Gel Electrophoresis

Gel Electrophoresis

  • Paul Rutland added an answer:
    1
    Cooling module for CHEF Mapper XA just broke... Can CHEF mappers be run in 4C cold rooms?

    Normally, I have 0.5 x TBE buffer running at 14C, and the cooling module keeps the buffer at this temperature. Ours seems to be broken, since it is not making the clicking noise it usually does, and the temperature keeps rising (went from 18C to 26C in 1 hr with cooling module & pump on, program not running). I can hear a motor running in the module, and it is warm when touched. Anyways, a new one is about $4000 and may not come for a while. Could I just run the CHEF gel in a 4C cold room? 

    I don't know too much about the effect of temperature on the eletrophoresis, just that we have the chiller so that the buffer doesn't overheat and melt the gel. I want to run a 24hr program, so that seems like a real possibility without some kind of cooling. Would it make a difference in my results if I ran it at 4C (stick the entire apparatus in cold room) instead of 14C?

    Paul Rutland

    the trouble with chef is that it separates very large fragmetns of dna. Cooling platens are used  because circulating water can remove huge amounts of heat. If you had to run chef without cooling the gel would melt unless you used a very low voltage ( chef can run at up to 9v/cm and that will be a problem and with a low voltage the bands would take weeks to run through the gel unless your fragments are really quite small so I think your best chance is an all users email at your institute ( or ask your lab manager) to see if anyone else has a cooler or chef apparatus that you can borrow. You could pour a gel and run it in the cold room with no samples loaded to see what your usual voltage does to the gel or even forget the gel and just run buffer and check its increase in temperature with time

  • María José Docampo added an answer:
    8
    Why in my zimography, does the gel separation of animal serum show uneven staining after electrophoresis?

    During the zimography after the staining gel appeared different colors separating the gel, giving us trouble in the analysis.What can I do if I am following the Krisztina Kupai protocol, PharmD, PhD,2011.

    María José Docampo

    Dear Angela,

    I agree. It looks quite good!

  • Ridhwan Muzaki added an answer:
    8
    PCR mutagenesis: no transformed colonies failure?

    Hi

    I've been trying to introduce a nucleotide substitution into a minigene. My protocol includes PCR amplification (with minigene as template) using KAPA HiFI PCR kit with 4 different forward primers(to introduce nucleotide changes at different position) and 1 common primer. Amplification is followed by DpnI digestion to get rid of parental bacterial template.  So far i could not get any colonies after transformation despite having tried annealing temperatures of 58 , 54 degrees celcius. I am certain it is an annealing temperature 'problem' as I performed gel electrophoresis on the PCR product but could not get any products.

    It is noteworthy that i the forward and reverse primer that i use has an overlapping region. I am not sure myself as to the strategy here as I am just an undergrad. but i hope the below information helps..

    Minigene template

    ctgtctaatcatgagtattggaataggatctgggggcagtgagggggtggcagccacgtgtggcagagaaaagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactcacccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtggagcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccagGTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCTTGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTATGGAAAATCACAACCACAGCAAGGGTATGTGGAGAGGGGGCCTCACCTTCCTGAGGTTGTCAGAGCTTTTCATCTTTTCATGCATCTTGAAGGAAACAGCTGGAAGTCTGAGGTCTTGTGGGAGCAGGGAAGAGGGAAGGAATTTGCTTCCTGAGATCATTTGGTCCTTGGGGATGGTGGAAATAGGGACCTATTCCTTTGGTTGCAGTTAACAAGGCTGGGGATTTTTCCAGAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGgtatggtggaaacacacttctgcccctatactctagtggcagagtggaggaggttgcagggcacggaatccctggttggagtttcagaggtggctgaggctgtgtgcctctccaaattctgggaagggactttctcaatcctagagtctctaccttataattgagatgtatgagacagccacaagtcatgggtttaatttcttttctccatgcatatggctcaaagggaagtgtctatggcccttgcttt

    forward primers (online tool indicating melting temp in bracket)

    HFE exon2 muta -2C F (70.9 ºC)

    GGAAAATCACAACCACAGCAACGGTATGTGGAGAGGGGGCCTCACC

    HFE exon2 muta 4C F (71.7 ºC)

    GGAAAATCACAACCACAGCAAGGGTACGTGGAGAGGGGGCCTCACC

    HFE exon2 muta 5C F (70.7 ºC)

    GGAAAATCACAACCACAGCAAGGGTATCTGGAGAGGGGGCCTCACC

    HFE exon2 muta 4C5C F (71.7 ºC)

    GGAAAATCACAACCACAGCAAGGGTACCTGGAGAGGGGGCCTCACC

    reverse primer

    HFE new muta cmnR (65.2 ºC)

    TGCTGTGGTTGTGATTTTCCATAATAGTCCAGAAGTCAACAGTGAACATG

    anyways i am trying annealing temperature at 50 degrees celcius, and another set at 48 degrees celcius

    i will keep you guys updated but is there anything wrong or advise that you can give as at this point?

    *panicky

    Ridhwan Muzaki

    Good point

  • Faruk Abdullah Saurav added an answer:
    2
    How can you improve your 2D gel?

    I am trying to run 2D gel. I am extracting protein from mammalian cell by using RIPA lysis buffer and then precipitate the protein with acetonitrile, then re suspend the protein in 250μl of re-hydration buffer sonicate the sample for 10mins and then start IEF focusing and so on by using invitrogen protocol and this is what I get every time. Can someone suggest me any solution on how to improve the gel or the whole procedure?

    Faruk Abdullah Saurav

    Thank you for your suggestion Dirksen but I have already tried that, the image I shared was after applying that suggestion. Thank you again.

  • Chingangbam Dhananjoy Meitei added an answer:
    15
    Why am I getting smearing after PCR?
    I have isolated DNA from bacterial culture.I amplified 16s DNA with PCR. But I am getting smearing after PCR. What could be the problem regarding this? I am attaching photo of my gel.
    Chingangbam Dhananjoy Meitei

     DNA smearing usually caused in plants due to high concentration of template DNA. So please see after reduction of the template. Another important thing while you are running the gel the buffer should be totally above the agarose gel.

  • Dominique Liger added an answer:
    1
    What is the electrophoretic mobility of ATP and DTT?

    What is the electrophoretic mobility of ATP and DTT?

    Dominique Liger

    Hi there,

    It will all depend on the system (mobile phase composition and nature of the solid phase). If I consider neutral pH, these molécules exhibit different properties : ATP is negatively charged whereas DTT is neutral (pK of SH lies between 8 and 9) so in an electric field , ATP would be more mobile than DTT...

  • Vijayashree Priyadharsini added an answer:
    4
    Can we perform comet assay in conventional submarine gel electrophoresis chamber?

    Need a simple protocol to perform comet assay using submarine gel electrophoresis chamber (the one used for agarose gel electrophoresis).

    Vijayashree Priyadharsini

    Thank you all!

  • Alexa Villavicencio Queijeiro added an answer:
    4
    Are there any suggestions for running a Native Page?

    In a tube we tried the following measurements to see if it the acrylamide would polymerize before we ran the gel:

    1.15mL ddH20

    1mL acrylamide

    0.25mL NaH2PO4 buffer

    330 uL APS

    33 uL TEMED

    Our protein of interest has a pI = 7.1. Every time the gel polymerizes, it is too watery when it needs to be more firm to be stable enough for our protein. Should I increase the acrylamide added to the solution? The above protocol is already a 10X of the original amounts specified for TEMED and APS. Maybe I should decrease the water?

    Alexa Villavicencio Queijeiro

    Hi Radiance, 

    Maybe this paper could help you, it explains BN- PAGE´s principles and I think it is a great way to be ready before even casting a gel. 

    http://www.ncbi.nlm.nih.gov/pubmed/17406264

     Best regards 

  • Ángel Zaballos added an answer:
    5
    Why does DNA stuck in the gel electrophoresis wells?

    I am runing two steps RT-PCR and the target size is 2.2kb. However, my products cannot migrate when I am runing the gel. I measured the concertration of my cDNA using nanodrop and it is around 1300 ng/ul (I know it is not pure cDNA but just a mixture of random primers and dNTP). Why my PCR is not successful? Do I need to dilute my cDNA?

    Ángel Zaballos

    Use 1% or less agarose gels.

  • Zhangbin Cai added an answer:
    6
    DNA stuck in wells during gel electrophoresis
    and a little linear isoform. I run a gel on it, but I saw a bright sharp band stuck in the wells. Then I put
    Zhangbin Cai

    How did you solve this problem? I am facing the same issue. I am cloing the cDNA but the band cannot migrate

  • Sepideh Parsi added an answer:
    3
    Has anyone ever used TGX stain-free acrylamide gels from BioRad?

    Some months ago, we started using TGX Stain-Free gels (cat.# 161-0181 and 161-0185) from BioRad, and we have experienced many and different problems of polymerization. Sometimes we have to cast gels twice or even three times.

    Has anyone ever had similar problems with this kind of gels? Has anyone been able to solve them? 

    Sepideh Parsi

    maybe APS or TEMED has expired. I always prepare fresh APS 10%. I have used biorad twice and there was no problem in polymerization whatsoever. very nice gel compared to home made ones. if it wasnt APS or TEMED problem i recommend contacting the company itself.

  • Suman Kumari added an answer:
    52
    I am trying to make SDS-PAGE gel. But unfortunately the running gels are not hardening. What is the reason behind that?

    I have added the following composition-

    1600 uL 30%acrylamide
    2000 uL pH8.8 3M tris HCl,
    40 uL 10% SDS
    320 uL  DW

    33.3 uL 25%APS
    3.2uL TEMED

    Suman Kumari

    some suggestions might help you.

    • your temed volume is very low,better increase it,if  you are using old gel procedure means like adding all chemicals separately,then in this case you should add temed volume equal to your final volume.For eg,for 10 ml,then temed should be 10 microlitre.We are doing same thing in our lab.This may be one of the reason for your problem,try it.GoodLuck
  • Ali Karimi added an answer:
    4
    Is there any possibility to use Real time PCR as normal End point PCR?

    In my experiment using PCR and Gel Electrophoresis is required, since in our school only Real time PCR is available , I wounder if there would be a possibility to use Real time PCR to do my experiment.

    Ali Karimi

    Thank you all, I found it out that the Real time PCR does have both Real time and End point option and the only thing I should do is to deactivate data collection at the end point  then it works as normal End point PCR.

  • Kayla Tabb added an answer:
    5
    What is wrong with my gel electrophoresis?

    I am a first time undergrad researcher. This is, however, not my first time doing gel electrophoresis. I have been having issues. Bands appear on the actual gel, but when I go to image it, only the ladder appears. I assume it's because there was something wrong with my PCR, but I'm not sure. Any help is appreciated. Thanks!

    Kayla Tabb

    My annealing temps were off. Once I adjusted them, I could see bands under UV light.

  • Massimiliano Zampini added an answer:
    12
    Does anybody know why GelRed modifies the migration of DNA fragments in agarose gel electrophoresis?

    We have noticed that sometimes the migration in agarose gel electrophoresis  of DNA fragments is shifted to apparently higher molecular size when using GelRed to stain the DNA. This usually happens when analyzing PCR amplification products. It is not an intrinsic property of a particular DNA fragment because  in some reactions the mobilty is OK and in other samplkes is not. When the same samples are analyzed using ethidium bromide they have the same mobiltiy.

    Massimiliano Zampini

    I sometimes have seen the same behavior.

    A much longer migration appeared to sort out the problem at least in one case.

    Not sure why this happened, but it may be something affecting more bigger fragments that get resolved only when they migrate extensively.

    I have seen my band occupying different positions compared to the ladder until the expected size was reached after a certain point.

    Again it is not always happening and this is the confusing aspect.

    Max.

  • Venkata Krishna Bayineni added an answer:
    3
    How can I clean SEPHADEX gel?

    I found white particles or sample precipitates in the sephadex gel already used 4-5 times. How can I remove it. I have read to use 0.2 M NaOH or non-ionic detergent for cleaning. But I couldn't find its detail procedure i.e. for how much time I should keep gel in the detergent or how many times I should wash it? Please tell me the detail procedure.

    Thank you

    Venkata Krishna Bayineni

    Hi,

    Try autoclaving at 120 degrees for 10 min and then wash with 2 column volumes of 0.2 M NaOH (5 min) and then reequilibrate with the gel with 2-3 column volumes of buffer. Store the used gel in 2-8 degrees in 20% ethanol. 

  • Carolina Esteban added an answer:
    4
    What do I have have to do to get a good SDS PAGE of glomalin?

    I tried to make the SDS PAGE following the protocol of this article, and I have not gotten down proteins. Could you help me and give me some advice. Thank you

    Carolina Esteban

    thanks

  • Meher Prakash added an answer:
    14
    What is the alternative for Ethidium Bromide in Gel Electrophoresis?

    As ethidium bromide is carcinogenic, there are several biological and environmental problems are associated with it. Is there any alternative chemical for Ethidium bromide for the detection of DNA in Agarose gel which is non carcinogenic and safe for environment?

    Thanks.

    Meher Prakash

    Hi. This is a graphic summarizing what I mentioned about the dye earlier. Please see if it interests you. Best wishes.

  • James John added an answer:
    9
    Can I use ELISA TMB substrate for Western blot?
    I am using HRP conjugated antibody.
    James John

    Dear TulsiDas 

    can you give me reference or link where i can find how to use TMB of ELiSA for western blot by  converting soluble TMB product of ELISA into insoluble with addition of  0.05% sodium nitroprusside 

  • Ali Azam Talukder added an answer:
    3
    I wonder if any one can tell me what is the difference between the molecular weight of relaxed, coiled and highly super coiled plasmid forms?

    plasmid mini prep 

    plasmid on gel electrophoresis

    Ali Azam Talukder

    Jürgen Denecke explained well of your question (There are no different among the molecular weight of 3-different forms of plasmid DNA).

  • Ozgur Kaynar added an answer:
    4
    I am having a problem with Tricine gels. Can no protein bands be detected at all?

    I have prepared 12% Tricine gels to detect 2.2 kDa peptide band. I ran the gel but after silver staining I couldn't see any bands!!
    I think the gel itself is fine because I use a prestained marker and the bands are clear and they run fine but I can't see any bands from my samples (knowing that I use a high concentration of protein). I followed the recipe of Schagger for silver staining.

    The recipe I use for staining solutions:
    Fixation solution

    Ethanol 50 mL
    Acetic Acid 12 mL
    dH2O 38 mL
    37 % formaldehyde 50 μL
    Sensitizing solution

    Sodium thiosulfate (Na2S2O3) 10 mg/100 mL dH2O (=15mg Sodium thiosulfate pentahydrate)
    Silver nitrate solution

    Silver nitrate (AgNO3) 100 mg/100 mL dH2O
    Developing solution

    Sodium carbonate (Na2CO3) 3 g
    37 % formaldehyde 50 μL
    Sensitizing solution 2 mL
    dH2O 98 mL
    Stop solution (100 mL)

    EDTA 25 mM

    Do you have any idea, what could be the problem so I can detect any protein bands in the samples ?!
    Thank you.

    Ozgur Kaynar

    1. Use only 40% methanol for fixation. Do not use ethanol.

    2. Use distilled water for all solutions

    3. Sensitizer - min 60 min

    sodium acetate 6.8 gr,

    sodium tiosulfate, 0.3 g

    25% glutaraldehyde, 2.0 ml

    ethanol 30.0 ml

    Final volume 100 ml

    After this step wash gels with distilled water 6 times in 1 hr

    4. Silver - min 30 min

    Silver nitrate 0.1 g

       37% formaldehyde 0.05 ml

       Final volume 100 ml

    Wash gels for 1 min

    Developer

     sodium carbonate, 30 g

    37% formaldehyde 1 ml

    Final volume 1000 ml

    Heukeshoven, J. and Dernick, R., 1988. Improved silver staining procedure for fast staining in Phast System Development Unit. I. Staining of sodium dodecyl sulfate gels. electrophoresis, 9 (1), 28-32.

  • Lusisizwe Kwezi added an answer:
    11
    Why does the preliminary SDS-PAGE look funny after using 1 -10M urea to test protein stability?
    I know I'll probably sooner or later find out what's going on but I would appreciate if some of you (having more experience with this than me) could help me out.

    I wanted to test the protein stability of proteins in 1 -10M urea. After making the dispersions (I used solid material to begin with) I centrifuged my samples and used the supernatants to prepare for protein measurement (EZQ). For this I added Leammli sample buffer containing 5% beta-mercaptoethanol (1:1) to the protein samples. Then I wanted to run an SDS PAGE to see protein distribution, but I read beforehand that samples containing urea should not be heated (or at least not over 37°C), so I thawed my already prepared ready-to-go samples at RT and loaded them onto the gel, 10µL per lane. In the picture below you can see lanes 1 through 6 are one protein set with decreasing urea conc (10 to 1M) . Lanes 7 through 12 are a different set of proteins and also in a decreasing order of urea used for these samples. I wonder why exactly it seems like my first set (lanes 1-6) isn't moving very far. Is it decreased protein mobility in gel? Even the marker on the far left seemed to be affected, however the marker does not contain urea! I know that I have more soluble protein in the first set, so I guess the urea (at a different concentration) is affecting the mobility of the proteins in different ways. Is that why I see a skewed rather than linear pattern? But I read that it's okay to use urea for SDS-PAGE. Or is it interfering at certain concentrations or messing with the SDS in the sample preparations?

    I would really appreciate your thoughts on this, maybe someone has had similar experiences?

    Thanks a million!
    Lusisizwe Kwezi

    If you are boiling your samples with Urea, prior to loading,  may result in carbamylation which can cause the fuzziness. consider not boiling after having solubilised in urea. Secondly you may want to precipitate your samples with Acetone or Methanol and resuspend the pellet in LB before loading you samples

  • Amir RIYAZ Khan added an answer:
    6
    How can I check the serum and protease stabilty of a cationic peptide?

    I want to check the serum and protease stabilty of a cationic peptide can I go with native gel electrophoresis other than HPLC. Just to see fragmentation if it's not stable. If someone have done Native gel electrophoresis to check stabilty of any protein in serum.

    Amir RIYAZ Khan

    Yes So that will very tedious work....So It seems HPLC or Mass spec  is the only option left....As these guys Hansen et al suggests. Thanks Sir for ur kind response.

    http://www.ncbi.nlm.nih.gov/pubmed/18726574

  • Sachin A. More added an answer:
    40
    How can I confirm an insert in a plasmid without sequencing?
    I am trying to clone a gene from E.Coli and after the PCR I got nice band. I cut the band and purified the DNA and ligated it to a vector. After the ligation I checked it in the gel whether I got the insert.
    My question is, my bands look same after the PCR and the ligation, so how can I be sure that the gel run after the ligation has the insert if I won't do the sequencing?
    Sachin A. More

    Primary test: Colony PCR, Plasmid PCR and restriction digestion

    Final confirmation though sequencing.

  • Sawsan Sajid Al-Jubori added an answer:
    8
    Is it necessary to perform sequence reaction on PCR product?

    Hi,
    Is it necessary to sequence reaction of a PCR product after the gene of interest has already been amplified and gel electrophoresis has been completed? Someone said after isolating DNA, doing PCR on gene of interest, running a gel, sequencing reaction of a PCR product must be done. If so, would you please direct me to where I can learn how to do a sequence reaction on a PCR product (or is that just adding the ddntp, Taq polymerase)? Thank you.

    Sawsan Sajid Al-Jubori

    I think sequence is very impotent since you could find variation with your local isolates as compared with NCBI data .. as you could record your finding too

  • Buchs Natasha added an answer:
    1
    Silver Staining; Why are the spots not dark enough?

    I've been using the silver staining Invitrogen kit to stain my gel and I have normal looking results.

    However, I changed to conventional method of silver staining and it doesn't produce dark spots. 

    The kit silver stain takes around 3 minutes to fully develop to dark spots while the conventional method takes 10 minutes and the spots aren't even dark

    Anyone has any idea as to why the conventional method results is not as good as the kit?

    I have a few concern as to my formaldehyde has gone over it minimum shelf life. My silver nitrate powder still looks whitish crystal (no hint of brown). However, the silver has been more than 3 years. 

    My protocol 

    Fixative (40% Methanol, 10% Acetic acid)

    Sensitiser (0.2% Sodium Thiosulphate, 68g/L SodiumAcetate)

    Silver (2.5g/L Silver Nitrate)

    Developer (25g/L Sodium Carbonate, 0.27% Sodium Thiosulphate and 0.4% Foraldehyde)

    Stop (14.6g/L EDTA)

    + 1 more attachment

    Buchs Natasha

    Hi

    Silver stain is not a linear stain with regard to protein amounts. A dark spot by silver does not mean a high concentrati on of protein, it only means the protein stains will
    by silver. Similarly, a faint band by silver does not mean low levels of protein, it only
    suggests a protein does not stain efficiently by silver. This makes deciding if there is enough protein for MS analysis very difficult.
    If sensitivity is a concern then we recommend lava purple or SYPRO ruby. If you require the sensitivity of silver stain, you probably do not have enough protein for MS analysis.
    In general, the key limit on the use of silver stain procedures prior to in-gel digestion and mass spectrometric analysis is the type of fixing that is used.
    The commonly used reagent glutaraldehyde is an excellent fixer that is used in most of the high sensitivity procedure. Glutaraldehyde, however, acts by cross-linking the protein by modifying lysine residues and make a protein intractable for
    proteolytic digestion. Therefore, no matter what the details of the silvering and development steps, the gel must be fixed by a non-modifying, precipitation
    procedure such as the ethanol (or methanol)-acetic acid method described here. In many instances, this change will reduce the overall sensitivity of the protein detection.

    Hope it helps , for more information and Protocol see this

    http://www.ccic.ohio-state.edu/sites/default/files/PAGE_Stain_Protocol_08.pdf

  • Marcus B Lee added an answer:
    3
    Will SDS disrupt DNA- PAGE?

    Will SDS disrupt the DNA oligonucleotide PAGE? (15Bp)

    I have previously ran a triplex DNA, duplex DNA, single strand DNA on SDS PAGE and did not get any results. I am wondering if SDS is the source of problem. 

    Marcus B Lee

    Thank you very much. I have tried again without SDS, and I was able to get a band in dsDNA only. I think the problem is now with EtBr's ability to intercalate with short single strand oligo. 

  • Rodrigo Moreno-Campos added an answer:
    12
    Can someone advise on the following EMSA problem: Multiple bands in free oligo lane?
    I've run my EMSAs alongside EBNA controls (which are included in the LightShift EMSA kit) and the control lanes migrate fine, therefore I don't think it's an issue with the gel, resolution, transfer or detection. It seems like it has to be an issue with how I prepared the oligo.

    Here's how I did that: Following amplification, I purified the oligo from an agarose gel using a GeneClean II kit and I labeled it using Pierce's Biotin 3' End DNA Labeling Kit. I should also note I did not end label the complementary strands separately (as Pierce recommended).

    Any ideas?
    Rodrigo Moreno-Campos

     i am also having a second shifted band on my free probe. 

  • Jody D Berry added an answer:
    3
    What is the minimum amount of papain (23500 Da) that I can see in the SDS PAGE gel?

    I am performing reaction between iodoacetyl-PEG-biotin (linker) and papain. Thiol group of papain reacts with the linker to form a thioester bond. then I use streptavidin beads to fish out papain bound to linker. So in order to use minimum amount of streptavidin beads I need to know minimum amount of papain I could see in a SDS PAGE gel. Can anybody please help?
    (1 mg of streptavidin beads can bind 400 pmol of biotinylated peptide.)

    Jody D Berry

    depends how you develop the gel and what you want to do with the protein afterwards ...silver stain is very sensitive if done well for visualizing

    silver stain donw to less than a ng but cant use the proteins for anything else like MS afterwards

    Coomassie down to maybe 100 ng but can do other things.

About Gel Electrophoresis

Gel electrophoresis is a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and charge.

Topic followers (18,532) See all