Enzymes - Science topic

I am currently working with one enzyme expressed in E. coli. We want to scale up the process to an industrial production (no Academia involved).

The regulation of E. coli BL21 cells is not clear to me. Can be used for commercial/industrial use if used for enzyme production?

If not, what other bacteria can be used instead?

If we use a pET vector system, can this be used for industrial production as well?

are there any milk and cheese companies that use the tyrosinase enzyme?

We are working on monoclonal antibodies using a G1 synapt HR mass. we can take a good charge state envelope for proteins with molecular weight of less than 40 KD such as Gh hormone or CAD enzyme. However for monoclonal antibodies with molecular weight  of more than  100 KD such as Ritoximab, charge state envelope has low sensitivity and resolution so that the Maxent software can not calculate  molecular weight of MABs. Our instrument is 8K.

any comment is greatly appreciated.

I want to use the active site structure of carbonic anhydrase enzyme in my paper. Is it better to draw its structure myself with software such as Discovery Studio or Paymol or...? Or is it better to take this structure from other articles and use it in my article and give them a reference?

thank you

Greetings everyone.

During my master's research, I focused on exploring the potential of a specific bacterial strain to produce antibacterial compounds. To achieve this, I used the technique of liquid-liquid fractionation (Extraction) using butanol for the bacterial culture broth. Then, I subjected the supernatant to freeze-drying and further dissolved a portion of the butanol crude extract in methanol for analysis using GC-MS. The results revealed the presence of two secondary metabolite compounds, notably beta-carboline and cyclo-l-proline-l-leucine.

I investigated the genes and enzymes of the bacteria, and it appears that the genes and enzymes that synthesize beta-carboline and related compounds were not present in the bacteria. I have the genomic sequence date of the bacteria. I have searched the genome database to identify any genes or enzymes associated with the production of beta-carboline. Unfortunately, no such gene or enzyme seems to be directly related to the synthesis of beta-carboline in this bacterium. Also, my investigations regarding the McbB enzyme (which is an enzyme that works for the production of beta-carboline) have unfortunately provided no evidence of its presence in my bacterial strain.

So my question Is there an alternative methodology or approach by which I could clarify the mechanisms used by this bacterial strain to produce these compounds? For instance, the synthesis of beta-carboline usually involves the enzymatic action of tryptophan decarboxylase, which catalyzes the conversion of tryptophan to tryptamine. However, my bacterial strain seemingly lacks this specific enzyme. I am hoping that if any practical strategies or methodologies exist, I will try them as a first step to finding some answers for the synthetic pathway.

I sincerely appreciate any insights or directions you can provide.

I had extracted dna from E. Colli which shown very low digestion even with Hf digestive enzyme It is suspected that becouse of 1-3 minute kept plasmid with Pd3 during plasmid Isolation caused supercoilling of Plasmid which hindering restriction digestion

I cut a vector that already contain the promoter using BstBI enzyme. The electrophoresis gel result showed that no different between control and vector+plasmid cut BstBI enzyme. There are more than 1 band found in the gel. Does anyone have any idea why it is this way?

Hello. This year we started using ITC in a bit unconventional way to study enzyme kinetics of beta-lactamase (there is already literature data that showed it works). The principle is fairly similiar to binding experiments, the difference is that after every injection of substrate to enzyme the baseline does not return to zero, but there is a slight displacement. This differences can than be converted to reaction rates if you know the ∆H of the reaction. The biggest problem we are facing is huge inconsistency in data, especially with controls, where we titrate just substrate to buffer (see the pictures). Also, at the beginning of each titration (both enzyme and controls) we get this endothermic dips, which is weird, because dilution heat should produce exotermic peaks, which are clearly showing up after couple of injections. Anyone has clue what might be going on or have some practical advice? Some useful experimental information: we use Affinity ITC, 190 ul sample cell, 30x2 ul injections with 100s spacing.

I'm searching how to find enzyme DNA sequence.

I know what strain produce product, and I also know the biosynthesis pathway.

But I can't find how to solve this problem.

Now I'm studying some program, but it doesn't help.

What is the problem?, my ability? or my low knowledge?

Hi all,

I'm attempting to clone a GC rich insert (500bp) into a vector that is approximately 5kb and also GC rich. After sequential digests (one enzyme works at 37 while the other works at 65 degrees Celsius), a 0.5% agarose gel reveals that the vector was efficiently cut as indicated by a 500bp shift down of the parent insert vector. Oddly, the 500 bp insert is barely visible. When blown out, the gel shows a smear near the 500 bp region. Is there a reason this is occurring? We are struggling to get any colonies to appear for diagnostic digests so any help would be appreciated.

Thank you!

I used HEK293 cells as expression system, transiently transfected using PEI. Harvested on Day 4 or sometimes Day 5. The enzyme produced always show up as strong band in cell pellet in western blot , while there is no band in supernatant. While doing enzyme assay, this shows no activity.

I changed my expression system and used Expi293 cell line, which produces an active enzyme.

My questions:

1. Is this related to cell lines, but in past we have seen HEK293 cell line producing any other enzymes?

2. Does vector design plays any role in this?

Iram

Hi everyone,

sorry if this is a simple question, or if I get anything wrong here, but I'm very outside of my comfort area when it comes to enzyme activity-related calculations.

So, I need to know the concentration of enzymes that a paper used for their stock solution of Catalase.

Here is a quote from the methods: "Enzyme activities of stock solutions were 3 mM/s for GOX and 998 s-1 for CAT. To obtain a defined, stable oxygen concentration of 2% on cell surface stock solutions were diluted by 1:10,000 for GOX and 1:1,000 for CAT."

For the GOX, I think I can manage to calculate the stock, but the catalase is the issue

So, the Kcat = 998 s-1

The Vmax = 1uM/ min = 0.0166uM/ s

For for the calculation: Kcat = Vmax / E[t] , is it as simple as rearranging it to E[t] = Vmax / Kcat?

That Vmax figure is from the data sheet of the catalase, with 1 unit being equal to 1uM H2O2 processed per minute (not 100% sure this is what is meant by Vmax), hence me dividing by 60 to get the uM per second.

I also know that 1mg of Catalase = 20,000U

The issue is that I don't know how to put this all together. I am currently trying to get more familiar with enzyme kinetics, but this is taking some time. I would very much appreciate if anyone could offer some advice to help speed things up so I can start with my experiments.

If I am missing some information here please let me know.

Best regards,

Ciarán

Good morning, I am trying to degrade an RNA naturally resistant to degradation by RNases, I wanted to use MNase but it only degraded very little. My sample is in liquid medium, in 95uL of RPMI and I added 5uL of Reaction Buffer for a final concentration of 50mM Tris•HCl pH 8, 5mM CaCl2 and heated at 37 degrees for 30 min in the water bath, then I also tried it for an hour and no good results either. I have used 0.5uL (50 Units) and 1uL of enzyme.

I don't know if I'm doing it right, could you please help me, I don't know anyone who works with this enzyme, I've also tried RNAse A/T1 and the RNA doesn't degrade either. Thank you so much.

In order to perform Michaelis-Menten plot to calculate Km for oxa beta lactamase , I used nitrocefin as substrate , 100mM sodium phosphate di basic and 25mM sodium carbonate as buffer pH 7.3

Enzyme concentration 20nM

Substrate concentrations

1 uM

5 uM

10 uM

20 uM

30 uM

40 uM

50 uM

70 uM

80 uM

100 uM

Wavelength 490 nm

In order to calculate Vo ,

I plotted the absorbance values of each concentration vs time. The problem is , the slope for all the concentrations are same which means that Vo of all substrate concentrations are same.

Where is my mistake?

concentrations of the enzyme?

Concentration of the substrate?

Activity of SOD has been determined in two ways:

1. Inhibition by the enzyme of an O2- dependent reaction.

2. Pulse radiolytic methods (Rigo et al. 1975) See: Beauchamp and Fridovich (1971); Misra and Fridovich (1972); Tyler (1975).

The method employed at Worthington is essentially that of Winterbourn et al. (1975) and is based on the ability of superoxide dismutase to inhibit the reduction of nitro-blue tetrazolium by superoxide. One unit is defined as that amount of enzyme causing half the maximum inhibition of NBT reduction. The reaction velocity will depend largely on somewhat variable assay conditions such as light intensity and reaction temperature. Calibration of the method in individual laboratories is recommended.

Hi All and thanks in advance.

For long shelf life cleaning solutions, what concentration of protease and what stabilising agent should be added to hypochlorite solution content to preserve the activity of enzyme

I have received the sequence of plasmid, I aligned it with the gene sequence on APE plasmid editor and it is matched. But when I performed vector screening on ncbi, the sequence is strongly matched to vector. Can I make probe with this plasmid by cutting with relevant enzyme??

We use Hind 111 is used almost every time but why? How many enzymes do we have to choose per experiment?

Hello! I'm currently using the IntEnzyDB (https://intenzydb.accre.vanderbilt.edu/kinetics/list) for a machine learning project. During this process, I noticed that for some observations in the Kinetics Data table, the substrate_kinetics column contains multiple substrates in the form of a merged string separated by ";", which is presumably associated with multi-substrate enzymatic reactions. However, the Km entry of the wildtype enzyme sequence (column Km Wildtype) only shows one value, and the same goes for kcat. I've checked some of these reactions in UniprotKB, and there are separate Km values for different substrates. I've looked into the published paper, but I can't seem to find any relevant information. As I understand that the kinetics of multi-substrate systems could be complicated, I'd like to ask whether someone could kindly provide me with some guidance on how to interpret those entries in the database. I really appreciate your time and support!

I want to do rolling circle amplification with phi 29 polymerase enzyme . Previous article show they use 10x reaction buffer. Can I use 10X reaction buffer from thermofisher for the PCR.

I would like to performe the GRIESS reagent kit from biotium. The nitrate reductase enzyme (Sigma catalog no. N7265) has an activity ≥300 U/g. By protocol I am to use it at a final concentration of 300 U/L. The enzyme is in lyophilized powder form. How many microliters of grade water should I add? And how many microliters should I take of my solution to have final concentration of 300 U/L?

Please provide your suggestions.

I'm designing a new activity for an undergraduate biology course about enzyme activity. I'm running into a slight complication. I've ordered a lyophilized powdered version of human salivary alpha amylase.

The issue is "how long can it be stored once dissolved?".

Most protocols say to use "freshly made" enzyme. But the amount needed for a lab section is too small to weigh out. Seriously, the bottle has 1000 Units and is only 10 milligrams. Diluting to 1 Unit/mL for a working concentration makes 1 Liter of enzyme solution. That is more than enough for an entire week of lab sections!

But, will it denature/lose too much activity in the refrigerator?

Looking for some practical advice!

Hello all,

I am over-expressing acid sphingomyelinase enzyme in HeLa cells. Theenzyme shows expression on western blot but I do not have any activity in in vitro assays. I have checked the activity through Mass Spec as well as radioactivity. Please suggest where could I be going wrong? Thanks!

I want to see polymorphism of Tumour necrosis factor alpha (308 G>A, rs1800629) polymorphism. The sequence of that region is given below:

AGTTCTATCTTTTTCCTGCATCCTGTCTGGAAGTTAGAAGGAAACAGACC ACAGACCTGGTCCCCAAAAGAAATGGAGGCAATAGGTTTTGAGGGGCATG [G/A] GGACGGGGTTCAGCCTCCAGGGTCCTACACACAAATCAGTCAGTGGCCCA GAAGACCCCCCTCGGAATCGGAGCAGGGAGGATGGGGAGTGTGAGGGGTA

So, I need a restriction enzyme which will cut on the bracket region in presence of either adenine or guanine. Most of the articles, I have Found that NcoI enzymes have been used for this purpose.

NcoI enzyme cleaves when this sequence present:

5'  C ↓C  A  T  G  G   3' 3'  G  G  T  A  C ↑C   5'But this sequence is not present in the above sequence . Rather the sequence is "GCATGG"  As a result when I am using tools to find out restriction enzymes, NcoI enzyme shows" 0" cut. I did not not find any other restriction enzymes also which will cut on that site. So, my questions are: What may be the possible solution? Where I am doing mistakes on searching?

Hello, so i am scaling up a 10 L biorector to 1000 L bioreactor for enzyme production using corncob-based media. The product increased, but there's a lot of excess media left in the product. So, i want to minimize the media impurities before purifying the product. What should i assess regarding this matter? Thank you

One Thing, Your Physics Book Many Equations Depend On Uniform Velocity And Acceleration Equation But Nothing Is Uniform All Time And Change Should Be And Must Be Come Every Where In Universe About Velocity And AccelerationAt Physics Books Those All Uniform Velocity And Acceleration Can Be More Or Less Correct For All Uniform Velocity And Acceleration World But Not For Practical Life Equation Cause Nothing Is All Time Uniform In This Life And In Heaven Also.When Moment Change And Time Change And When There Are Day,Night,Morning,Noon,Afternoon,Evening,Night That Moment Change Sky,Cloud,River,Pond,Mountain,Rain,Storm,Breeze,Drizling,Cats And Dogs And Others Then Also Velocity And Acceleration Of Life And Planet Change And When Mass Increase.Without There Would Not And Will Not Life Beauty.Life Would Be And Will All Time Alike And All Time Uniform And No Taste And Color Of Life.Kids Would Be Forever Kids,Parents Would Be Forever Parents. Universe.Its Research And Scientists Say Planets Movement And Rolling Never Follow Isac Newton Equation And Isac Newton Rule

Newton”s First Law:No Outside Force Motionless Elements Forever Motionless But Motion Elements All Time Motion.

Ans:Wrong Because No Outside Force Elements Has Inside Force.And Others Wise Actually Elements Are Not Only Electron,Proton,Neutron And Every Elements Has Different Characteristic And That’s Why Chemical Characteristics Different And That’s Why Their Strength And Characteristics Different And That’s Why Elements Not Only Electron,Proton,Neutron And There Are Many Atom Just Like Electron,Proton,Neutron That’s Why Characteristics Different And That’s Why Different Different Elements.There Are Many Atom(More Than 150 Atom Inside Every Chemistry Elements And Its Atom Number Is Vary Elements To Elements-If We Are See Chemistry Nucleaus And Chemistry(Organic Or Inorganic) Elements Or Reaction Under Plasma Microscope Or Satellite Frequency Microscope Or Very Strong Microscope Than We Will Be See Totally Different World Of Chemistry Which Is More Or Less Totally Different From Our Chemistry Book And Also Never Ever Only Chain Reaction Happens In Organic Chemistry.And Chemistry Nucleas Is That Which Secret Frequency And Secret Vein Just Like Leaf To Compact Others All Atom And Under Plasma Microscope Or Satellite Frequency Microscope We Will Be Able To See Accurately Nucleus Which Secret Frequency And Also Vein Just Like Leaf To Compact All Atoms.Nuclues Is Never Proton And Neutron…..If Nucleaus Is Only Proton And Neutron Than When Environment Partial Reaction Will Be Happen And Temperature,Air,Light,Color And Environment Different And Fraction Will Be Come Than When Proton Will Be Go Away And All Over Atom Distribution Will Be Broken And All Will Be Broken.So,There Are Many Atom Inside Elements. . Chemistry Basic Atom Not Only Electron,Protron Or Neutron And There Are Others Basic Atom Within Elements And That’s Why Characteristic Different And Vary Places To Places.Changeno Atom,Airono,Waterono,Cloudono,Massono,Environmentallono,Specifino,Tastetono,Reactono And Others Many Atom(Just Like+_*%#!) Within Elements And It Is Vary Environment To Environment And Places To Places Or Planet To Planet.Atom Distribution Equation-----q*v*theta(sin,cos,tan or others)/Time Or Changing Time----Here---q=Atom Charge---Velocity----Theta---Atom Position With TimeIf We Are See Chemistry Nucleaus And Chemistry(Organic Or Inorganic) Elements Or Reaction Under Plasma Microscope Or Satellite Frequency Microscope Than We Will Be See Totally Different World Of Chemistry Which Is More Or Less Totally Different From Our Chemistry Book.And Chemistry Nucleus Is That Which Secret Frequency And Secret Vein Just Like Leaf To Compact Others All Atom And Under Plasma Microscope Or Satellite Frequency Microscope We Will Be Able To See Accurately Nucleus Which Secret Frequency And Also Vein Just Like Leaf To Compact All Atoms

Now Without Outside Force Motionless Elements Never Forever Motionless Or Motion Elements Never Forever Motion Because They Have Specific Characteristics And Inside Temperature, Pressure And Atom Elements Just Like Electron,Proton,Neutron And They Will Do Reaction And Others Velocity And They Have Half Yearly Age Because Every Elements Should Be Do Reaction And Die Or Convert Or Change Because Planet Mass Increase Everytime And When Only If Single Something Change Than Change Everything.So,Aisac Newton Equation Should Be Wrong.Aisac Newton Equation Can Be True That Time When There Would Be No Constellation Or Universe Because Change Should Be Come Today Or Tomorrow And Every Time Because Nothing Is Uniform Velocity And Acceleration Here And In Heaven Life Forever.

Solve Equation:No Outside Force Motion Elements Can Be Motion But Once Inside Electron,Proton,Neutron And For Others Basic Atom Like Airono,Pressurono,Timeno,Frequencyiano,Reactionon,Relationono,Rationono,Waterono,Environmentolono And For Others Basic Atom Motion Elements Can Be Do Reaction And Once Motionless And It Can Be Slight Motion Increases But Once Motionless Cause There Are Many Many Basic Atom In Environmental Elements And Their Ratio And Velocity Different And That’s Why Characteristics Different And Sometimes Vary Place To Place Or Place And Distance Change And They Have Half Yearly Age And Environment Has Recycling Process And Partial Reaction And Its Gonna Convert Others Like Dhancha Plant When Die Then Convert As Green Fertilizer.And Same Words For Motionless Elements.And Motion Elements Never Wanna Forever Motion And Motionless Elements Never Wanna Forever Motionless Cause It Has Utter Energy And Basic Atom Reaction And Velocity And Ratio And Environmental Partial Reaction And Recycling Process For Life.

Now,Suppose Anything Is Motion And No Outside Force:Motion Elements=Total Unit( Time And Others)*Summation Of Velocity*Inside Utter Energy Change*(Like Basic Atom Ratio And Velocity Change And Environmental Partial Reaction And Recycling Process Change)=Last Step Can Be Motionless Or Sometimes Slight Motion Increases And Once Inert Elements And Scattered………… And Here Elements Came From Environment.And Motion Less Elements Will Be Slight Motion And Once Scattered And Equation Motionless Elements=Total Unit( Time And Others)*Summation Of Slight Increases Velocity*Inside Utter Energy Change*(Like Basic Atom Ratio And Velocity Change And Environmental Recycling Process Change))=Last Step Can Be Motionless Or Sometimes Slight Motion Increases And Once Inert Elements And Scattered.

Newton 2ndLaw:Force Proportional Momentum Change(Wrong)

Ans:When We Give Force On Elements It Can Be But Elements Has Also Own Force And Momentum.Example:Suppose Two Things Running:

M1=2, M2=50

V1=3,V2=80

K1=3,K2=80

So,It Should Be After Collusion Small Things Velocity Must Be Highly Increase And Big Things Velocity Also Increase And It Depends On Two Elements And Environment.

Solve:Force And Momentum Change Depends On Elements.Suppose One Ball When You Will Be Kick Then It Will Get Easily More Velocity But When You Will Convert Same Ball To Any Sheet And Give Same Force Then Its Momentum Change And Both Momentum Change Should Not Be Same.And Force And Momentum Change Depends On Elements And Size And Environment Also.Suppose You Are Wanna To Fall One Thing From Mountain Then Just Touch And It Will Be Get Huge Force And Velocity But Your Force Was Very Slight And If You Will Give Same Same Force On Normal Environment Then It Will Not Get Same Velocity And Force.So,Its Depend On Environment And Environmental Recycling Process.

Equation:F1=M1*Dx1/t1 And F2=Dx2/t2 Now After Accident F1*F2=M1*Dx1/t1*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)*M2*Dx2/t2

Now F1**(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)=/<_(Not Equal)>_(Not Equal)F2*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)

Newton 3rdLaw:Every Force Has Equal And Opposite Force(Wrong And It Can Be True For Slight Time But Not All Time) Ans:When We Give Force On Elements It Can Be But Elements Has Also Own Force And Momentum.Example:Suppose You Are On Mountain And Just Touch A Big Stone By Finger Which Will Be Go To Touch Soil And Get Huge Force When Newton Under Apple Tree And Break Newton Head.So,What Will Be Opposite Force Of Newton Broken Head.Or You Are Pushing A Pin At Wall By Hammer…Pin Is Going To Wall But Hammer Does Not Get Same Opposite Force.Suppose Two Things Running:

M1=2, M2=50

V1=3,V2=80

K1=3,K2=80

So,It Should Be After Collusion Small Things Velocity Must Be Highly Increase And Big Things Velocity Also Increase And It Depends On Two Elements And Environment.So,Elements Force Should Not Be Equal And Opposite. You Are Giving A Kick To A Truck And Truck Has No Reaction Force But Your Leg Is Broken.Truck Not Give Same And Equal Force.Newton Gave Bullet And Gun Equilibrium Force Equation But Now Many Bullet Donot Give Opposite Force After Release.And Same Equation For Boat Also.And I Am Giving Something Fall From Moutain Or Foorball Or Truck Velocity And Acceleration Equation.

So,It Should Be After Collusion Small Things Velocity Must Be Highly Increase And Big Things Velocity Also Increase And It Depends On Two Elements And Environment.So,Elements Force Should Not Be Equal And Opposite.

Equation:F1=M1*Dx1/t1 And F2=Dx2/t2 Now After Accident F1*F2=M1*Dx1/t1*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)*M2*Dx2/t2

Now F1**(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)=/<_(Not Equal)>_(Not Equal)F2*(Momentum Change That Distance And Time That Velocity With Time Change Unit With Environmental Change)

Newton Gave Bullet And Gun Equilibrium Force Equation But Now Many Bullet Donot Give Opposite Force After Release.And Same Equation For Boat Also.And I Am Giving Something Fall From Moutain Or Foorball Or Truck Velocity And Acceleration Equation.

And For That Motion Of Rocket Equation Was Wrong Because It Was Depend On Newton”s 3rdLaw: When You Will Be Go From Soil To High Sky Than Gravitational Attraction Increase That Velocity Decrease But Once Near Unventilated Places Gravitational Attraction Decrease And Rocket Velocity Increase And Plane And Rocket Different Things But Alike.And Free Velocity Should Not Be All Time 9.8 ms-2.And It Should Be Different Elements To Elements Either Up And Down.So,When You Are To Go Up Than Every Second Before Reached Unventilated Place Velocity Should Be Decrease For Gravitational Attraction.

Motion Of Rocket:

Rocket Mass:M

Gas Mass: Δm (Delta Mass) In Every Seconds

One Second Gass Mass = Δm

Δt (Delta Time) Gass Mass= Δm (Delta Mass)/ Δt (Delta Time)

Now Force F=Ma

HERE, M=Rocket Mass

a=v/t,

Δm (Delta Mass)/ Δt (Delta Time)*t

.

Force=M(Rocket Mass)* Δm (Delta Mass)*Increase Gravitational Attraction That Deacrease Rocket Velocity With Environmental Temperature And Pressure And Others And Increase Velocity By Force With Environmental Temperature And Pressure/ Δt (Delta Time)

So,HereGass Mass Should Be Higher Than Or Bigger Than Rocket Mass And Everything Seconds It Will Change For According To Environment.So,Newton 3rd Law Should Not Be Work Here Beccause It You Are Use Newton 3rd Law Than Rocket Shuttle Should Be Broken For Environmental Pressue And Temperature And Rocket Should Be Fall From Sky.

Now Neednot And Shouldnot Use Rocket.Now You Can Use My Triangle Vehicle Which Will Be Go Electric Recycling.IDonotKnow,You Will Be Albe Or Not My Triangle Vehicle Cause It Has Very Sharp Design.You Can Try But May Be You Cannot Make My Triangle Vehicle Which Will Fly In The Sky,Run On Road,Swim On Water And Dive Under Water.And.You Can Try But It Has Very Sharp Design

Now………1.Anything Is Running That Motion And Last Point Reached Equation:

Let,Suppose One Thing Is Running On V Velocity

After One Second(1s) It Will Be Go=V*1

Now T Second It Will Be Go=V*T But Now What Will Be Its Velocity Change And Equation:

In One Second=V*1 That Dx1/t1 Now 2 Second It Will Be Dx2/t2 And 3 Second It Will Be Dx3/3 And 4 Second It Will Be Dx4/4.Now Dx Can Be Change From 1 Second Or 2 Second Or 3 Second Or 4 Second.Now What Will Be Motion Elements Reached Point Equation After Time:

It Will Be Dx1/t1+Dx2/2+Dx3/3+Dx4/4 That 4Seconds*Summation Mean Of Velocity Change Or Velocity Summation (Dx1/t1+Dx2/2+Dx3/3+Dx4/4) That 4*Summation Mean Of Velocity Change And Others All Plus In 4 Seconds.

That((Dx1/t1+Dx2/2+Dx3/3+Dx4/4).

So,Specific Point Reached Equation After Time And Velocity Change Will Be

Specific Point Reached=4*Summation Of Mean Of Velocity And Time Change That Distance And Time Change And Others All Plus In 4 Seconds.

Specific Point Reached=Total Unit(Time And Others)*Summation Of Velocity

And Specific Point Reached Mean Velocity=Total Unit(Time And Others)*Summation Of Acceleration(Acceleration Mean Change Of Velocity That Distance And Time Change)

So,All Time Changing Velocity(Not Uniform) And Acceleration Equation Is:

V1+V2+V3+V4+V5 And a1+a2+a3+a4+a5

SPR=Total Unit Or Total Time*Mean Summation Of Velocity Or Acceleration.

Now Last Velocity When Velocity Change All Time More Or Less.So Last Velocity And First Velocity(Not All Time Uniform):

SPR=V1+3*Mean Summation Of Three Velocity+V5

Now,S-3*Mean Summation Of Three Velocity=V1+V5

S-F(F3MSTV)=V1+V5

Now v5=E-V1…….Here (S-F=E)

Motion Of Falling Elements:

1stVelocity=0 But When Fall From Upper Sky Velocity Low But When Fall From Near Soil Velocity High For Attraction Cause(Lower Portion Gravitational Attraction Is High).

Suppose Falling Fruit From Ifel Tower Head And Every Meter Per Second ms-1 Velocity Increases Not All Time Alike 9.8 Ms-2. Cause Its Also Depends On Environment And Elements.Its Also Not Possible For All Uniform Equation Cause Elements To Elements 9.8 Vary.

Here Suppose Vo=0 Now Vo+V1*1+V2*2+V3*3(Here Velocity Increases With Fall Attraction)

Now Last Velocity Will Be=Vo+Increases Attraction*Summation Of Mean Velocity

Suppose Increasing Attraction Velocity=g

So,Last Velocity Will Be=Increases Falling Attraction*Summation Mean Of Velocity*Total Time+Vo

So,Last Velocity Will Be=Mean Increases Falling Attraction Velocity*Summation Of Mean Velocity*Total Time+Vo (Some Error Can Be Come But Error Should Be Identify)

And So,After Soil Touch Velocity Equation Will Be=(V-Last Velocity Increases Attraction After Touch)=Increases Mean Falling Attraction Velocity*Summation Of Mean Velocity*Total Time+Vo

(If Need You Can V-LVIAAT Or V+LVIAAT)After Touch AsNecessity.Here Vo=0 Others Can Be

Now Last Velocity And Distance Equation Will Be That After Soil Touch Falling Elements Equation Will Be=Vo+Summation Of Mean Velocity*Mean Increases Falling Attraction Velocity*Total Time+Velocity-Last Velocity Increases Attraction*1unit

From Soil Low To High:VelocityDesreases With Gravitational Attraction But Once Near Two Point Of Planets That Near Unventilated Places Velocity Increases

That SPR=Vo+Summation Of Mean Velocity*Total Time Unit*Decreases Attraction Velocity+(V+Last Velocity Decreases)*I Unit.

Laws Of Static Friction:

1.Motionless Varnish React Inverse Of Elements Motion

Ans:It Can Be True But Not All Time.Suppose One Boat On River.And Boat Is Motionless But River Water Wave Velocity Increases For Air Environment.And Environment Has Changing And Recycling Process.So,Boat And Water Varnish Both Velocity Also Increases.So,Equation Is Going To Be Wrong.Now It Can Be Sometimes True Or Many Times Also Like Cycling On Road Or It Can Also True Motion Increases But Mass Huge And That’s Why Gonna To Be Slow Or Stop.

Equation:Motionles*Varnish Force*Last Velocity Will Be=(V-Last Velocity Increases Or Decreases Attraction)*Increases Or Decreasing Attraction*Summation Mean Of Velocity*Total Time+Vo

=(V-Last Velocity Increases Or Decreases Attraction)*Increases Or Decreases Mean Attraction Velocity*Summation Of Mean Velocity*Total Time+Vo …..Here Vo Can Be=0 Or Others

Equation2:Motionles*Varnish Force Proportional To Stop Or Obstruct Force

Ans:How It Can Be True Cause Water And Boat And Mountain Or Truck Or Cycle Or Football Example.Cause Sometimes Can Be Increases Or Decreases

Equation Just Like 1st And S1=U1VI And S2=U2V2 And So,Here Not Proportional.

Equation3:Angel Of Repose Proportional To Last Border Varnish

Answer:Suppose One Boat On Rivet Or One Oil Machine Machine By Cow.If You Will Be Give Slight Force On Boat Border Than Its Move More Cause Lower Touching Portion Varnish Is Soft And It It On Soil Or Muddy Then It Would Be Give More Force To Move.Suppose Football Player Corner Kick,ItsGonna Here And There And Many Times Not On Specific Cause Environmental Cause Air,Temperatire,Pressure And Own Utter Energy Cause.So,Its Depend On Environment And Utter Energy Of Both Elements.

Equation Like Before And You Can Use My New Mathmatics Equation But It Can Be Increases And Decreases As Necessity And Length And Angel Can Increases And Decreases And But It Will Be Very Helpful For Cow,Goat,Horse That Animal Organ Convert For People Like Bones,Eyes If You Are Modify And Change Them 2 Or 3 Places Or More As Organ Then You That People Can Use Those Normaly But Need Plant And Plant Enzyme And Others Enzyme And Color Convert Also.

Equation4:Varnish Mean Never Depends On Touching Places And Volume

Answer:Its Ultimately Wrong If You Read My Previous Upper And Others Equation.

Equation5:Varnish Mean Never Depends On Area

Answer:UltimatelyWrong.Cause One Big Thing And One Small Thing Varnish Should Not Be Same And Also Depends On Both Area And Environment Also Like Water,Desert,Normal,Pitch Road Or Normal Village Road And Environment Also.

I Am Giving You Roult Law Example:

When 2 kg Ice+2kg Water Convert To Water Then Its Is 4Kg But According To My Law When 2kg Ice+2Kg Water Convert To Water Then It Can 4.10 Or 3.90 Or 4.20 Kg Cause Environmental Elements Enter Within It.LikeTemperaure,Pressure,Light,Master Force And Others And Why ItsGonna To Be Convert Without Why It Will Be Convert.And When Enter Something Within And React And Then 2+2=4 Kg Should Not Be 4 Kg And It Will Be 4.10 Kg Or 3.90 Kg Or 4.20 Kg Depends On Environment.So,NewRoult Law Will Be According To Me: (n2+n1)/n1=D(P2- Or + P1)/P1

Or (n2+n1/n2)=D(P1- Or + P2)/P2

Or (n1+n2)=D(P1- Or + P2)

Or (n2+n1)=(P2- Or + P1)D………Here P1 And P2 Next Situation Of n1 And n2. D=K And According To My Previous Equation K=Pressure*Temperature/N(Atom)*Volume Or D=K That K=Temperature*Pressure/Volume

Graham Law: Motionless Pressure And Temperature Any Gas Diffusion Per Inverse Density Rot

Answer:Gas Diffusion r=KTPD/Delta Time Here K=Increase Or Decreases With Temperature And Pressure Like Attraction Or Repulsion Equation

MarkonicovLaw:R-CH=CH2+HX …..Here (=)=Two Double Bond Now Solve Equation Will Be R-CH-H-CH2-X It Will Be True Equation Reaction Cause Asymmetrical And Unconnected Or Not Related.

Now You Can Think All About Your Study Equation They Are True Or Not And There Are Fit For Life And Environment Not Cause I Guess They Are Not Fit For Environment And Life Cause All Uniform Velocity And Acceleration Equation And Modified Equation Which Is Not Fit For Life And Forever Cause Here And There And In Constellation Or Universe Nothing Is Uniform Velocity And Acceleration Equation.People,Vehicle And Planet And Constellation And Universe Never Walk Or Run Or Motion Or Motionless As Uniform Velocity And Acceleration Equation.ItsGonna Change When Time Change Or Mass More Or Less Change And Moment Change Like Strom Is Not Uniform Velocity,Tsunami,Rain,MoonLight,Sunlight,Vehicle And Others Nothing Is Uniform Velocity And Acceleration Motion Or Motionless But All Your Study Equation Uniformly Go.I Am Solving According To My Own.ButIts Your Matter Accept Or Not.Now You Can Think Your Own Way And Try To Solve If You Are Guess They Are Wrong.

And Albert Inestine And Salam Glass And Stephen Hocking Equation Wrongly Prove From My Plant Energy,Fragrance,Color And Others Planet Light Absorb Or Mine,Pit,Quarry Find Equation. .............Are Those True About About Uniform Velocity And Acceleration Equation And About Isaac Newton Equations Wrong & Error?.........Please See Attachment For Further Attachment And Discussion.

Dear colleagues,

For genomic library preparation we need to obtain Tn5 enzyme. Unfortunately, In-house-produced Tn5, which was purified on Ni-column, has a nuclease activity without loaded adapters. Сould this be due to the incomplete enzyme purificatoin from the gDNA using PEI? Is this related to accidental nuclease contamination?

Dear All,

Hope are you doing well.

I am working on beta lactamase inhibitors. I have beta-lactamase-producing bacteria and i will have to check the concentration and enzyme activity for beta-lactamase using nitrocefin. Kindly share the protocol for the same.

Thank you

detailed explanations and procedures if any

Anyone have any experience using the EnzChek pyrophosphates kit in the presence of citrate. There appears to be something strongly absorbing at 360 nm prior to the addition of the last enzyme (PNP).

Hello, I am planning an experiment to measure enzimatic activity, and i will take sample every 24hrs. The only problem is that substrate is non soluble... nevertheless, enzyme can still access to it. My idea is to keep the reaction on movement, but i would like any suggestion on how to lessen error when taking the sample, because last time i tried doing separate reactions in different tubes for each measure (e.g. i had 3 different tubes for T0, 3 dif. tubes for T2, and so on), but replicates wheren't as much as similiar as I expected them to be. My first thought was to make a reaction stock (on triplicate), and take a volume of it each time, but I believe that since the subtrate isnt soluble, each time I take a sample, subtrate might vary, and i will still get error...

Is there an alternative for this type of experiments?

If not, which way is better: a stock reaction or multiple reactions?

Thank you in advanced for reading.

I am working on Nitrocefin assay for screening of beta-lactamase inhibitors and for that I would need to generate the standard curve using Nitrocefin. For my assay, I would be using crude beta-lactamase enzyme and inhibitor which will be incubated and later Nitrocefin will be added and evaluated using microplate reader at 490nm. Can I plot standard curve using Nitrocefin (fixed concentration) with enzyme unit (varying concentrations) or Is there any other methodology ? Please suggest as I am not using any readymade kit and need to develop a simple working procedure in a lab.

We digested pUC57 with the XcmI enzyme, and a non-specific band at 1500bp appeared alongside our intended band (2750bp). To diagnose the issue, we attempted gel purification on both the digested and undigested products, but received the same result. Additionally, we tried heating the digested and undigested products to dissolve secondary plasmid formation, but the same result occurred.

is there anyone with same issue who can help us please?

Antibiotic resistance , enzyme production are types of screening method . Both have advantages and disadvantages so , in these two which method is more preferred to insert in vector and provides maximum results . Are there any considerations of these methods while performing gene cloning?

All other aspects of how the simulation runs is ready. I am now creating a class in python called "Enzyme", however the following problem is not yet solved:

In BRENDA I have found the Kcat and KM values for ATP and glucose for hexokinase. In this bisubstrate reaction, how can I compute the reaction rate if I know enzyme, ATP and glucose concentrations? The problem I have is that I need to get Vmax from somewhere but for bisubstrate reactions I cannot compute Vmax from Kcat (because there are two).

Is computing Vmax as the enzyme concentration multiplied by the lowest Kcat an option?

Am I making a mistake by using Michaelis-Menten kinetics?

All help is welcome and appreciated :)

I want to test a list of peroxidases against a specific metabolite.

Ideally, I want to find an enzyme that will catalyze the reaction. But even a feeble peroxidase catalytic activity would be a great start.

Any tips are welcome!

I found that an organ contains an enzyme that can deacetylate N-acetylserotonin, but I cannot identify it. Does anyone have suggestions for identifying the enzyme?

A polymerase enzyme must be needed to transcribe a RNA or replicate a DNA sequence a. But how the 1st polymerase was produced from the genetic material when the ancient cell was born?

I am using the following equation to calculate the amylase activity.

Glucose conc. from Spectometer X 1000 X Dilution factor

Enzyme activity (U/ml/min)=----------------------------------------------------------------

Molecular weight of glucose X Incubation time

Is it correct? or have any alternative equation? Please tell me.

I am testing an enzyme, arylacetamide deacetylase's activity toward different substrates. I am not sure whether the enzyme I am using, which is expressed in the Sf21 cell, will have the same deacetylase activity as the enzyme expressed in the 293T cell?

I have extracted collagen from various animals and would like to study their molecular weight differences.

I want to measure the molecular weight using Q-TOF MS, but the protocol is unclear, and I have a question.

1. lysis and measurement, which enzyme should I use?

2. we have a Thermo LC/MSMS. Is it possible to analyze this instrument?

The calculation i tried,

Since 200 U is present in 1g that is, 200U IN 1000mg

Hence 5 U will contain 25 mg.

And for 0.5 U we'll need to take 2.5mg.

But i am confused as to in what volume this has to be dissolved ?

Applying enzyme assisted extraction method using an enzyme cocktail. The reaction mixture was incubated overnight at a specific temperature. Can this enzyme cocktail also act on metabolites by breaking them down into different components, e.g separating a sugar from an aglycone component?

plasmid concentration= 253.8ng/ul.

Greetings, colleagues!

I am currently analyzing IL-6 -174G/C polymorphisms using the PCR-RFLP method.

I set up all of the conditions for PCR and restriction enzyme digestion. I had no trouble analyzing 28 probes. Then, from day to day, I got an irregular image after electrophoresis of restriction enzyme digestion products.

On each agarose gel, I placed two DNA ladders (one at the beginning and one at the end), two PCR products (to see if the product had amplified), and sixteen enzyme digestion products.

On 12.07.2022, I received the regular image of the separation, allowing me to assess the genotypes of the patients. On 13.07.2022, I received an irregular image with a stripe of around 50 bp in each path, which stopped me from further analysis because the stripe is the same size as the potential final product of enzyme digestion. What's more, this stripe appears in the separation of PCR products, where only one stripe of amplification product should appear. I considered a few possible causes of this troublesome stripe:

I rule out restriction enzyme fault in this case because the stripe appears in the undigested PCR product as well.

Further information:

I use a DNA ladder with sizes ranging from 1000 to 100 bp.

The amplified PCR product has a size of 164 bp.

After restriction, the products are 164 bp, 111 bp, and 52 bp in size.

I'm trying to attain kinetic parameters of TdT. And I'm using Fam-labeled oligo. I made 20% TBE-UREA PAGE, with 8 M urea. I pre-run my gel and load only 5 microliter of sample. The first four lanes from left are my oligonucleotide with incubation with enzyme and the last lane is my control without enzyme. I want to get discrete bands , what should I do?

I am using some restriction enzymes, and according to the protocol, the amount of enzyme should not exceed 10% of the total reaction volume to avoid star activity. This activity is due to the high glycerol concentration that I would have if I used more than 10% of the enzyme (that is stored in 50% glycerol). Could you please explain to me how can glycerol induce this star activity in restriction enzymes?

Recently I am stuggling to improve the kinetics of an artifical enzyme. I expressed this enzyme in E.coli and then test it's kinetics properties.

I noticed that if I pick single conies for testing, there will have a variation in both reaction rate and maxium reaction. indicating in fig.1 (the y axis represent the product that have been formed and the x axis represent the time in seconds.) 4 different conies have been picked and they all contain the same plasmid that transfection at the same time and same procedures. However there is huge differeces in the reaction rate and maxium reaction.

Then I wonder if it's due to the different conies would fold the protein differently, so I did another test by add multiple conies (actually all conies on one dish) into my culture medium. And then I test this mixed enzyme with different substrate concentration to test the affinity and kinetics at the same time. fig.2 (different color represent different concentration; the dash line represent a Imaginary limitation)

The problem that makes me wonder is that: what might be the reason for this reaction have a rate limitation?

I have few hypothesis about this phenomeon:

1. based on the Imaginary rate limitation; there might have steric effects preventing the binding of the substrate. (but I don't have see enough enzymatic reaction curve that have steric effects)

2. based on the varation between conies; this artifical enzyme might have many different ways of folding (I mean this enzyme would have many different prefered structures in different bacteria cells). maybe bactria from the same coniey would prefere similar stucture? and some stucture have better enzymatic performance, others do not.

I am really appreaciarte your reading and would be very happy to receive any response.

about mutation

Dear community,

I am having this issue as I need to follow the following protocol:

"Phosphoglucoisomerase-glucose-6-phosphate dehydrogenase (PGI/G6PDH): 40 ul of phosphoglucose isomerase (Boehringer yeast enzyme, 2 mg/ml, ca. 350 units/mg) and 20 ul of glucose-6-phosphate dehydrogenase (Boehringer yeast enzyme, 5 mg/ml, ca. 140 units/mg) are diluted to 1 ml with 20 mM Tris-HC1 or imidazole-HCl"

I am confused about the 2 mg/ml, ca. 350 units/mg. Could someone help?

Thank you.

Best regards,

Katherine

elicitors shouldnt binds with enzyme at the active site.

thank you all

what else is missing for the calculation? do I need to consider the reaction volume also? the volume was 600ul.

For the synthesis process of the hydrogel.

I want to extract glycosaminoglycans using pepsin enzyme, I tried Tris buffer and sodium acetate at pH 1-3, but I want to try a buffer other than these two, thank you for guiding me.

"Restrict from EMBOSS Suit version 6.3.1 with the following parameters: snucleotide1, sitelen = 4, rformat = table, enzymes = enzymes.txt. From the 4379 enzymes present in REBASE, we selected the 650 restriction enzymes that were commercially available, since this assay is meant to be used in any laboratory. From the 650 enzymes, 152 digest all P. salmonis sequences and only 65 recognized conserved restriction sites in the complete set of sequences, generating the same/similar restriction pattern (same number of bands and similar sizes)"_{[https://www.frontiersin.org/articles/10.3389/fmicb.2016.00643/full]}

I have two sequences corresponding to the 16s rRNA gene for two strains of a certain species. I simulated the restriction digestion of these sequences using a restriction enzyme.

How do i figure out if a recognition sequence is conserved or not, if the coordinates of the cut are not the same in the sequences?

What i want to say is that they could be different for two reasons: A-not conserved or B-conserved but there was some base insertion/deletion that lead to this position mismatch.

I guess i would need some tolerance, how do i figure this tolerance value and how do i apply it?

(the sequences are flanked by the same primers motifs.)

Emboss's restrict:

The enzyme is water-soluble.When we use this enzyme to catalyze the reaction,whether shaking will affect the catalytic activity of enzyme?Even change the conversion rate of the reaction.

I would appreciate people's thoughts on a methodology consideration.

We're docking several thousand small molecules at a specific location on the receptor. We're using Autodoc Vina to reduce the library to e.g., 20 compounds. Then, further reduction follows using generalised Born and surface area solvation (MM/GBSA), etc.

This is my concern. The crystal structure is a substrate-bound enzyme. Those that prepared the structure mutated Glu to Gln to prevent activation. This single-point mutation is far from where we are docking the compounds e.g., > 4 nanometres. We are considering what our risks and limitation in our study are before running anything. Will an in silico modification (reverting from Gln to Glu) in the crystal structure affect calculation performed by Autodock (vina of AD4) if those changes are outside the grid box in which docking calculations are performed?

I understand the calculations performed by Adutodock/Vina are stochastic to a degree, so a direct comparison of how that mutation affects the results would be tough to produce. However, is there any merit in performing a before and after screening on the receptor, even if that change is far from the docking site?

Thanks.

Available products carry mutations in endonuclease genes cause they are used for cloning applications. Please advise. Thank you!

I performed crosslinking using a 10 mg pellet and 5 ml of diluted 2.5% glutaraldehyde for a period of 2 hours. Upon attempting to dissolve the crosslinked enzyme for activity assay, I encountered inaccurate dissolution. Moreover, when compared to the free enzyme, the crosslinked enzyme did not exhibit activity in the activity assay. However, increasing the concentration of the crosslinked enzyme resulted in activity, which is in contrast to the behavior of the free enzyme, which exhibited activity at a concentration of only 100 ng. What further steps can I take to address this issue?

I'm presently attempting to assay the activity of dihydroorotate dehydrogenase (DHODH) from two different species in the presence of a couple different inhibitors. For one DHODH, I already performed Michelis-Menton analyses and determined its Km for both dihydroorotate (substrate) and decylubiquinone (coenzyme, electron acceptor), and Vmax at 31 nM enzyme. I have also determined the IC50 of both inhibitors for this first DHODH at a single concentration of the substrate and coenzyme. For the other DHODH, I am limited to using only 10 nM of the enzyme in the assay, which is enough to see activity but prevents an apples-to-apples comparison. The ultimate goal is to compare the potency of inhibition of the same inhibitor between these two enzymes. As such, I'm wondering how to go about selecting the concentrations of dihydroorotate (DHO) and decylubiquinone (Qd) such that we have the closest we can get to an apples-to-apples comparison. My current thought is that I should again determine the Km for DHO and Qd with the second DHODH at the 10 nM concentration, but then keep the ratios of [DHO] and [Qd] to Km the same as they were in the experiment already performed for the first DHODH. However, I'm very curious to here what you all have to say.

Thank you in advance!

In the enzymatic reaction, the enzyme concentration is constant。With the increase of substrate concentration, will the reaction conversion rate increase in a certain period of time? If this is feasible, can increasing the substrate concentration increase the conversion rate to 100%? If not, what are the factors?

I bought 100 units of lyophilized enzyme, but I do not know how much volume of buffer to dissolve this enzyme. I will be glad if you help.

I am currently running an HPLC to quantify the activity of my enzyme. I incubate it with my substrate which shows a peak corresponding to its product and also the substrate peak which wasnt converted as well. Since i use the substrate i also do HPLC runs with the substrate alone as a control so i add no enzyme to it and all the buffer conditions, pH etc. are the same. I use the exact same methode (flow rate, injection volume, temperature) as well. But every run shows a substrate peak at a RT of 7.3min for the substrate alone without any enzyme. The peak corresponding to my substrate in the enzyme reaction however has a RT of 7.1min so a shift of 12 sec even though it is the same compound. How is it possible?

How do I measure activity of an enzyme if it catalyses a two-step reaction? The final product is what I want.

Hello,

I am trying to figure out the issue with the isoform of pDNA isolated with GeneJETPlasmid Miniprep Kit and further digested with FastDigest enzyme in FastDigest Buffer (thermo scientific). As a control for restriction digest I prepared the exactly same reaction with pDNA, but didn't add the enzyme. I loaded on 1% agarose: marker, pDNA in restriction digest mix without enzyme, pDNA in restriction digest mix with the enzyme (see the pic attached).

The enzyme recognizes a single site, so what I expected to see on the gel was the supercoiled plasmid DNA band in the middle lane, and in the right lane, digested, linear pDNA band, at slightly higher position than the middle one.

Instead, the middle one is a smear, that can hardly migrate through gel and I don't see pDNA at all. I don't think that it's genomic DNA or RNA either (used SYBRsafe for staining), as the right lane is a clear band which also corresponds with the expected pDNA size.

My question is, could FastDigest Buffer disrupt the supercoiled pDNA into open circular or nicked isoform? Currently, I cannot perform gel electrophoresis, with pDNA alone thus I hope someone has some more experience in this matter.

Thank you

In our thesis we did a reasearch about antioxidant acitivity of SOD. To get results we used the formula according to SOD kite Assay Cayman. We understood the formula the following way: the more enzyme the higher antioxidant activity. However, during the research we found articles claiming the opposite. How do you understand the formula?

Thanks, Erika.

Currently, i got SRL Restriction enzymes for performing a double digestion reaction (NdeI and XhoI). However I doubt on the functionality of the enzyme. I first performed single digestion with my empty vector (pET43a) to check if the enzyme is able to digest my plasmid and incubated for 4 hrs (each enzyme individually). However I did not get satisfactory result. Any suggestion would be helpful.

Hello!

I'm a researcher working for identifying novel natural inhibitors for a microbial inhibition. I have selected a target enzyme in the particular species of microbes and now I need to validate whether that target is a suitable one for inhibition.

I am really new to this field of inhibitor discovery and could you please recommend me any methods to do the above step. I have seen there ere many methods of doing it. But most of them seems to be really complex.