce viscosity, otherwise your lysate is highly viscous and things get trapped. Sanitation or some other treatment that disrupts the DNA can be used instead of DNase, or if you are doing a gentle detergent lysis then the addition of DNase just makes the subsequent steps easier. It should not have any effect on the bacteriocin concentration but might make it easier to purify. 
By the way, many bacteriocins are extracellular and you can purify them without lysing the bacterial cells. You might want to determine whether that is the case with yours. 
  • asked a question related to Molecular Microbiology
Question
6 answers
I would like to do susceptibility tests on non culturable fungi isolates from clinical and environmental  samples.
Relevant answer
Answer
Thank you Umar.
  • asked a question related to Molecular Microbiology
Question
13 answers
I plan to use the Illumina MiSeq platform to sequence cDNA of a transcriptome from soil bacteria and fungi. 
Relevant answer
Answer
Thanks for your help - I definitely need to do more research
  • asked a question related to Molecular Microbiology
Question
5 answers
I would like to perform PCR on crude bacterial lysate. Has anyone successfully done so using lysozyme, and if so what formulation was used?
Relevant answer
Answer
Using a fresh culture, you could try resuspending a few colonies in 150 µl TE buffer (10 mM Tris-HCl, 1 mM EDTA), boiling at 98ºC during 10 min in the thermocycler and using the supernatant as DNA template (5 µl) for amplification.  It works well with Bacillus anthracis.
  • asked a question related to Molecular Microbiology
Question
5 answers
I know the lysostaphine is the easy way to extract DNA from Staph, but it is expensive. I prooved already the simple boiling way but it does't work.
Relevant answer
Answer
Using a fresh culture, you could try resuspending a few colonies in 150 µl TE buffer (10 mM Tris-HCl, 1 mM EDTA), boiling at 98ºC during 10 min in the thermocycler and using the supernatant as DNA template (5 µl) for amplification.  It works well with Bacillus anthracis.
  • asked a question related to Molecular Microbiology
Question
16 answers
I'm doing some anaerobic microbial experiments, in which I'm using an anaerobic hood for preparation of cultures and plating for enumeration. I put my plates into sealed jars, and remove them from the anaerobic hood to incubate. I think that the jars are maintaining anaerobic conditions, but I want to use an indicator as proof. 
I know I can buy indicator strips, but I have resazurin in my lab, so I made up a solution (30 mg/L in deionized water), and left it in my anaerobic hood to deaerate. However, after over 24 hours in the hood, the solution was still blue. As I understand it, the solution should turn pink initially (and irreversibly), then clear when under anaerobic conditions. According to my oxygen/hydrogen probe in the hood, conditions were always under 1ppm oxygen.
Am I missing something here? Do I need to provide alternative reducing conditions (somehow?) in the solution initially so that it turns pink? Or would purging the solution with nitrogen ensure that my solution is fully anaerobic? Any thoughts would be greatly appreciated!
Relevant answer
Answer
I have been working long time with Resazurin:  it clearly show anaerobic conditions  only when there is total absence of oxygen. Also the pH is important for Resaruin to become clolorless. The point is that flushing with nitrogen does not mean having total absence of oxygen. When I worked with liquid media, the addition of sodium sulphide caused the riduction of all the oxygen and the medium became colorless. Working with anaerobic jars, you have to add some small bags: the compound inside the bag reacting with added water, produces hydrogen, that by a catalizer bag  located in the jar, allowes the total reduction of oygen. In these conditions, the small strips of resazurin indicator become colorless. The nitrogen alone, even at high purity, contains always minor amounts of oxygen: the resazurin never will turn colorless if you do not add a compound able to transform the residual oxygen in H20. So if you need "strict" anaerobic conditions, you must add a chemical that "destroys" all the residual oxygen present.
See these papers:
Tandoi V., Di Stefano T., Bowser P.,Gosset J.M. And Zinder S.H. (1994): Reductive dehalogenation of chlorinated Ethenes and halogenated ethanes by a high rate anaerobic enrichment culture. Environmental Science and Technology, 28, 973-979.
Gatell X.M., Tandoi V., Gossett J.M. and Zinder S. H. (1995): Characterization of an H2 utilizing enrichment culture that reductively dechlorinates tetrachloroethene to vinyl chloride and ethene in the absence of methanogenesis and acetogenesis. Applied and Environmental Microbiology, 61, 3928-3933.
  • asked a question related to Molecular Microbiology
Question
6 answers
hi
What is the prerequisite before me conduct relative quantative real-time PCR?
Relevant answer
Answer
Dear Fahimeh,
When using the standard curve method, the quantity of each experimental sample is first determined using a standard curve, and is then expressed relative to a calibrator sample.
In order to use this quantification method, prepare five (5) 2-fold, 5-fold, or 10-fold serial dilutions of cDNA template known to express the gene of interest in high abundance. Use each serial dilution in separate real-time reactions, and determine their threshold cycle values.
In a base-10 semi-logarithmic graph, plot the threshold cycle versus the dilution factor and fit the data to a straight line. Confirm that the correlation coefficient (R2) for the line is 0.99 or greater.
This plot is then used as a standard or calibration curve for extrapolating relative expression level information for the same gene of interest in unknown experimental samples. The relative quantification calibration curve result for the gene of interest is normalized to that of a housekeeping gene in the same sample, and then the normalized numbers are compared between samples to get a fold change in expression.
A standard or calibration curve must be generated separately for each gene of interest and each housekeeping gene.
  • asked a question related to Molecular Microbiology
Question
10 answers
I have three types of samples including liquid samples (water, milk), solid samples (feed, feces) and aerosol samples. After quantifying by qPCR, I have the copies number of each sample. However, I don't know how to compare the number of bacteria among these samples because of the differences in their characteristic and difference in unit (g vs ml) as well. Could anyone give me suggestion? Many thanks.
Relevant answer
Answer
Let me know why do you want to compare the number of bacteria. As per the information given by you, it is a redundant exercise. 
  • asked a question related to Molecular Microbiology
Question
6 answers
16s paired -end sequencing using illumina platform.
Relevant answer
Answer
At least 3 soils samples (or replicates) per plant, but it is better if you have more.
  • asked a question related to Molecular Microbiology
Question
8 answers
I have isolated lactic acid bacteria isolates and through basic characterization I found that they belong to lactobacillus genus is there any biochemical method which can differentiate species of isolates before I do 16S rDNA analysis 
Relevant answer
Answer
Dear Saleem, I suggest you to directly proceed for species specific PCR or 16S rRNA based sequencing. Using biochemical methods may not be useful and conclusive.
  • asked a question related to Molecular Microbiology
Question
7 answers
How to screen a large collection of different bacterial isolates with lowest contamination risk (liquid LB medium)? and,  Do you have any suggested how to keep them in -80 with limited space?
We will have a large collection of different bacteria together which we need to screen them. Although, I know that one of the possibility is keeping them in 96 well plates to not get too much space but anyone has any other suggestion? Even if we sealed them by stickers, we will have the risk of contamination. Do you have any other suggestion in this regards?
Thanks
Relevant answer
Answer
the best is to use small glass capillaries as container for frozen isolates (20% glycerol or DMSO).
  • asked a question related to Molecular Microbiology
Question
7 answers
I'm studying the ability of extracellualr enzymes production for some fungal strains using congored plates. What is the best way to calculate the enzyme index. what I'm trying to use now either
EI=diameter of hydrolysis halo zone/diameter of colony OR area of hydrolysis halo zone/area of colony
Relevant answer
Answer
It depends how you obtain fungal colonies. Do you start from one spore or just a "loopful" of mycelium? in this second case the colony diameter or area is not indicative of growth. Thus I would suggest to measure only the decoloration halo diameter excluding the diameter of the colony
  • asked a question related to Molecular Microbiology
Question
6 answers
RNA profile for all my samples shows strange big peak at 5S position. Should I use these RNA samples for downstream experiments? Does anyone know if this is common with Staphylococcus aureus. Total RNA was isolated by using RNA protect (Qiagen) for stabilisation of RNA. RNeasy kit was used for extraction. I have also noticed that the concentration of RNA is differs with the instruments used. Nanodrop gives higher concentration than Bioanalyser for the same samples. Please let me know what you think regarding the peak shown in attached image. I have very limited experience with RNA and seeking for experts help. I am happy to provide any other detail you might want to know. Thank you very much.
Relevant answer
Answer
From the position of the small peak close to the 5S, I would say that you are detecting the tRNAs, so nothing to worry about. You can run the sample on a PAA gel next to an appropriate ladder for confirmation, the bands should migrate between 70-90bp. 
I would rather be concerned about the great imbalance of extracted 5S and 16/23S. Is the kit/protocol you used designed for specific isolation of small RNA?
  • asked a question related to Molecular Microbiology
Question
4 answers
I have been looking for a protocol to quantify ROS formation in bacteria using a spectrofluorimeter, NOT a fluorescence microscope, but I failed to find one.
I have APF and SOSG (singlet oxygen sensor green) as probes.
  • asked a question related to Molecular Microbiology
Question
4 answers
Lactic acid bacteria producing bacteriocin
Relevant answer
Answer
Hi
The resistant bacteria against lactic acid Bactria different among spices of bacteria. 
example five strains of   L. monocytogenes  some strains inhibition and no inhibition either strains . The resistant bacteria  depends on several things
  • asked a question related to Molecular Microbiology
Question
5 answers
I am trying to prepare agar plates from the CHROMagar powder and the instructions say to mix 33g in 1L of water and bring to the boil at 100 degrees before autoclaving. This is difficult for me as my lab does not have bunsen burners or waterbaths with this capability. I was wondering has anybody tried making this agar without boiling the solution before autoclaving. Thanks
Relevant answer
Answer
Do it on a microwave oven.
Also, if your autoclave is an old model (where you can remove items from the sterilization chamber while the temperature is still relatively high) you might try autoclaving directly, without melting the agar beforehand, and then homogenizing the resulting solution afterwards.
  • asked a question related to Molecular Microbiology
Question
8 answers
Want to know how efficient well diffusion is over disc diffusion
Relevant answer
Answer
Disc or well diffusion tests are both qualitative assays. Hence, they wont give an accurate estimation of the effect of the antimicrobial activity of plants extracts or any other antimicrobial agent. Minimal Inhibitory Concentration (MIC) and IC50 values must be investigated for quantitative estimation. It all depends on what you are testing e.g. crude extract, protein extract, pure compounds or mixture of phenol-like compounds...doing well diffusion or disc diffusion test of crude or non-purified compound is meaningless... any plant extract would have some inhibitory activity due to the phenolic substances...  
  • asked a question related to Molecular Microbiology
Question
2 answers
Is ycplac33 not expressed in this saccharomyces without the introduction of other promoters?
  • asked a question related to Molecular Microbiology
Question
3 answers
I have tried using MRS broth and plating on MRS agar with 0.01% calcium carbonate and there is bacteria colonies growth on plates. Unfortunately, almost all colonies shows catalase positive which is not belong to lactic acid family. Lactic acid bacteria is catalase negative or is it possible to have a catalase positive lactic acid bacteria?
Relevant answer
Answer
Lactic acid bacteria (LAB) are catalase-oxidase negative in general. MRS is usually used to cultivate LAB. In case you got other microorganism on your plate, it is highly suspected that you have contamination and in most cases this contamination is due to either Bacillus spp or other yeasts which can grow also on MRS. You may consider using M17 supplemented with 5% lactose or glucose. Do not use general media ! LAB needs enriched media to grow. In addition, most of G-negative bacteria can not grow on MRS. If you are not happy with MRS and M17, you can use Tryptic Soy broth supplemented with 2% yeast extract.
Keep in mind that it is not as easy as it looks to isolated pure LAB from honey or any other fermented sources.
-Abdelahhad
  • asked a question related to Molecular Microbiology
Question
4 answers
Hello everyone!
I'm starting a project involving phage display and the protocols largely sound like I can do my panning on the bench top, instead of in a biosafety cabinet.  Do I need to pan aseptically?  Or how do I prevent contamination downstream when I infect my E. coli cultures with the selected phages if the solution the phages are in is not sterile?  Do you filter the recovered phages before infecting?  Any suggestions?  General knowledge?
Relevant answer
Answer
Stephanie, I think it largely depends on how clean (i.e. particle free) your lab environment is and what else is happening near and around you: Mold growing in the aircon and in/on fridges, colleagues happily eating crunchy food next to you and mice running around your bench (or your labemate's)?  In that case, (and in general, actually) better escape under a laminar flow, as the experiments are pretty lengthy and laborious, and the phage libraries are pretty precious and expensive resources.
There is no need to panic about biosafety however, it's rather about protecting your samples and ensuring the quality of your data.
Before you are going into the "hot phase", the manual probably suggests to get used to the techniques involved and to do some phage amplification and retrieval and, possibly, playing around with a control phage panning experiment until you are sure you want to do the actual screening. So you actually may check safely if you don't get nasty contaminations.
  • asked a question related to Molecular Microbiology
Question
19 answers
I want to see the community structure of the soil amended with biochar, however, I've got difficulty in extracting high DNA yield. My samples did not pass the quality control for next generation sequencing analysis, so I'm thinking for another option with the same target yet with low conc. of DNA. Do you have any suggestions on what to do with my DNA with very low conc (>5ng/ul but less than 15ng/ul) ? Thank you very much. 
Relevant answer
Answer
I take it you are sending the samples to a commercial facility with fixed standards for acceptable material? We sequence some extremely low biomass samples that come from extreme environments--some work, some don't.  If you take the risk that they won't work, would your facility make the attempt? 
Someone may suggest using whole genome amplification, but I don't advise it. Your results almost certainly will be biased. 
  • asked a question related to Molecular Microbiology
Question
2 answers
I am going to run a flow cytometry experiment on synthetic communities of microalgae and bacteria. I would like to use a nuclear stain to determine all the biological particles, and gate those to ID microalgae Chloroplast fluorescence to ultimately determine the bacteria:Algae ratio. I will also be running a supplementary experiment to stain with Nile Red to reveal the effects on neutral lipid synthesis.
The nuclear stain I think would be best suitable is SYBR-Green (or some kind of SYTO stain) because it should use the FL1 laser we have (ex laser: 488, FL1- 533/530). Nile Red should be picked up by the FL2 laser (ex laser: 488, FL2 - 585/40), and the Chloroplast should auto-fluoresce with the FL3 laser (ex laser 488, FL3 670 LP).
Will this staining procedure/experiment achieve what I hope to? I should note I am a very amateur user of the flow cytometer and analyzing its data.
Relevant answer
Answer
Hi Samuel, unless your lab uses Nile red frequently to assess lipid accumulation in multi-stain assays, I suggest avoiding it. Nile red exhibits solvatochromism in a hydrophobic environment (such as neutral lipid), and this causes a 40nm emissions to lower (more blue/green) wavelengths. As a result, it overlaps heavily with green fluorophores. I've worked a lot with Nile red (but not with algae) and I know it will be detected in FL1 of your cytometer. Depending on how much lipid (hence staining) is present, you may or may not be able to compensate the signal from Nile red out of the SYTO signal. If you have the money for it, you can use other BODIPY or LipidTOX dyes that emit in the red and stain lipid.
In terms of actually doing the experiment, Arno has good suggestions. To check for spectral overlap of the fluors, you can use samples stained individually with each fluor to set the compensation parameters (your flow technician should know how to do this).
When you process your data, I suggest using FlowJo. You need to buy it , but its very good software. I havent used them, but free softwares are Flowing and CyFlogic.
Hope this helps!
Here's a paper for you on Nile red:
  • asked a question related to Molecular Microbiology
Question
14 answers
I need to remove human dna data from HiSeq metagenome sequencing data of human gut. Is there any available script/software to use?
Relevant answer
Answer
Hey Katya!
I would recommend using the "bbmap" tool included in the "BBTools" suite for that task.
For an introduction to the "bbmap" tool: 
For a description of how to use bbmap to remove human contaminant DNA (also includes an already processed reference genome available for download):
  • asked a question related to Molecular Microbiology
Question
10 answers
i need to know which method is more practical for storing bacteria with less change in genotype.
Relevant answer
Answer
Make a heavy suspension of your culture in glycerol broth (20% glycerol) and place the vial as soon as possible at -80°C. When needed scrape a little material from the surface of the froozen stock (prevend thawing of the stock) and culture in a suitable growth medium. Your strain will stay viable for many years this way. Using small srewcap vessels with one to one and a half milliliters glycerol broth will be enough.
  • asked a question related to Molecular Microbiology
Question
11 answers
Hi,
I want to evaluate the effect of supernatant from an actinobacterium on Staphylococcus aureus biofilm formation, but this supernatant showed antimicrobial activity against S. aureus, so i can’t evaluate the antibiofilm activity.  
Please guide me how can i do this in simple way?
Relevant answer
Answer
To evaluate the antibiofilm efficacy of different matherial such as titanium surfaces, the whole biomass present on each disc was detected. Briefly, biofilms grown on titanium
discs were air-dried and stained by disc immersion in a 5% crystal violet solution for 15 minute and, after several washing , air dried again. The estimation of biofilm biomass was performed by elution of the biofilm bound crystal violet with ethanol (96%)
followed by the determination of the absorbance of 100 ll of eluted dye solution at 595 nm using a microplate photometer (Multiskan FC, Thermo Scientific; Milan, Italy). Measurements for each discs, were carried out in triplicate. For each bacteria and
surface, mean values and standard deviation of absorbance value were computed. Un-paired Student’s T test was used to compare data between experimental surfaces.
I hope this protocol help you
  • asked a question related to Molecular Microbiology
Question
2 answers
 Native H. pylori Urease 
Relevant answer
Answer
I do not know how far it be relied upon the supply of urease as mention by Mozafari. If I were you I would go in for isolation of the enzyme form the culture of H.pylori which would definitely very reliable for my research work. The isolation of the enzyme is pretty easy.
  • asked a question related to Molecular Microbiology
Question
4 answers
Hi, I´m using this method for detection one of phytopathogenic bacteria. Now I´m testing new primers (without loop primers):
reaction:
 20 ul reaction with 2 ul 10x Isothermal Buffer (Optigene), 25mM MgSO4 change (3 - 5mM), 1.4 mM dNTP mix , 40uM of each FIP and BIP, 5 uM of each F3 and B3, and 8U GspSSD2.0 Polymerase (Optigene), 3,2 ul template DNA, and molecular grade water.
I´ve had problem with contamination of negativ control (water). Now is good, but I have a problem with specifity and with some eror with preparation reactions.
On two pictures is same reaction which is prepare with same procedure.
from left: Xv - bacteria, which will detect, Xe,Ps,Ea - will no detect, NC - negative control, M - marker
change concetration of MgSO4 (from left 5mM, 4mM, 3 mM)
Why I have got different results? (big mistake in preparation, beacause it is prepare to small amout reaction? bad designed primers? badly concetration MgSO4? Will I add betain?
If anyone has faced the same problems and or know the cause and solution, I would really appreciate some help. Please email me at dagmarstehlik@gmail.com. Thanks!
Relevant answer
Answer
First, I think it's good result for negative control. The Xv products are really good, but your problem is the false positive to other DNA, right? So, my comment is may be you can decreased the incubation time to be 30- 40 min because from you picture it's seem like the Xv product is very strong while the others are weak or low concentrations (except Ea and Cms). or may be you can increase temp. to be 66-67 C. 
PS. I have question about the concentration of the outer and inner primers in the reaction why you use the same concentrations (1.6 uM) or it is your mistake of typing information. Because normally the inner primers should be more than outer primers 8-10 fold. Good luck for you.
  • asked a question related to Molecular Microbiology
Question
6 answers
For experimental evidences  for aggregation/ cell membrane penetration or self-assembling nature on surface or any other surface phenomenon by visualization techniques.
Relevant answer
Answer
Hi Krishna Kumar Sharma, I worked with a few antimicrobial peptides (Their role in immune modulation). Sometime during my study I planned to visualize the peptides in the cell membrane (or in cytoplasm), but dropped it because my goal is to see the immunological status of the mammalian macropage in the presence of the peptide. If you are trying to see the peptide aggregation on bacterial surfaces through florescence microscopy, label the peptide with Cy3 (Red) using protein labeling kit  (GE health care) and bacteria with CFDA/SE (Invitrogen) (Green) vital dye. Incubate the labeled bacteria and peptide together for 1 hour. Fix it with 2% para-formaldehyde and mount it on glass slide to see it under Confocal or florescence microscope. You can see the bacterial labeling with CFDA/SE here https://www.researchgate.net/publication/299576966_Comparative_Analysis_of_the_Effects_of_Two_Probiotic_Bacterial_Strains_on_Metabolism_and_Innate_Immunity_in_the_RAW_2647_Murine_Macrophage_Cell_Line. All the best for your research.
  • asked a question related to Molecular Microbiology
Question
3 answers
I am new in DGGE analysis. I am evaluating fungi profile from root samples and doing 2 PCRs with ITS primers, including the nested PCR, before run the DGGE. I wonder if two or three bands in an agarose gel are problematic in the DGGE analysis, or if it can be arbitrary, just related to the sample diversity. Is it possible to find it, or I'd better avoid those samples?
Thank you for attention!
Relevant answer
Answer
Hi Erica,
Could you include a picture of your gel to give us an idea how close together the bands are? Following on from Julian and Ali's questions, you need to work out if the multiple bands are
  • unspecific or cross amplification - this will be bad for your analyses as these samples do not contain the sequences you wish to compare. Adjusting your PCR conditions or changing primers may help.
  • ITS sequences of different length - if this is the case, there is already some selection going on between genera that fall into either of those sequence lengths. In this case I'd recommend loading your entire PCR product on a gel, getting that resolution between the two (or three) ITS lengths then cutting out those bands. Those can then be purified using a gel purification kit (or simply  leaving the band in eppendorfs with molecular water in the fridge over night) and then load each band on a different lane in the DGGE.
DGGE is a massive pain to work with. If there is any way you can change that part of your experimental design, I would highly recommend doing so.
Also, one common problem with community analysis is that your answer is very dependent on the primer set you use. It's worth checking that the set you have selected is adequate at amplifying your target fungi so you don't unintentionally loose some information. Depending on what taxon resolution you're after, ITS may be too short a sequence to give you an ID down to species level when you get to the sequencing stage.
All the best!
  • asked a question related to Molecular Microbiology
Question
4 answers
I want to identify my bacteria that i have isolated. I would also like to know the difference between the two techniques (Maldi-tof & sequencing) in terms of results.
Is it necessary to do biochemical tests, microscopic tests (gram test ...) before using the maldi-tof ms?
Thanks,
Meriem,
Relevant answer
Answer
Hi Alex,
Thank you again for clarifying things.
I will inquire about the database before starting to identify my bacterial strains.
Have a good day,
Meriem
  • asked a question related to Molecular Microbiology
Question
5 answers
I am going to be growing the three mention strains and just wondering if trypticase soy yeast extract medium be ok for all three strains or do i need to grow them on more selective media ?
Relevant answer
Answer
Hi Jorge
Thank you so much for your help. Just a few more things, should i do an OD before i plate them or just plate them after 24hrs ? Also should I test the them on selective agar just to make sure the bacteria is the strain i want ?
  • asked a question related to Molecular Microbiology
Question
2 answers
I have started work on culturing a strain of bacteria, Pseudoalteromonas citrea, I have read into the background of growing the strain but I would like to know if anyone has dealt with this bacteria in the past and if so, what growth conditions were used. Any information will be greatly appreciated.
Relevant answer
Answer
Thank you for your response, I have used the aforementioned Difco marine agar and those plates appear to stimulating better growth, I have also noticed an increase in colonies by changing the incubation temperature to 28 degrees.
  • asked a question related to Molecular Microbiology
Question
5 answers
I do not have any kit to be use in purification. Can anyone suggest an effective and easy way to purify the DNA? Thank you in advanced! 
Relevant answer
Answer
Sim Huey Yi:
The following reference may help you.  The full article should be available through open access.
Girardin H, Latge JP, Srikantha T, Morrow B, Soll DR. Development of DNA probes for fingerprinting Aspergillus fumigatus. J Clin Microbiol. 1993;31:1547–1554.
  • asked a question related to Molecular Microbiology
Question
3 answers
I'd like to check the identity/integrity/validity of the plasmid with the alternative names above. The size is too large for a simple gel, so restriction fragments should rather be inspected, but for that I'd need to know the sequence to see if the pattern is correct.
I could not find the sequence in NCBI - Addgene - DSM - Stanford - etc... :(
So we'll blindly use it and if it works, then fine. :)
Relevant answer
Answer
Thanks a lot.
  • asked a question related to Molecular Microbiology
Question
5 answers
I was trying to recover the Lactobacillus DNA through simple boiling method. Some of the samples failed but one showed fragmented band. The boiling method include:
Loopful colonies from MRS media. Washed with PBS. Heat it at 99C, centrifuged it and ran gel electrophoresis. 
Relevant answer
Answer
Thank you @Ali Mahmoudpour for sharing your experience. 
  • asked a question related to Molecular Microbiology
Question
2 answers
I am relatively new to cell culturing. I need to co - culturing MAC-T cell with bacteria. If anyone would have a protocol or any papers that might be relevant , I would greatly appreciate it .
Relevant answer