Molecular Biology - Science topic

I am analyzing the differential expression of splicing variants, through capillary electrophoresis, of a DNA repair gene after treatment with a DNA-damaging drug. I am using gene-specific primers for cDNA synthesis, which makes it challenging to identify a suitable internal control. Using another region of the same gene might also be affected by the drug, while choosing a housekeeping gene would require a separate cDNA synthesis step and introduce variability. What would be the most appropriate internal control to ensure accurate normalization in this setup?

Hi,

I'm trying to differentiate iPSCs to Immune cells and looking for plates with low-attachment. I came across this reagent "Anti-Adherence Rinsing Solution" by stemcell technologies which is a surfactant solution for pre-treating cultureware to reduce surface tension and prevent cell adhesion.

But, my question is: can I use this solution on any TC treated plates or should it be only from aggrewell brand? Has anyone used it before?

https://www.stemcell.com/products/aggrewell-rinsing-solution.html Catalog #07010.

Thanks.

Vertica

I have been using NEB Hifi Gibson assembly for a couple years now and I've been quite happy with it. I regularly make plasmid constructs with 4-8 fragments, and always >1/4 of the colonies are "perfect," while the remaining ones may have some SNPs at the joining sites, or be misassembled due to a repetitive region.

Some colleagues said that Golden Gate has even higher efficiency. That even with 8 fragments, it is normal for 50-100% of colonies to be perfect. Is that true? Is Golden Gate that perfect?

I am using rosetta for protein expression and my recombinant protein is T7 promotor base. I used more than 3 protocols and different temperatures (16,30,37) and IPTG 1.0 mM and I also used 3% ethanol but I am not getting sds page or western but I am getting positive result in dot blot,but in dot blot my control also showing reaction also. Anyone can help me?

Hello ResearchGate group,

As M.D.-Ph.D. scientist working on molecular biology, I am wondering if anyone is interested in joining efforts for creating PCR standardization statistical tools.

Best regards,

Alexios

Is this toolkit only an extension for YTK (MoClo Yeast toolkit), does it assume that I have this kit and is based on YTK level 0 fragments?

Are there any regular YTK promoters or only the newly added inducible promoters?

molecular biology and molecular genetics laboratories. It is a reagent designed for the removal of ribonucleases (RNases) and other nucleic acid contaminants, such as RNA, that can degrade nucleic acid samples, such as DNA.

In recent months, I've been running gels for a fragment around 430 bp on 1.2% agarose gel with a voltage of 120 and a 100 bp DNA ladder, and it has been working without any issues.

After a two-month break, I’ve returned to this routine, but now the runs under the same conditions are turning out as shown in the picture. Does anyone have suggestions on how to improve this? I don’t think it’s an issue with my samples, as even the DNA ladder itself is showing problems.

the lab has minimum molecular biology setup like: DNA extraction, gel electrophoresis and thermal cyclers/

Have a question on gene expression, protein synthesis, or molecular pathways? Post it here, and let’s explore molecular biology together!

I ordered a primer when I received it where one nucleotide is different in the forward primer.

the original sequence is: CTCTTTGGGCTCAGAGTGAGTCTGG

the sequence which I get: CTCTTTGGGTTCAGTGTGAGTCTTG

Three nucleotides (Bold) are different

This primer will work?

while I have tried so many times but there is no result. If it is working, how can I fix my PCR protocol?

Hi. I want to synthesize this blaTEM gene. This is the FASTA sequence, but I don't know which part is related to coding sequence, Can anyone help me?

(my major isn't related to microbiology or genetic, so I don't know the exact procedure of genetic basics,)

and one more thing, after synthesis how can I know how many copy numbers are there in my sample to generate qPCR standard curve based on that?

I have to estimate the growth of my bacterial cultures spectrophotometrically and I read articles of measurement at an OD of 600nm. Also what to do if the values exceed 1. What is the proper method for the measurement of the same.

Exciting news! Users can now like projects on PeptiCloud. Check it out: www.pepticloud.com

I found that fingerprint analysis of oligonucleotide fragments was used in molecular biology in some top-tier journals in the 1970s, but it seems difficult to find such experimental methods in current journals. Why is that? Does this experimental approach have any defects? What methods can be used to replace it now?

15 E. coli K12 promoters from EcoCyc are now accessible on PeptiCloud (www.pepticloud.com)! You can clone them into your projects to build constructs. Find them here: https://www.pepticloud.com/public-project/E.%20coli%20K12%20Promoters.

Dmt protection is a important step allowing protection of the hydroxyl group in the 5'OH in the nucleotides. This 5'OH specific protection allow a sequential coupling of the nucleotides, forming a obligonucleotide.

As we know DMT protection is follow the sn1 reaction manner. And for sn1 reaction, primary alcohol is less reactive than the secondary alcohol. Therefore, beside steric hindrance I would like to know why DMT is 5'specific. Thank you so much

Dear esteemed colleagues and professors,

I understand that this platform may not be the most appropriate place for this request, but as I was unsure of where to post this request where all respected professors and colleagues are present, I have decided to post it here.

I am a master's student in cellular and molecular biology and have been looking for a group or professor to collaborate with on writing a paper.

If you are willing and able to help, please send me an email at:

[ztaheri199@yahoo.com]

Thank you for your time and consideration.

Greetings, recently I have acquired the pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro vector (V012884). I would like to know whether the gene of interest's expression is regulated by the CMV promoter or not, given that this vector contains two sets of 5'LTRs. Specifically, I would like to know which set is integrated into the cell genome subsequent to transduction. Regards in advance,

For researchers in molecular biology and genetic engineering, I would like to know the most successful genome sequencing technique(s) currently used worldwide?Thanks in advance.

Good evening, can you help me interpret the results of the 1% agarose gel.

DNA was extracted from plant tissue using the CTAB protocol. In the wells (left to right) in well 1 and 4 is the molecular weight marker (1kb) with the amount of 1μl, well 2 has 1μl of sample + 1μl of loading buffer. well 3 μl of sample + 1μl of loading buffer.

Electrophoresis conditions: 80V x 30 min.

I am mainly interested in understanding the banding pattern of well 2.

Thank you.

In the identified case of familial desminopathy (T341P DES mutation in heterozygous state), the son has bradycardia, but the father did not have bradycardia. How can this fact be explained?

Hi all,

DNA sequences have traditionally been shared through literature, often scattered or hidden in appendices, making it difficult for the research community to access and use modular sequences.

To enhance collaboration and accessibility, PeptiCloud has introduced a new feature that allows researchers to effortlessly clone and import DNA sequences from other projects into their own. Inspired by open-source collaboration in the software industry, this feature aims to make it easy and error-free for researchers to utilize and build upon sequences created by others.

Check out the cloning feature at www.pepticloud.com!

Thank you,

Chris

I am currently optimizing a RPA-based protocol. As everyone knows, this nucleic acid amplification technique is based on isothermal amplification (around 37-42˚C) in combination with recombinases and single-stranded DNA binding (SSB) proteins.

I have designed several candidate primers to optimize my RPA. All of them were searched in literature and designed considering the criteria to be used in an RPA reaction.

These same primers were verified by conventional PCR (At different Tm: 55-65ºC), obtaining a successful result.

The problem started when I used the RPA master mix (lyo version from Twistdx) and performed the RPA reaction with the same primers and samples used in the conventional PCR. ALL THE RESULTS BECAME NEGATIVE?!

Primer concentrations used in RPA reaction was 400nm (recommended by twistdx) and the reaction time was 30 minutes at 39 °C (conditions recommended for the set of primers tested). Visualization of the amplification was done on agarose gel (1.5%) and doing a posterior melting curve assay. In all cases, no amplification was detected.

Does any one have a clue on what is happening???

I don´t know which other variables I can change to obtain good results

Suggestions?

Thank you

Help me to find experienced supervisor with excellent lab studying plant abiotic stress physiology and molecular biology

When we perform statistical analysis on qPCR data, do we use fold change or ΔCt?

I am reaching out to seek your expertise on the use of different culture media for growing gene-transformed Agrobacterium K599.

In my current work, I am utilizing both TY and YEP media to culture Agrobacterium rhizogenes K599 that has been transfered DNA plasmid pAGM4723 contain RUBY reporter gene. However, I am unsure how these media might affect the growth and gene expression in this particular bacterial strain.

1. Are there any known effects of using TY medium versus YEP medium on the expression of the introduced genes in Agrobacterium K599? How might the choice of medium influence gene stability or expression levels?

2. Are there specific experimental conditions or practical considerations that might make one medium preferable over the other for optimal culturing of gene-transformed Agrobacterium K599?

I was wondering if it is possible to form a permanent open "ssDNA bubble" similar to a transcription bubble (>13 nucleotides) within E. coli. These criteria are important:

1. Open ssDNA bubble within replicable (in E. coli) genetic element. So no C-Traps under force.

2. No proteins, nucleic acids, or other toxic chemicals supporting the bubble. Can help during nucleation, but bubble has to be accessible for protein interaction.

3. Stable in bioorthogonal conditions. Physiological pH, salt, 37 °C, etc.

Hi all,

Editing DNA sequence has been done traditionally in a word doc or google sheets, which often leads to mistakes and limits the ability to create combinations using various regulatory elements in one location (ex: trying out different promoters or signal sequences for a certain ORF).

To solve such issues, PeptiCloud has created a brand new feature called Sequence Playground. Inspired by visual programming or block-based coding, Sequence Playground treats each DNA segment as a block and allows users to mix and match various blocks to combine multiple sequences in an efficient manner. It also allows users to deconstruct a sequence into smaller segments to be used as components.

Please check out the new feature at www.pepticloud.com!

Thank you,

Chris

Hi,

I'm transducing Ly1 and L363 cell lines using our standard protocol for retroviral transduction. The cells are successfully transduced as evidenced by GFP expression. However, after 4-5 days they start dying off and look really stressed. I'm suspecting polybrene since we've got a new batch. The cells look really weird, irregular and start forming clumps which they don't normally do in standard cell culture. I've tried using the same polybrene concentration (8ug/ml) in standard culture medium without the virus to check toxicity and it appears that it is decreased. Which concentrations do you normally use? Should I make a polybrene concentration curve to find the minimal nontoxic condition?

I have used ssDNA oligo and plasmids for HDR. I am wondering whether anyone has tried using PCR product directly as HDR template. 

I am trying to extract DNA from serum. I found an article that claimed simple extraction can be done in a single tube -

Here they used a solution containing 6M NaI/13mM EDTA/0.5% sodium N-lauroylsarcosine/10 µg glycogen as a carrier/26mM Tris-HCl, pH 8.

But currently, I don't have NaI and glycogen. So, I am thinking of making a solution with KI + EDTA + sodium lauroyl sulfate + Tris-HCl, pH 8. And finally, use Na-acetate and absolute ethanol for the precipitation of DNA.

What consideration should I take into account to use alternative reagents?

And, in their protocol does it mean the final solution containing all reagent should have a pH 8 or it just means the use of Tris-HCL with pH 8?

Hello,

We found three packages of Illustra™ MicroSpin™ G-25 columns in the cabinet of an unused lab. They are very old but have never been opened. I have never used this kit before, and I couldn't fully understand what it is used for from my internet search. Is it just a simple DNA purification kit, or is it something more functional? I am interested in recombinant protein production. Can I purify my ligation product with this before cloning into bacteria, or can I purify my PCR product with this before ligation? In which scenarios is this kit indispensable?

Thank you.

Dear Scientists and Researchers,

Problem Statement: Managing multiple versions of biological sequences can be challenging, often leading to compromised data integrity and collaboration issues.

See our demo video: https://www.youtube.com/watch?v=v4HEFgxhYA4

Sign up for free at www.pepticloud.com and reach out at pepticloud@outlook.com with your thoughts, suggestions, or questions.

Thank you for your time!

Sincerely,

Chris Lee Bioinformatics Advocate & PeptiCloud Founder

Apparently the lack of tyrosinase:

"Inhibition of tyrosinase can reduce the production of melanin and achieve skin whitening, effectively solving pigmentation (Lall and Kishore, 2014). Therefore, the development of antioxidants, tyrosinase inhibitors, and elastase inhibitors play important roles in solving skin aging and pigmentation" ( https://www.google.com/url?q=https://www.sciencedirect.com/science/article/abs/pii/S0926669020309766&sa=U&ved=2ahUKEwjE4pTd0KyHAxUzHEQIHTzCCpIQFnoECAEQAw&usg=AOvVaw0gD_VQbHW1t1Go0zkPQyIW ).

Ming-Xiang Li, Jing Xie, Xue Bai, Zhi-Zhi Du,

Anti-aging potential, anti-tyrosinase and antibacterial activities of extracts and compounds isolated from Rosa chinensis cv. ‘JinBian’,

Industrial Crops and Products,

Volume 159,

2021,

113059,

ISSN 0926-6690,

https://doi.org/10.1016/j.indcrop.2020.113059.

(https://www.sciencedirect.com/science/article/pii/S0926669020309766)

Abstract: Rosa chinensis cv. ‘JinBian’, a cultivar of Rosa chinensis Jacq., is one of major raw material of rose tea and possesses sufficient plant resources in China. However, the studies on the chemical constituents and cosmetic activities of R. chinensis cv. ‘JinBian’ are almost blank. The main purpose of this study was to evaluate the anti-aging, skin-whitening, and antibacterial potentials of extracts and chemical constituents of the flower by 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging, elastase inhibition, anti-tyrosinase, and antibacterial assays. Bioassay results suggested both 95 % and 65 % ethanol extracts possessed significant antioxidant, elastase inhibition, and anti-tyrosinase activities. The combined active extract was studied with bioassay-guided fractionation to give a new compound, kaempferol 3-O-α-l-rhamnopyranosyl (1→6)-(2”,3”-O-digalloyl)-β-d-glucopyranoside (1) and fourteen known compounds (2–15). All compounds were firstly isolated from this species and subjected to the above mentioned bioassays. Ten compounds exhibited antioxidant activities with DPPH radical scavenging rate from 63.40 %–94.04 % under the concentration of 100 μg/mL. The antioxidant activities of 1, 2-phenylethyl 1-O-β-d-(6'-O-galloyl)-glucopyranoside (12), vomifoliol (14), and 4, 4'-dimethoxy-3'-hydroxy-7, 9': 7', 9-diepoxylignan-3-O-β-d-glucopyranoside (15) were firstly found with DPPH radical scavenging rate of 83.24 %, 91.10 %, 63.40 %, and 77.75 %, respectively. The moderate elastase inhibitory activities of 12, ethyl gallate (13), and 15 were firstly found with the inhibitory rate of 43.69 %, 43.25 %, and 35.34 % at the concentration of 100 μg/mL. Multiflorin B (3), 12, and 13 showed strong tyrosinase inhibitory activities with the inhibition rate at 43.83 %–55.80 %, comparing with the positive control, α-arbutin (22.15 %). In addition, 1 showed significant antibacterial activity against Staphylococcus aureus with the MIC50 of 8.51 ± 0.26 μg/mL. Compounds 2–4 and 12–14 showed moderate antibacterial activities against S. aureus. Compounds 6 and 13 also exhibited moderate inhibitory effects against Klebsiella pneumoniae. Above results manifested that R. chinensis cv. ‘JinBian’ possessed potential application values in the development of natural anti-aging, skin-whitening and antibacterial products.

Keywords: Rosa chinensis cv. ‘JinBian’; Antioxidant; Elastase inhibitory activity; Tyrosinase inhibitory activity; Antibacterial activity; Cosmetic potential

Yes. Specifically https://www.researchgate.net/publication/382049802_Correcting_Cell_Errors .

If we take a gel picture (Image attached) then in lane 1 and 2, all the bands are Polymorphic bands? or they are monomorphic? 

Cellular damage, NOT mutation, causes aging. Cellular error is difficult to define.

Hello, I am Master student under molecular biology.

I want to find the Shine-Dalgarno sequence after performing a BLAST search in TargetRNA2. Could you please suggest a web tool to predict the Shine-Dalgarno sequence?

I would also like to know if there are any papers that discuss the minimum base pair distance between flanking genes required to categorize them as trans-acting or cis-acting.

Hi all,

I have a question regarding proper dilutions and conversions of my RNA.

This might be a silly question, but I am getting confused by the conversions and wording. Thank you!

It is known that patients with desminopathy often die from pneumonia. Have pathomorphological studies of the lungs been performed in patients with desminopathy?

Hi! I'm doing a renilla luciferase assay with coelenterazine and HEK293T cells transfected with AP-1 renilla luciferase. I'm wondering if the cells need to be lysed prior to adding coelenterazine and measuring the luminescence. Coelenterazine is cell-permeable, so I'm wondering if/why the lysis step would be necessary.

I understand that the proteins would be more exposed--would the luminescence be not as great through the cell membrane if we didn't do the lysis?

Hi there,

I have transfected these two plasmids into 293T packaging cells to encapsulate a pLVX-M-Puro coding plasmid. I had already validated the stability of the pLVX-M-Puro insert by transient transfection. However, after producing the particles, infecting the cells, and selecting with puromycin, I can't observe the expression of my gene of interest by Western Blot.

Any idea what might be happening?

Best wishes,

Hi everyone,

I have the problem in endogenous nuclease contamination in my protein preparation purified from E. coli BL21(DE3). I would like to ask your experts in avoiding or removing such contamination. Can you suggest me the protocols or an alternative E. coli host strain with tagged-nucleases?

Thank you in advance.  

I will be running my first luciferase assay and the protocol I am using does not specify what filters or filter settings I should use. The plate will be read on a lumometer from Biotek, Synergy HT. What would a general filter setting be to measure the luminescence?

Who (first) proposed/used/coined the term ‘translation’ in biology/genetics? What is the history behind the use of the word? Thank you!

Hello,

In the literature, there are some MS/MS results that include hypothetical proteins, which can be shorter than 40 amino acids. I can also find these when I search for an organism in the protein section of NCBI. My question is, would it be absurd if I synthetically synthesize these peptides called hypothetical proteins and test them as drug candidates in certain disease models? Or are studies like the one I mentioned feasible and being conducted? If so, what procedure should I follow? For example, when I find a hypothetical protein, should I first perform a blast and then synthesize and use it if it meets certain conditions?

Is there any chance you could share some references with me that have been done in this manner?

I hope I have been able to convey what I want to ask.

Thank you for your answers.

Example link: https://www.ncbi.nlm.nih.gov/protein?term=txid562%5Borganism%3Aexp%5D+AND+((%2210%22%5BSLEN%5D+%3A+%2220%22%5BSLEN%5D)&cmd=DetailsSearch

I would like to do genome assembly for the bacteria isolate from the environment. Can any provide me the information or any tutorial? It would be helpful!

thanks!

My e-mail address: zbshirvani@gmail.com

Please write to me and give some info about yourself.

What are the 3’ end modifications that prevent DNA from being extended by DNA polymerase? Which one has the best blocking effect? Leakage is minimal?

Hello everyone,

I hope this message finds you doing well.

​I am writing to ask you a significant question about whole-virus ELISA and its procedure.

Honestly, it seems that coating a microplate with viruses is not as convenient as some papers mentioned, especially when high accuracy is needed. Now, my question is, is there any particular procedure in order to enhance the efficiency of the coating? For instance, what would we do if we tended to expose viral protein to the microplate better than before, based on your experience?

Thank you

Currently, phenotypic characterization is routinely used in diagnostic laboratories for antibiotic resistance measurement due to its cost-effectiveness. With the advent of molecular diagnostic technologies that offer shorter turnaround times and more comprehensive data on antibiotic resistance, is there any chance that they will replace phenotyping and become standardized in practice?

I am trying to stitch in a 38 amino acid tag to the N-terminal end of my protein (3200bp) to be cloned into a lentiviral vector (~7000bp). The forward primer for the same, along with the overhang and the restriction site, comes about 150bp long. The first round of amplication gives me a band close to about 3000-3500bp along with a lot of other non specific bands at the higher molecular weight range. I then gel elute this specific band and reamplify using it as a template with the same primers but i end up getting a smear on the gel. I have also tried using this gel eluted sample to proceed with the digestion and ligation with my vector but in vain.

My PCR parameters are as follows:

1. 98 degC- 2min

2. 98 degC- 10s

3. 65 degC- 30s (2-4: x25 cycles)

4. 72 degC- 2min

5. 72 degC- 5min

6. 4 degC- hold

I use Q5 polymerase (strangely, I do not get any amplification with Phusion). I have tried a gradient PCR and it generally works in the range of (58-68 degC). I use about 50ng of the plasmid template for amplification. I understand that really long primers hamper the quality of amplification but unfortunately, this is a necessity right now.

I would really appreciate if anyone with experience can help me out here. My molecular biology is not THAT strong so please point out if I am committing any obvious mistakes.

Thanks in advance!

Hi!

I am staining iNOS and CD163 in my cells so I am looking for a minus control, expressing neither iNOS nor CD163. But the cell familiar in our lab including panc-1 and 293T seems at least expressing 1 of them. Which cell line is known to not having observable level of these 2 proteins?

Thanks!

I know, IRES enables the coordinated co-expression of two genes with the same vector, used for the expression of two proteins separately.

But I found two kinds of IRES sequences in my plasmid database and literature. Here it is:

IRES:

TCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAA

IRES2:

CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC

Somehow, I want to know what is the difference on the expression level of these two sequences. Someone said IRES2 will decrease the expression of the second gene compared with IRES, is it true? Could IRES keep same expression level of two genes (I know people will suggest 2A peptide, but I do not want to introduce any amino acids on my protein)?

Greetings, dear colleagues!

Our team conducts research on newly discovered SIRC elements in plant genomes ( , which are thought to be MITE transposons losing inverted repeats products, which could influence genome regulation) using bioinformatics, and we plan to conduct experimental molecular biology studies to elucidate the functions of SIRC. The problem is - our team is specialized in molecular bology experiments aiming to reveal the functions of genes, not non-coding DNA elements. That's why I want to ask your expert opinion - what experimental techniques would help to reveal the functions of abundant DNA elements of repetitive nature?

What comes to mind is the creation of mutant lines without several of these elements, but such experiments are too large-scale and can last for years, which is too complicated at the moment.

Another technique that comes to mind is the amplification of certain sequences and examination using circular dichroism spectroscopy to reveal whether given elements have unusual secondary structure like G-quadruplex of triplex DNA etc that could influence processes of genome transcription or replication.

And one more - we thought it could be possible to capture and identify plant proteins that specifically recognize SIRC via some modification of EMSA (electroforetic mobility shift assay) method. Unfortunatelly, up to date we didn't find any mentions of EMSA variant that uses not single purified protein, but whole DNA-free nuclear lysate, with subsequent identification of binding proteins via MALDI-TOF.

What other in vitro experiments could be useful?

A patient with desminopathy (mutation Thr341Pro DES in a heterozygous state) with the progression of the disease has a decrease in taste and smell, immunosuppression, and an increase in IgA in the blood.

Oddly enough, but all this is characteristic of infections, including viral ones. For example, it is known that if the hepatitis C virus is not treated, then death will occur in 20 years.

In the identified case of late onset desminopathy, muscle weakness manifests itself at the age of 30, and death occurs 20 years after the onset of the disease.

I just found the Platinum SuperFi II DNA Polymerase, which should simplify PCR protocol as it allows uniform annealing temperature of 60°C, but it should also have very high fidelity; >300× higher than Taq Pol, that should be even more than Q5, reported by NEB to have 280× higher fidelity than Taq Pol.

The SuperFi II DNA Polymerase should even allow amplification up to 40 kbp, while Q5 only up to 20 kbp.

This looks like we have new Queen in the HighFidelity DNA Pol area, don't we? Does somebody have experience with this enzyme?

I am getting zero DNA yield after using qiagen purification columns. I finally traced the problem to NEBuffer 3.1, but pH doesn't seem to the cause.

Essentially, I observe:

3 ug of DNA in 50 uL of water ->

qiagen purification column ->

1.5-2.3 ug of DNA

In comparison:

3 ug of DNA, 5 uL of 10X NEBuffer 3.1, bring to 50 uL with water ->

qiagen purification column ->

zero DNA

I thought it was a pH problem -- high pH can cause low efficiency. But I don't think pH is the problem. Because pH strips and qiagen's pH indicator say my pH is okay (pH<7). And I added 20 uL of 3 M sodium acetate (pH 5) and it doesn't fix the low yield at all. I observe:

3 ug of DNA, 5 uL of 10X NEBuffer 3.1, bring to 50 uL with water ->

Add 20 uL of 3 M sodium acetate (pH5) ->

qiagen purification column ->

zero DNA

Why does adding NEBuffer 3.1 cause low yield if not pH problems?

We would like to purchase around 10 thousand DNA oligos in a 96 well format (25 nmol). The cost per base is coming to around Rs 14-15. We wonder if there is any economical option available in the market.

Thank you

Dear ResearchGate Community, I am reaching out to express my interest in collaborating on the write-up of a research paper related to Cancer Biology, Telomere Biology, and Gut Microbiome. If anyone is working on research based on this field and you are looking for a co-author or contributor to help in the writing process, I am more than willing to be a part of that. With a strong background in biochemistry and molecular biology, I believe I can bring valuable insights and a fresh perspective to the work. I am committed to maintaining the highest standards of research integrity and would be thrilled to contribute to a meaningful project in this vital area of science. If you are interested or know someone who might be, please do not hesitate to connect with me directly or drop a comment below. Thank you for considering this collaboration, and I look forward to potentially working with some of you soon! Best regards, Mashal Naeem #collaboration #researchpaper #research

I am currently doing my PhD project which consists of a lot of cloning of new plasmids I am assembling. Our laboratory generally maintains the collection on JM109 strain. But since I am doing a lot of Gibson Assemblies, I have been using electrocompetent DH10B cells for higher efficiency. My question is, can I use standard protocol of preparation of electrocompetent E. coli on JM109 instead of DH10B?

Molecular biology

An unopened Sigma-Aldrich (P4557) phenol solution bottle was shaken (prior to the addition of the Equilibration Buffer) and a gel-like layer formed at the bottom of the bottle. The upper phase is still liquid. The bottle was shaken briefly after the phenol solution was taken out of +4 C. What should be done? Should it be heated in order for it to return to liquid?

I have molecular data (0,1) and a trait with continuous variables. My goal is to detect the significance of markers associated with the trait. Which statistical analysis should I perform? Should I use a t-test, logistic regression, or something else?

Q1

We have animal behavior scores of 4 group, Normal+ctrl virus, Normal+down-regulation virus, Model+ctrl virus and Model+down-regulation virus. It has two factors(Independent Variable): Model and virus. Editors suggested we use two way ANOVA to analyze, and now we obtained main effects of Model (F(1, 56)=201.18, P<0.0001) and virus (F(1, 56)=11.17, P=0.00427), as well as Model × virus interactions (F(1, 56)=16.13, P=0.0007).

If we should continue to calculate? For example, Model+ctrl virus vs. Model+down-regulation virus. We want to confirm the role of virus in Model animals.

Q2

Next, we used chemical drug to treat the Model animals and Normal animal. It has 4 drug concentration. Should we still use two way ANOVA to analyze the behavior scores? We want to know the role of different drug concentration in Model animals. And what do we do after two way ANOVA？

Thanks very very much!!!

It is known that in the early stages of desminopathy the muscles most often affected are: Semitendinosus, Gracilis and Sartorius. What is the reason for the damage to these particular muscles?

User-friendly software tool designed for analyzing the final images generated from Gel Electrophoresis.