Cycling - Science topic

To predict the capacity of LFP cathode or MCMB anode half-cells before the first charge-discharge cycle, you can use indirect methods:

Electrochemical impedance spectroscopy (EIS)

The impedance spectrum can reveal internal resistance and charge transfer properties. The charge transfer resistance (Rct) is often inversely related to capacity, but precise prediction requires calibration with similar cells.

Material characterization

Estimate the theoretical capacity from the active material weight and specific capacity:

- LFP: ~170 mAh/g

- MCMB: ~350 mAh/g

Factors like electrode composition, porosity, and uniformity also influence the practical capacity.

Open circuit voltage (OCV) analysis

The OCV before cycling can indicate lithium-ion intercalation behavior, indirectly correlating with capacity.

Other considerations

The solid electrolyte interphase (SEI) formation on the MCMB anode during the first cycle can consume lithium, affecting capacity. Freshly fabricated electrodes may also require initial activation.

Impedance data alone may not directly provide capacity but can serve as an indicator when combined with other parameters and experimental calibration.

We had a similar milky structure formation after sputter and annealing procedure of Pd(001) cleaning. The surface had a spiral texture as well. We heated this sample to 1200 degrees Celcius for 10 minutes by slowly raising the temperature all the while observing the sample, and noticed that at around 1200, the milky surface texture was gone and the smooth surface resurfaced.

Most likely the best/simplest option is repeating chronopotentiometry. This is assuming you want to control the current and the anodic and cathodic currents will be the same throughout the experiment (not as each other, but that the anodic current will be the same throughout and the cathodic current will be the same throughout).

The duration of each cycle does affect the plating/stripping performance, overpotential, and interphase behavior of zinc-air batteries. A longer cycle time (e.g., 12 hours/cycle) may lead to smoother electrode surfaces and more uniform stripping, but may increase internal resistance and overpotential. A shorter cycle time (e.g., 2 hours/cycle) may result in lower overpotential and internal resistance but potentially poorer electrode surface stability. The optimal method depends on the specific application and requirements of the battery.

----

Canrd provide battery R&D services. If there's an opportunity, you can consult with our technical staff (our core team members come from CATL). We have accelerated the work of many research groups and R&D teams. We can solve most battery-related issues for you.

We also offer battery materials/electrolytes, material evaluation and performance testing, and custom dry cells.

For more information,

please visit our website: [https://www.canrud.com]

check out our factory video : [https://youtu.be/Wj6bOrbuwWA]

It is a single cycle, step 3 will inactivate the enzyme. As your thermocycler, you can set it to 2 cycles and end the program when the first is finished.

Yes, it is possible to simulate high cycle fatigue (HCF) crack growth based on time in Abaqus, but not directly by defining amplitude and time. Abaqus doesn't have a built-in feature to directly link time to load cycles. To simulate high cycle fatigue (HCF) crack growth based on time in Abaqus, you'll need to use a cyclic loading step to define the amplitude and frequency, and then employ XFEM to model crack initiation and propagation. A suitable fatigue crack growth law, like the Paris-Erdogan law, should be applied to predict crack growth rates based on stress intensity factors. The analysis is iterative, with the crack geometry updated after each cycle and the simulation repeated. Key considerations include time step size, mesh refinement, material model, and convergence monitoring. While this approach is more complex than a direct time-based simulation, it provides a more accurate representation of HCF crack growth.

Adjust the rotation of wheel and then find out how much it takes time in one rotation, so... That's it.

Presumably your vertical axis is force and horizontal axis is displacement and your forces are low enough to protect the sample from plastic deformation or failure.

If all cycles are performed to the same force, then viscoelastic relaxation or creep will cause migration of the minimum and maximum displacement. This effect is more pronounced in the first few cycles and diminishes with higher cycle numbers. This happens because biological tissues are not perfectly elastic.

Ernest Rogers Thankx for the feedback. I have looked into this but for our purpose it won't work. We install traffic controllers and other active equipment in the manhole. The manhole is made from SMC and has a volume of about 06m^3 after the equipment is installed.

With my testing a 200W raised the temperature of the manhole from 20°C ambient to 52°C. I need to maintain a temperature of 30°C with a 800W heat source.

I have designed a custom aircon unit that will work but as you said the condenser is ridiculously large to such an extent that I don't trust my calculations.

The nature of where these manholes are installed, we cannot have anything exposed above ground due to theft. Everything must be underground.

Any other assistance would be much appreciated.

I have met the same question, can you give me some advice?

Dear Sahil Nain, this is done generally to exclude extra transitions accompanying the targetted one. These extra transitions may be due to residual stresses, different macromolecular structures arrangements (especially in the case of proteins) in the amorphous phase, and others. By heating-cooling cycles, the effects of such artifacts are reduced if note completely removed. My Regards

This manuscript has some information.

The electrolyte used in the previous question is hydrofluoric acid with a 3:1 ratio of ethanol.

Шановний колего. На моє переконання, таким дієвим інструментарієм є системний моніторинг якості знань здобувачів освіти.

Since I wrote this question I realized that frequency is not a velocity but a potential energy, which like 25 mph, is also defined on a time interval.

The string frequency is not a real valued function, it is a scalar output by a functional. The functional takes the equation of motion as input and outputs a number. The number is an extremal given by the calculus of variations. When the string is plucked, it quickly zeros in on the frequency with the lowest energy as a solution to the calculus of variations.

This is important in music theory because we want the frequencies on musical instruments to be algebraic numbers, not sine wave. That is, frequecy is real but constant and cannot change as long as the instrument is in tune.

This explains how the frequency is constant right up to the moment it stops. Velocity cannot go to zero at a point.

The frets on guitar are functionals that take the string tuning function as input and output the frequency.

The somewhat wet exhaust from the combined cycle power plant is acidic, thus requiring an alkaline agent to convert the CO2 to carbonates and water. There is not much research on cost-effective methods of reacting an alkaline source (found in nature, or readily available from a waste stream) with acidic, "wet" CO2. Expansion Energy LLC has received patents for a "VCCS Cycle" which uses alkaline coal ash or "red mud" to neutralize flue gas containing CO2. Natural sources might be better, especially if the alkali source is not toxic, as is coal ash and red mud. Are there any agricultural waste streams that are alkaline?

From result .. check step/frame

If you are working on LEFM, this course will help you to get the required graph.

Is there a way to define cooling/heating rate in a thermal step? Mehdi Aliehyaei

À partir d'une grille d'élaboration d'une évaluation préétablie qu'ils essaient de respecter d'une façon formelle.

Mostly, the crystallization peak appears during cooling. However, you can see the peak both during heating and cooling for polylactide (Polylactic acid).

It seems correct,

Try pre wraps or Coban wraps maybe?

You can restart the pcr and the taq will be fine so you should get your expected bands. Unfortunately the low annealing temperature will allow the primers to anneal all over the genome so the pcr will be messy with additional bands. If all you want is a band of the right size to show the existence of a product then it may work ok but dirty but generally I would start again

Thanks for your interesting question, Felipe. I guess that midstance is a phase during running where the lower limb's function is to support the body as it moves from the loading phase in early stance to the unloading phase in late stance. There are several gait events that occur during the midstance phase, and which could be used as a single, specific descriptor of midstance. These would typically include, for example, a peak vertical GRF (although some athletes have a higher vGRF at impact), the knee at its most flexed, a 'flattened' foot position and, as you mention, the transition between braking and propulsion.

I think that all of these have merit as objective measures of 'midstance' given that which one is most useful depends on the measurement system being used (force plate, videography, pressure pad, optoelectronics), or the aim of the study. For example, I have previously used the braking-propulsion transition to define midstance in race walking, which is particularly useful in that event given the abnormal movements used ( ) although I have also used 'a visually chosen position where the athlete’s foot was directly below the hip, used to determine the “vertical upright position"' in a paper on race walk judging because, although more subjective, this was felt the most ecologically valid regarding what the human eye would consider to be midstance ( ).

In terms of analysing running in competitive situations where force plate data are unavailable, I have used horizontal coordinate values via manual digitizing to determine midstance (defined as 'the instant during stance where the athlete’s foot center of mass was directly below the CM' in both road running: and track running ).

These gait events are unlikely to describe exactly the same instant during midstance (it is more difficult to be precise in any case with video data) but are likely to be very close in timing during running and reflect some of the varied methods used in gait analysis. I hope this is helpful.

Repeated cycles can lead to cracks or enlarged pores which decrease rejection and increases flux. adding some plasticizers or blending could help

I think that your samples are simply over amplified. and combined with the likelihood that you are amplifying too much dna you are getting minor non specific bands amplifying strongly.

I would measure the od of your dna and use 25ng ( who knows how much dna is in 2.5ul?) and run 30-35 cycles ( 45 is far too many cycles) and include a no template control (water instead of dna) to check for contamination and if you are still getting multiple bands then run a DMSO gradient up to 8%dmso or use a higher annealing temperature.

It may be that your dna contains pcr inhibitors and using less dna will work much better

The Climate Index is used to simulate climate anomalies at different space-time scales. There is a study by Ortiz Bultó (http://rcm.insmet.cu/index.php/rcm/article/view/315) that can help you better understand this term and provide tools of interest.

Characterize residual charges, before and after cycling.

Relate charges, losses and the electrical and mechanical properties of materials.

Make sure your observations are original.

Don't follow models that don't apply to all observations: yours and others and do not use the foundations of physical chemistry..

Sincerely

Sorry I forgot to mention it remains on heating and does not switch over the STE!

Could it be that your cold trap packing material is moving around and sometimes creating channels? Sometimes it is packed firmly and sometimes it is loose.

VIEW THIS LINK

Certainly! Here is a list of journals with no publication processing fee that are recognized by the Higher Education Commission (HEC) under the W, X, and Y categories:

Please note that the HEC categories and journal listings are subject to periodic updates, so it is always recommended to cross-check the HEC website (http://www.hec.gov.pk/) for the most current information.

Good Luck!

I don't know what is the cycle. Just guessing. The active catalyst forms in the course of the reaction.

Dear Tiffany

I checked in Primer BLAST. Primers can indeed amplify the snails. See first two results:

Products on target templates

>MF979281.1 Calliostoma unicum isolate DYLKL2 16S ribosomal RNA gene, partial sequence; mitochondrial

product length = 586 Forward primer 1 CGCCTGTTTATCAAAAACAT 20 Template 1 .................... 20 Reverse primer 1 CCGGTCTGAACTCAGATCACGT 22 Template 586 ...................... 565

>NC_068865.1 Tristichotrochus unicus mitochondrion, complete genome

product length = 585 Forward primer 1 CGCCTGTTTATCAAAAACAT 20 Template 10736 .................... 10717 Reverse primer 1 CCGGTCTGAACTCAGATCACGT 22 Template 10152 ...................T.. 10173

But Tm is 52 and 62 for fp and rp by primer blast and 59 and 68 by Thermofisher's online multiple primer analyzer.

Additionally, not a cross dimer but the forward primer forms dimer very easily (Thermofishers online multiple primer analyzer).

See the results:

1 dimer for: f

5-cgcctgtttatcaaaaacat->

||||| | | |||||

<-tacaaaaactatttgtccgc-5

You said you used 50C as Ta. I have not done pcr for the snails ever, but I may say what I may have tried:

1. Increase the Ta, as increased Ta will decrease the chance of self dimer of forward primer (will be become unstable). May be, use 55-60C.

2. You use 1.25 mcl of 50mM MgCl2 in 25 mcl reaction, this leads to final 2.5 mM. Usually the PCR buffer has MgCl2 to make final 1.5 mM. Thus the sum if 4 mM. Increased MgCL2 increased the stability of duplexes, eg primer dimer. So either dont add the MgCl2 (if the PCR buffer is known to have it). Or if PCR buffer doesnt have it, add only to make final 1.5mL, eg. add 0.75 mcl per 25 mcl reaction volume.

3. If primer dimer persist, you may want to decrease the concentration of primers to 0.5 mcl or 0.25 mcl per reaction.

4. All these methods (1-3) decrease chance of primerdimer but also decrease chances of amplification (though slightly lessly), so increase the cycle number, if you do 1 or more of these changes.

Hope your experiments go well and you may get better answer. Paul Rutland is a retired Oxford? lab tech and he loves to answer such question in Researchgate. He may give you answers, much accurate.

Paul Rutland (researchgate.net)

Divya

Because according gto structure of virus e.g. envelpe viruses titer decrease while non envelope one titer increase

The quantitative cycle is proportional to the bacterial density...

Thank you!

Good afternoon,

I would suggest that the housing crisis is not a unique problem to Ireland but a global one were the intensity of it may vary from country to country and between regions in the same country due to a variety of factors. Is the Modular Construction the key to unlocking the housing opportunities - I doubt. I would suggest that that my contribute towards short term relief of the problem, but it is potentially questionable on the longer term. There are number of instances where Modular Construction has been possibly successfully used on a short term basis to alleviate the housing shortage after wars and disasters, but if you look over a period of time the long term outcomes might be different one, e.g. use of experimental technologies that do not allow for ease of alteration and of a limited life span, use of construction methods that potentially increase the risk during earthquakes, floods or fires, construction systems that are difficult to insure and so on. Rather than focusing on Modular Construction it might be beneficial to look into the problem a bit wider: public vs private, not for profit - profit, etc. Even if Modular Construction can deliver all of the needed housing in the world, if people cannot afford to buy it or rent it, Modular is unlikely to be able to resolve the problem. The same probably apply in the allegedly reported instances of house builders starting developments on sites but tightly controlling the production output to manage supply and demand, and main the property prices.

With Best Wishes

Sequencing amplification product is always a good option to determine the specificity of the PCR. In addition, you should at least run an end-point PCR with a low number of cycles for an appropriate house-keeping gene as control for your input.

Could it be possible that your primers also amplify genomic DNA, which basically always contaminates your RNA unless you conduct an DNAse treatment step. If so, design exon-exon spanning primers.

If microchips can be "grown" using organic semiconductors. then yes an AI quantum computing unit can be grown in the a living thing. Perhaps we should try it out with trees first.

Dear Prem Babu

B.Tech (Chemical Engineering), M.Sc (Ecology and Environment), M.Phil (Environmental Sciences), M.B. Retired Executive from DGM (Production and Process) Dangote Fertilizers Nigeria and Sr. Manager National Fertilizers Ltd. India at Institute of Engineers (India)

India

Greetings and respect to my dear teacher and professor. Thank you very much for your complete answer. Abbas

Based on the cyclic voltammogram you shared, the observation of two reduction and two oxidation peaks suggests that there are likely two different redox processes occurring for the metal-ligand system under study. Some possibilities include:

To distinguish these and obtain more definitive structural information, you could systematically alter experimental parameters like metal ion concentration, ligand ratio, pH levels, scan rates etc. and monitor the voltammetric response. Complementary structural characterization techniques (NMR, ESI-MS) would also help elucidate the origin of the dual redox behavior you observe.

here are a few possible reasons why the specific capacitance of a supercapacitor could increase after several hundred charge-discharge cycles:

Thank you for your valuable answer. This was really helpful for me!

The microplastics cycle refers to the movement and distribution of tiny plastic particles within the environment. These particles can originate from various sources such as the breakdown of larger plastic items, microbeads in personal care products, and microfibers from synthetic clothing. Once released into the environment, microplastics can be transported by air and water currents, leading to widespread distribution.

The cycle of microplastics involves their deposition in various environmental compartments such as soil, water bodies, and even organisms. They can be ingested by aquatic life, potentially accumulating in the food chain and causing harm to marine ecosystems. Microplastics can also be transported back to the atmosphere through processes like evaporation and wind erosion, contributing to their global dissemination.

Understanding the microplastics cycle is crucial for developing effective strategies to mitigate their environmental impact and protect ecosystems and human health. Efforts to prevent plastic pollution and develop sustainable waste management practices play a key role in addressing this environmental challenge.