DNA Vaccines and Virus Vaccines - Science topic

Daer Geof Pain

As far as i know, the primary solutions and buffers used to encapsulate mRNA within lipid nanoparticles, would be completely eliminated by TFF and replaced by PBS or other safe buffers. Nevertheless, the possible remained ethanol and other ingredients involved in upstream steps should be checked by QC departments.

follow

Molecular docking

Dear Professor @Mutasem Z. Bani-Fwaz, (in lighter vein) this is a question of life or death.

In my opinion, the vaccines come after lot of tests/ trials. But, there will be always a risk ( virus is mutating/ individual's response to vaccine may vary). So. I will get vaccinated.

More antisense RNA (asRNA) in highly conserved regions of coronavirus (SARS and MERS):

MN988669.1:14755R24 (gene="orf1ab", ribosomal_slippage,putative RNA-dependent RNA polymerase)

5' UAC CAU CCU GAG CAA AGA AGA AGU 3'

Td = 70.2°[nearest neighbor method]

Tm = 82.5°[%GC method]

Alignment

5' ACTTCTTCTTTGCTCAGGATGGcA 3' SARS-CoV-1

5' ACTTCTTCTTTGCTCAGGATGGTA 3' SARS-CoV-2

5' AtTTtTTCTTTGCTCAaGATGGTA 3' MERS-CoV

MN988669.1:17826R23 (nsp13, putative zinc-binding domain, putative superfamily 1 helicase)

5' CCC UGU GAU GAA UCA ACA GUU UG 3'

Td = 66.7°[nearest neighbor method]

Tm = 82.9°[%GC method]

Alignment

5' CAgACTGTTGATTCATCACAGGG 3' SARS-CoV-1

5' CAAACTGTTGATTCATCACAGGG 3' SARS-CoV-2

5' CAgACTGTTGATTCcTCACAGGG 3' MERS-CoV

PS: Do not expect a finished product.

Laboratories with the appropriate equipment and methods are of course addressed for the check.

It would depend on your data.

If you are comparing the effectiveness of a protocol you may plot the mean and standard deviation of the cell proliferation rates between protocols.

If this work is the validate a technique you may look to plot mean proliferation rate in the presence of the protein compared to negative control.

You would need to include more details, such as the aim of the experiment, for further answers!

Interesting question and looking forward to read answers

I speka bout real dangers and damages of brain of fpoetus and neonatis! Intauteine infections, metabolic disorders, diets, hormonal disturbances, aemio, ect. Then preterm delivery, arteficial deliverz , anestesy, hypoxia, hypoglicemia, electrolite disbalna, perinatal and postnatal infectios, ect. Most preventable and curable etiologies! It is no reparation of mytochondrial damages! And the baby from firs hours and days must have continuisly, tactile, acustic, vestibular and visula stimulation. The mother must speka with babz all the time and in teh same room! No separate the baby from mother! No in other room!!! It is unnaturally!

I used real-time qPCR to detect Vero DNA using primers I designed. I didn't extract the DNA from the vaccine preparation, though, so the method wasn't very sensitive since I had to dilute the vaccine fairly far to avoid enzymatic interference. Also, see:

ThermoFisher/Applied Bio

resDNASEQ® Quantitative Vero DNA Kit 100 rxns for $2305 List price

Sanofi has a presentation: https://www.regonline.com/custImages/240000/244811/Mallet%20-%20NCNV%20II%20(2007).pdf

and I have seen them contract the service out to "WuXI AppTec, Inc. (Philadelphia, PA) " in an HSV vaccine paper by Mundle, S et al. 2013 PlosOne.

Good Luck.

Hi,

The type of cell line used for virus culture depends on the sensitivity of the cells to a particular virus; for example, Hep-2 cell line is used for adenoviruses and respiratory syncytial viruses. Therefore, you have to sure which cell line is suitable for your target virus, and vaccine production.

I'm not sure what you think you are buying by this strategy of targeting a large number of linear epitopes. Even with just a few, that's a variant of the older component peptide vaccine method that doesn't work very well. Perhaps you are trying to target HIV epitopes? Is that why you want to do this?

If you link together that many linear peptide sequences, what you will have, if you get expression, is an entirely new protein. How it would fold is a good question. You could try Rosetta or Robetta on it. 

http://robetta.bakerlab.org/  - High quality structure prediction. http://www.bioinfo.rpi.edu/bystrc/hmmstr/server.php

How that protein would relate to generating antibodies you want would be impossible to predict. There is no reason to think that the proteasome  would chop up that novel sequence into parts resembling your desired epitope. It might, but I would highly doubt that most of them would get presented as you hope by MHC.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1783040/ - In figure 1, the little barrel shaped thing labeled 1, antigen processing, is the proteasome. Understanding it is key, because the way the proteasome breaks things up defines what can be presented to the immune system.  Note that the best epitopes are non-linear as a rule.

I'd expect that something out of that 20-linked protein would produce an antibody that sticks to some parts of the target protein(s) you are after. However, you could also produce some that are unique, and the affinity may not be all that great. I wouldn't want to  try that on humans, mainly because there is the potential risk of generating a rogue antibody that produces auto-immunity. Pretty low risk, but not out of the question. 

In any case, primates don't produce B-cell response well from DNA vaccination. It is sometimes termed the primate barrier. Most of it would be T-cell response. B-cell response will happen, but it won't be a strong response.

If this is for an animal vaccine and you want it to work, I would suggest simplicity. Express key proteins completely. Let the immune system decide what the best epitope is. But not knowing your goals, whether it is educational, etc. it's hard to say. One can sometimes learn more from doing strange and possibly useless things than doing a conservative, more likely to be viable project.

Thanks Ben, very interesting!

T cell epitopes can be found on either the outside or inside of a virus. The classical example is the nucleoprotein 118 epitope in LCVM (inside) in the Balb/c mouse as well as the nucleoprotein 396 (inside) & glycoprotein 33 (potentially outside) in the B6 mouse. T cell epitopes, because the are processed before presentation, can be found anywhere in the proteome. On the other hand B cell epitopes are almost always on the outside of the virus and for the most part are hydrophilic in nature so as to be accessible for the antibodies. An other difference is that while T cell epitopes are linear in nature and sequential in the protein structure, B cell epitopes CAN be linear in the protein OR a combination of different residues in different 'loops' of the protein and even a combination of residues from different proteins, i.e. these epitopes CAN be 3D in nature and lost in conformation changes and denaturation of the virus.

As for the original question. NO quantity is NOT always a good indicator for a vaccine candidate, it obviously critically depends on the presence of an epitope and the quality of that epitope, i.e. it's binding affinity to the intended MHC and the presence of an T cell precursor population with appropriate binding affinity or precursor Ab population. In addition, for most anti-body response based vaccines the epitope selected would need to be neutralizing (i.e. binding of the Ab would need to inhibit binding and/or entry of the virus into the cell).

A book could be, and probably has been, written on this subject and even then we don't know all the parameters that go into making a 'good' vaccine. Evidence the failure to produce an effective vaccine for AIDS and Flu as well as a number of other important diseases which don't have the particular 'mutation problem' these have.

"In theory, there's no difference between theory and practice.  In practice, there is" Y.Berra  

I had understood one could also construct smaller immunostimulating peptides- but where is the evidence base?   Guess dose-response is key.

Thanks for fascinating question and responses.  There seem to be important threshold effects for systems, so why does something magical happens with a 13 aa chain? (or not, in practice:)

Detergent treated virus might give an HA after removal of the detergent, but depends on virus subtype and preparation. So, the answer to your question is: it depends.

Jonges M, Liu WM, van der Vries E, Jacobi R, Pronk I, Boog C, Koopmans M,

Meijer A, Soethout E. Influenza virus inactivation for studies of antigenicity

and phenotypic neuraminidase inhibitor resistance profiling. J Clin Microbiol.

2010 Mar;48(3):928-40.

Yes I agree with Tatiana. You have to have a totally empirical approach with basic data on virus size, aggregation properties of the virus in given fluid, the types of proteins and their characteristics in the fluid along with membrane characteristics organized to design your experiments and come to conclusion.

Thanks.

The better awareness can be achieved through the coordinated approach of concerned Govt. by organizing awareness . The use of insecticide and biological control method should be applied. Also there is a need to educate the health workers.

Hi Abdelmalik,

I just wanted clarification on general information about the cross reactivity of Pneumovax23 which is targeted against Strep. pneumoniae.

My concern is specifically to the point that whether the cross reactivity and cross protection (or cross immunity) are same for this vaccine?

When it finished with the disease and does not cause side effects. Easy to say, hard to get.

hi

i personally use 293T cells to make virus by transient transfection , but they undego only single round production but you get huge amount from them. If you still want you can propagate the virus in T cell line or any other cell line but you have to change the media very often to take care of cell debris and death.

we standardized the protocol for making virus very well in our lab if you want i can send you the detailed protocol.

All the best

AB

Hi such kind of booster dose pattern may be observed while one is working on hyper immunization in experimental animals with increasing doses because in such cases there are chances of shock and it is highly debilitating for the subject too.

I think the LAB strains genetically modified with antigenic protein coding genes alone should be considered for use as the potential benefits outweigh the negative impacts arising from use of antibiotics/ drugs to treat infections. I am of strong opinion that the guidelines need to be relooked in the context of potential benefits and sustainability over long term.

Anuradha Krishnan's statements are factually correct but Jane Zhou's answer is more appropriate for this question - particularly the last 3 words of the question: "in vaccine research". Immunodeficient mice have substantial limitations for vaccine research, are unlikely to be readily available to an investigator in Egypt at this time, and limited to narrow experiments like adoptive transfer. Not useless, but for the question asked I think the shorter answer was more appropriate.

Some approaches are

Regards,

Joachim