Science topic

Colonialism - Science topic

The aggregate of various economic, political, and social policies by which an imperial power maintains or extends its control over other areas or peoples. It includes the practice of or belief in acquiring and retaining colonies. The emphasis is less on its identity as an ideological political system than on its designation in a period of history. (Webster, 3d ed; from Dr. J. Cassedy, NLM History of Medicine Division)
Questions related to Colonialism
  • asked a question related to Colonialism
Question
21 answers
I have tried to ligate my vector+insert in ratios of 1:3 and 1:5, along with keeping a vector only control. Although, I got colonies post transformation the no. of colonies is more or less same in vector+insert and vector only control plates.
since I have got colonies, I believe transformation isn't the problem here. Could someone help me troubleshoot?
Relevant answer
Answer
Regarding digestion: presence of 250 bp band suggests, that at least part of your plasmid has been cleaved. But this is never 100% effective and at least small fraction of uncleaved vector will markedly affect your result. Most of your clones will be empty.
  • asked a question related to Colonialism
Question
3 answers
Hey jelly community!
I was wondering whether you could help me ID the species depicted in the attached photos?! The specimens have been collected in October and November this year in the Bay of Biscay and westernmost Mediterranean Sea mostly in the top 500 m of the water column. While the first 5 pictures show medusae, maybe semaeostome Chrysaora (?), the creature shown in picture 6 may be something completely different, maybe even a salp chain or pyrosome colony. Scales are included in most pictures. Generally, all of them were between 1.5 and 10 cm in size.
Looking forward to hear your suggestions!
Cheers - Florian
Relevant answer
Answer
I can give you some general information about the types of species you mentioned.
The first 5 pictures you've described as medusae, which are jellyfish-like creatures that belong to the phylum Cnidaria. Semaeostome Chrysaora is a genus of jellyfish that are typically found in coastal waters, and they have a typical bell shape with long tentacles. They are known for the bright colors, and the size of the bell can vary between 1.5 and 10 cm.
The creature shown in picture 6 is harder to identify without visual confirmation, however, based on your description, it could be a salp chain or a pyrosome colony. Salps are marine invertebrates that belong to the phylum Tunicata, and they are common in the open ocean, they have a long and cylindrical shape that can be up to 10 cm in size. Pyrosomes are also common in the open ocean, they are colonial tunicates which are formed by many individuals living together, they have a cylindrical shape and can be up to several meters in size.
I would recommend consulting a marine biologist or an expert in marine invertebrates for a more accurate identification of the species in the photos. They may need additional information such as location, depth, water temperature and salinity.
  • asked a question related to Colonialism
Question
2 answers
B cells
Relevant answer
Answer
This seems like an exam or homework question for a class.
  • asked a question related to Colonialism
Question
5 answers
In our phytobacteriology lab, there is a general rule that bacterial cultures (single colonies) must not be subcultured consecutively from one selective agar medium (i.e. media containing antibiotics) onto another selective agar medium. We currently cannot figure out an original source for this rule, so do not know if this is generally “correct” or advisable, and if so: why? Does anyone have an idea? Thanks!
Relevant answer
In the process of isolation (obtention of pure cultures), one usually starts by plating out the original sample onto an adequate selective agar medium and then selecting one or several well isolated colonies with the desired characteristics. When selecting an isolated colony, we presume that we have a pure culture (i.e., a population that descends from a single bacterial cell), but that is not always the case, due to several reasons. If we further streak this colony onto a selective agar again, eventual contaminant bacteria present in the original colony will be inhibited, but may persist. On the other hand, if you use a non-selective medium, contaminants will show up as different colonies, and you may select only the colonies that have the important characteristics you're looking for, leaving behind contaminants.
Furthermore, passing bacteria through a selective medium will stress them and they will not be in their best physiological shape for further testing.
A note of caution: you should not subculture bacterial isolates multiple times, once you estabished your pure culture, and that applies to either a selective or a non-selective culture medium. You'll cause mutations and alter their properties. I would advise you to constitute a stock culture of each isolate (in slants, for instance) and always go back to that same stock to perform each test on selective agars.
  • asked a question related to Colonialism
Question
3 answers
I have my vector and insert double digests purified and gel extracted. After ligating and transforming, I didn't observe any colonies on the plate. Is it okay if I use the purified double digests for ligation again? or Do i have to do a new double digestion?
Relevant answer
Answer
Since you do not know which part of the ligation is causing the problem I would suggest to keep them and try again since I assume you were able to see the double cut band when you purified it.
  • asked a question related to Colonialism
Question
12 answers
I work for a cosmetics lab in the microbiology department. Our lab is not accredited, but we do follow the International Standards (ISO).
One of the steps in these standards is to contaminate a cosmetic sample with a known strain (S. aureus, P. aeruginosa, and/or E. coli) in a known concentration and then plate the suspension. The media used is a non-selective media (TSA) and the plates after solidifying are incubated inverted. The entire procedure is done in a laminar airflow chamber. The strains used were purchased and then cryopreserved.
The issue is with the P. aeruginosa strain, regardless of the incorporation technique used it will form an aggregate of colonies. Furthermore, the stock strain (kept refrigerated at -5ºC) is changing color after 3 weeks and won't grow after streaking to new non-selective agar media, when most of our strains last at least 6 weeks.
What should we do to avoid the colonies from merging on the plate and is it normal for a strain to become invalid after that short of a period?
The first photo is of the colony aggregation issue and the second is the aspect of the stock strain after 3 weeks.
Relevant answer
Answer
Hello.
You should identify grown colonies on the MALDI-spectrometer. If it is the target microorganism, then the dilution should be rechecked.
No, it is not normal that after 3 weeks of freezing, the culture dies. Typically, long-term storage of P. aeruginosa stock cultures is carried out at -80ºC.
Sincerely yours,
Artem Trofimenko
  • asked a question related to Colonialism
Question
3 answers
Dear colleagues,
I transformed DH5alpha with 70 ng or pUC-based construct per protocol (C2987 NEB). There were not many colonies seen next day (approximately 20 tiny colonies after 1:10 dilution with SOC) as opposed to hundreds good-sized colonies with various constructs, including this one during other transformaitons). I picked two colonies and started an overnight 16-hr incubation in LB at 37C for 200 rpm for a miniprep. The opacity was quite low and the streak plates showed extremily tiny colonies after an overnight incubaiton.
What could be the cause for this?
I recall thawing these bacteria for too long (about 20-30 min) on ice, more than 10 minutes(1st step of transformation) The other steps of transformation were not changed. Could it be a reason for poor bacterial growth now?
Kind regards,
Maria
Relevant answer
Answer
Good luck with your experiments.
  • asked a question related to Colonialism
Question
3 answers
Dear colleagues,
I am wondering whether the size of an individual e.coli colony matters as to how much plasmid it produces? Would larger colonies give higher plasmid yield, or would smaller colonies give more plasmid yield due to toxicity of the plasmid product on the bacteria?
Thanks,
Kind regards,
Maria
Relevant answer
Answer
I don't think you can conclude that there is more plasmid in the smaller colonies by using a colony PCR, which is by no means a quantitative assay and once above a threshold amount the template is usually in excess. Often with colony PCR you get inhibition by the gunk from the colonies, so it may be that the smaller colonies have less gunk (due to fewer cells). I've had quite a few instances where I got no signal from colony PCR, but then if I diluted the template about 5-10 fold I would get signal.
But I think the right conclusion is to not worry too much about it.
  • asked a question related to Colonialism
Question
3 answers
I saw this colony which looks like cells that probably growing upward, is it by any chance an iPSC colony?
I know iPSC colony normally would not looks like this, but has anyone encounter something similar? Can iPSC colony grows upward?
thank you
Relevant answer
Answer
Afternoon,
I concur, this is likely debris, or potentially fungus.
I would keep a close eye on this, potentially throwing this plate away to be sure.
iPSC colonies should be round and the cells close together.
Chris
  • asked a question related to Colonialism
Question
3 answers
I have tried to separate the plasmids by extracting the DNA from agarose gel but I have only managed to make pRARE functional. I have been able to transform E. coli with pRARE that I obtained from this extraction but I do not obtain colonies when transforming with pET28a+. It should be noted that pET28a+ yields very little in this technique.
Relevant answer
Answer
Pierre Béguin and Bertrand Cornu Thank you very much for the tips. They have been very useful.
  • asked a question related to Colonialism
Question
1 answer
I will be working with thermophiles, and I want to culture them on solid media, and view colonies. However, traditional agar melts at lower temperatures, and my desired temperature is 80 °C
Relevant answer
Answer
Hi, I do not have personal experience with it but I have often seen Gellan Gum as the one that is recommended for this purpose.
  • asked a question related to Colonialism
Question
12 answers
According to Philostratus [Life of Apoll. 3.20], Indians founded sixty cities in sub-Saharan Africa 1500-1100 BCE, and according to Juba of Numidia [Plin. Nat. 2.34.97], there was an Indian colony in West Africa before 50 BCE. According to Cornelius Nepos [Geog. 3.5], an Indian tribe had sailed to Germania to do commerce, and according to Scymnus [Perieg. 167], the land of the Indians was located west from Sardinia, which would locate Indian colonies into Iberia.
Were these ancient writers referring to people who originated from India, or was the word "India" just a confused term to refer to all dark skinned people? If the latter interpretation is correct, who were these Africans who were claimed to have populated also western Europe before 150 BCE?
P.S. If you have good comments to these questions, you are warmly welcome to participate to the peer review of the India-Africa-Europe theory, which has been published at https://agilepublishing.fi/books/atlas-and-herakles
Relevant answer
Answer
Dear Pasi Malmi , thanks for the link to this interesting paper. The Indian presence is corroborated by linguistics, religion, archaeology and genetics. You will find a link to the summary of my findings, with a link to my main study, which was peer-reviewed and published in Scientific Culture;
  • asked a question related to Colonialism
Question
2 answers
sewage sample was grown on EMB agar, pink colonies were observed, those were then inoculated on MacConkey agar, pink colonies observed which due to time turned translucent white. what can be suspected bacterial species???
Relevant answer
Answer
As Ravini said and assume Gram negative and pure culture, looks like a lactose fermenter. Prob not E. coli
  • asked a question related to Colonialism
Question
1 answer
Hi all,
I want to separate S.cerevisiae spores from their asci so that after plating a sample each colony will result from a single spore and not from the four spores in the ascus. Under the microscope I see that after treating S.cerevisiae asci with zymolase/lyticase the spores are still connected. Is it just a matter of zymolase/lyticase concentration (I've been using 500U/mL lyticase) or is there a way to disconnect the spores after this enzymatic treatment.
Thank you
Relevant answer
Answer
porulation of the baker's yeast Saccharomyces cerevisiae is a response to nutrient depletion that allows a single diploid cell to give rise to four stress-resistant haploid spores. The formation of these spores requires a coordinated reorganization of cellular architecture.
Regards,
Shafagat
  • asked a question related to Colonialism
Question
2 answers
if same bacteria from a colony grows on both macconkey agar and mannitol salt agar research gate
Relevant answer
Macconkey agar and mannitol salt agar is a medium for the growth of microorganisms. This medium helps the growth of a certain type of bacteria. This medium is important in medical laboratories to differentiate between pathogenic microbes in a short time.
  • asked a question related to Colonialism
Question
1 answer
Hello, I am currently learning to generate Agrobacterium deletional mutants by homologous recombination. I already prepared the construct containing the up-and-down- fragments of the gene from Agrobacterium in a suicide plasmid (SacB, GmR) in E. coli S17. To obtain the deletional mutant I did bacterial conjugation between Agrobacterium and S17. The result of the first crossover seems fine since the Agrobacterium colonies I obtained contain the up and down fragments after I did the PCR check. However, in the second crossover, I thought at least I would see some colonies going back to wild type, but no bands are shown in all colonies I picked following the PCR. This experiment was actually already done by someone else in my lab, and she obtained the mutant. I used her mutant and the wild type of Agrobacterium as control. The PCR result of the control seems fine. So what is the possible reason for this failure, and is there any suggestion?
Relevant answer
Answer
It is hard to diagnose what is going wrong without more details. But I would suggest you try again and use a few independent "first recombinants" and see how each behave. Sometimes you just get a weird colony for non-obvious reasons. But if you have someone who has done it already, why not ask them to help you trouble shoot, there might be something subtle that is wrong in the design.
  • asked a question related to Colonialism
Question
3 answers
Before passaging, and freezing, this ipsc passage's sum was 63
after culturing, I passaged and froze.
First, I found that the transferred cell was not attached on matrigel plates (0.5mg/plate)
I thought that may be related to plate coating or my thawing mistakes.
Then thawed them to another person's matrigel by themself and my matrigel by myself. But it didn't attach. But colony size was great, and colony density was also high.
Moreover, cells are taken away changing the medium ( two days after subculture. )
I am still trying to figure out the reason.
I used gibco's Verene, Wicell E8.
Those pictures are captured after 24h subcultured.
In the picture, non-attach colonies are soooo weird!
Could you find some reasons?
Thank you
Relevant answer
Answer
Is it possible that there's some kind of medium contamination going on (micoplasma, bacteria or fungus)?
At this point, after confirming everything thing else is ok, I'd suggest you go back to basics, thaw a batch onto a feederlayer and give them time to grow into iPS colonies with decent morphology.
  • asked a question related to Colonialism
Question
3 answers
hello
i have a question about the cloning
i am trying to do the cloning for ECFP and EYEP , although i have colonies on my AMP plate the result of my cloning is negative.
would you please help me what should i do and how i can fix this problem.
thank you so much
Relevant answer
Answer
did You use a single restriction enzyme for linear the vector? In this condition, there is a chance of self-ligation of the vector to produce false positive colonies.
Try double digestion of vector and insert with 2 different RE enzymes that eliminate the self-ligation.
1) check your antibiotic stock concentration and prepare fresh working stock if possible.
2) Make sure that your competent cells are not growing in media with antibiotics to check for any contamination.
3) To check contamination in competent cells used 2 culture tubes one with only media+antibiotic, media + CC and media+antibiotic+CC.
4) For transformation used an extra control without ligase.
5) While plating make some control
a) CC without any ligation mixture.
b) CC with ligation mixture(no ligase)
c) CC with proper ligation mixture.
I hope this will help you or you will defiantly find a solution to your problem.
and I'm sharing some useful articles too for your referencehttp://www.protocol-online.org/biology-forums-2/posts/6830.html
  • asked a question related to Colonialism
Question
1 answer
Hi,
I am having troubles cloning a Cas9 gene (around 4300 kb) into a vector, replacing a LacZ cassette. (I use the uloop system.) I use SapI as a restriction enzyme and T4 as a ligase. I cloned several other constructs into the same kind of vector with high efficiency (mainly white colonies, and almost all carry the correct insert when screened).
When I try to insert Cas9 (or also dCas9) I yield the same number of colonies, with again almost all white. However, when I screen the colonies via colony PCR or restriction digest the isolated plasmids of the colonies, no vector carries the insert. I did not sequence these plasmids, but from the restriction digest it suggest, that the plasmid only lost its LacZ cassette and was closed again without any insert (eventhough overhangs are not compatible).
I tried two settings for GGC:
37 C 5min...............37 C 5min
16 C 5min................16 C 5min
(25cycles)................(40cycles)
65 20min-................65 20min
85 10min..................85 10min
4 hold......................4 hold
I tried two different buffer conditions:
-T4 buffer only
-Or 50% T4 buffer, 50% Cutsmart buffer
I started with fresh Cas9 (and dCas9) PCR templates and with several fresh receiver plasmids. Also I used different competent cell batches.
I double checked the overhangs of receiver plasmids and the overhangs created on the Cas9 insert.
I am running out of ideas..
Does anyone know if GGC with single large inserts (4000 kb+) effect GGC efficiency?
Does anyone have a suggestion how I could improve GGC efficiency?
Further troubleshooting suggestions?
I really would appreciate your ideas!
Thanks,
Florian
Relevant answer
Answer
In my experience Golden Gate reaction has considerably (about 10-fold) lower efficiency with PCR products vs plasmids. First and foremost, it must be assured that PCR product is pure (spectrophotometry check). Second, does concentration for the insert is calculated using moles (not mass). If same mass is added to the reaction, large inserts can end up at very low molar concentration. Third, are overhangs indeed ok. It is always worth to re-check this by using tools for in silico cloning. For example, Benchling allows one to choose fragment and then perform in silico GG reaction to check that overhangs are ok. I know that it was mentioned that overhangs were checked, but due to high-throughput nature of GG reaction, frequently, errors here are over-looked. Fourth, also from this category. Is the antibiotic on plates correct?
In my program for GG cloning cycles are (1min - 37C, 3min - 16C) X25. Using longer cycles seems unnecessary, as it appears that even under those conditions the vast majority of plasmids are ligated by 10th cycle. Prolonged incubation at 37C might decrease enzyme activity and be detrimental. But I don't think this is the problem.
If none of these seems like an answer I would adivise to titrate the amount of Cas9 amplicon; i.e., set up several reactions with increasing amount of the insert.
There is also an option of 'classical cloning'. Just precut plasmid and insert with restrictase, purify both and set up ordinary ligation reaction.
If cloning absolutely fails, the most likely reason is wrong overhangs. In this case overhangs shall be checked by sequencing. The insert can be TA-cloned for this.
And TA-cloning is still another option. It is possible to TA-clone the insert, purify the plasmid and then use this plasmid to transfer the insert from the TA-plasmid to GG plasmid.
  • asked a question related to Colonialism
Question
1 answer
Is there any specific reason that we cannot get the transferred colonies?
According to our methods and protocols, we have done all the procedures of bacterial transformation and used plasmid pUC19 on ampicillin plates, but after overnight and even more days of observation, we cannot see any colonies on the ampicillin plates. We repeated several times but still could not get the target points, which are attached here.
Please provide scientific suggestions and solutions; it means a lot to me.
Relevant answer
Answer
So it is clear that something is not working in your procedure, so you need to do controls and confirmations. The likely things to suspect are:
1) your plates are incorrect (someone added the wrong antibiotic)
2) your plasmid is wrong or there is no plasmid DNA
3) your cells are not competent or are dead
4) you are not following the protocol properly
Most likely the answer is 3, but all should be checked and confirmed until you find the problem.
  • asked a question related to Colonialism
Question
2 answers
Hi,
I am going to do lipofectamine transfection of my plasmid with GOI into HEK 293 and ShSY5Y cell lines. However, I have a question at the colony picking stage. How can this be done, especially if I do not have a microscope like the EVOS inside my hood? Our microscope is big and outside the hood, but I will not be able to pick colonies outside of the BSC because of sterility issues. Has anyone found a workaround to this?
Thanks and Regards,
Mathangi
Relevant answer
Answer
Aaron Dhanda Yes, I was thinking exactly of that! Thank you:)
  • asked a question related to Colonialism
Question
7 answers
I'm trying to purify plasmids from e.coli, the plasmids are high copy. I start with about 1.5ml culture volume, using neb monarch miniprep kit, and rarely get concentrations higher than 20 ng/ul, eluting with ~40ul. I'll outline my steps below:
- - - - - -
I streak out the plasmid containing amp resistant dh5a e.coli on amp/carb (conc.100 ug/ml) lb plates, and grow o/n.
Then I make LB broth containing ampicillin or carbenicillin at (same conc. as plates) and put 4ml of that into a 15ml falcon tube. I inoculate this with 1 fresh colony from the plate.
I then seal it completely with the cap and rotate them in a benchmark rototherm o/n at 37c and 30rpm. This rotates them cap over end and so the tubes must be sealed or else they will leak.
I don't think i have a reliable way to measure OD, but they definitely appear cloudy after about 16-20 hours. I spin down 1.5ml of this culture into a visible pellet and proceed with neb's monarch miniprep kit. At the end I elute with 40ul of neb's elution buffer, or DI water.
- - - - -
I thought maybe the ampicillin I was using had gotten old so I attempted minipreps with fresh ampicillin, and also with carbenicillin in case that would help but hasn't seemed to make a big difference. I keep a 1000x antibiotic stock in the fridge, do these become degraded really quick?
Anyway I'm at a loss of how to improve these miniprep yields, any advice is appreciated,
Thanks
**update:
I've tried larger tubes with more aeration and got way higher cell densities, however the plasmid yield was still less than 20 ng/ul. I have tried qiagen's kit instead and still getting low yield. I am still unsure what the cause is, my next test is to use much higher antibiotic concentrations and make fresh antibiotics. I'm not confident it will help because I've used fresh antibiotics before.
Relevant answer
Answer
You could start with 2ml or in fact 3 ml culture.
Elute using 20ul.
  • asked a question related to Colonialism
Question
5 answers
I did transformation for some plasmid into E.coli and spread it on agar with antibiotics, then i chose a colony and did DNA extraction (with miniprep) and then i ran the gel. for some reason i am not sure what is the sequence of the plasmid but i know it's size, so I am not sure which exact restriction enzymes should i use. when i ran the gels I got some bands at the exact size of the plasmid that i should have (which is 7.3 Kb). is that a good proof that i have the right colony with the the desired plasmid in it? can carry on with my experiments on that?
thank you all
Relevant answer
Answer
I agreed with Katie AS Burnette, "contamination doesn't make a 7.3kb band" magically appear, it might somewhat show a thymine dimmer below the lowest band on the gel. sequencing the plasmid is the best way to determine whether you chose the suitable colony after transformation.
Best of luck brother.
  • asked a question related to Colonialism
Question
3 answers
Our lab recently started S.aureus culture. We inoculated it on agar plate (LB) and everything went well at fisrt (attached file).
However, there was some contanimation (blurred, big colony cover the s.aureus colony) and colony with irregular shape appeared.
We already did the following experiment to find the problem causing contamination:
1. Placed a clean agar plate into incubator, no colony was shown. The incubation should be clean.
2. We conducted experiment under laminar flow hood, by placing an open agar plate in laminar flow hood. There was no colony.
3. By streaking method , we first confirm our bacteria stock was clean. Then picked one colony for further cultivation.
4. The agar plates with contamination (blurred, big colony cover) have strong odor.
The contamination already last for a month. After cleaning the incubator and laminar flow hood, the contamination keep appearing.
Any advice would be very much appreciated.
Thank you,
Ian
Relevant answer
Answer
I support the views expressed by Prof.Dr.Michael J.Benedik.
We are working since 1973 on animal pathogens that are communicable to humans and published over 750 papers.
We always use face mask, aprons, and disposable gloves when working in the Microbiology laboratory.
  • asked a question related to Colonialism
Question
3 answers
Please suggest me why I am not able to get transformants and how can I troubleshoot the problem?
Initially when I transformed and selected on Hygromycin and G418 plate, I got 5 to 15 colonies per plate but now not a single colony I observed after 5 rounds of transformation.
I checked the incubation and heat shock temp.
I prepared the transformation reagent freshly, such as, TE-Lithium Acetate buffer and PEG.
I used DMSO to increase the transformation efficiency.
I maintained proper cell density during the log phase culture.
now what I should try????
Relevant answer
Answer
When I select for Hygro or G418 resistance I plate my transformed cells on YPD first and incubate o/n then transfer with velvet on drug-containing plate. It helps to the cassette to be expressed correctly. In my hands it helps a lot.
Best
  • asked a question related to Colonialism
Question
4 answers
I am trying to do a Site directed mutagenesis and after DpN1 digestion,I transformed the PCR product in DH5 alpha cells and subsequently plated it on kanamycin containg agar plate since my plasmid contain kanamycin resistance gene and performed plasmid isolation from the colonies observed the next day.However after sequencing I got colonies carrying a different gene.I had prepared fresh competent cells and cross checked it by plating on kanamycin plates,so there is no contamination in my competent cells.Can anyone tell how can a bacterial colony carrying a entirely different plasmid with the same antibiotic resistance grow on my plate?
Relevant answer
Answer
Aaron P Landry the sequencing was done using primers based off the plasmid.
  • asked a question related to Colonialism
Question
1 answer
For my Y2H experiment, my yeast gold strain transformed with an empty AD vector (PGADT7) is growing on DDO medium (not growing with empty BD). What could be the possible reasons and how to figure them out?
Relevant answer
Answer
if you wanna help you got to be more descriptive...
  • asked a question related to Colonialism
Question
2 answers
in coral colony is it zooxanthellae count different shaded part and non shaded part?
Relevant answer
Answer
Hi Sahab,
Zooxanthellae densities in coral colonies are very closely linked to areas of calcification. Here are a couple of links to papers that you may find interesting:
Cheers,
Tom
  • asked a question related to Colonialism
Question
2 answers
I am in the process of finding the microbial load of different surfaces. I bring in the sample swab and then incubate it in Nutrient broth for 18 hours at 37C and then I apply dilutions of the broth to 7 differential media. After a 24-hour incubation I count the number of colonies and the CFU. I want to know if calculating CFU after sample enrichment is the correct method or not because when I swabbed my samples without enrichment, I had no colonies on my plates. please guide me forward.
Relevant answer
Answer
The concept and procedure of enrichment before incubating into the media are correct. And there is a standard from ISO 21149:2017Enumeration and detection of aerobic mesophilic bacteria section 4.4(a), and I quote, "Incubation at 32.5 °C ± 2.5 °C for at least 20 h of a defined quantity of the initial suspension in a non-selective liquid medium containing suitable neutralizers and/or dispersing agents".
  • asked a question related to Colonialism
Question
7 answers
Hi,
I am currently working on Gateway cloning as a practice. This is the first time I have ever done this. As a college trainee, the point of this experiment is just for me to get used to Gateway cloning process, hence it is a simple and straightforward experiment.
I had a plasmid, PHIP, with a specific concentration I got beforehand. I carried out PCR to generate attB-PCR product, which was treated with DpnI and purified. At this stage, I had two PCR products, and they were exactly the same; I had an extra in case I might mess up. The next step I did was BP reaction to create entry clones. I got two samples so far, which again were exactly the same. Next, I carried out transformation to collect colonies to then do mini prep and restriction digest to validate. Specifically, in the transformation after adding outgrow medium, I diluted each sample I got with LB broth, meaning I had two plates per sample. For each sample, one plate had 50 ul of transformation mix + 150 ul LB broth, and for the other plate I doubled the amount of transformation mix, which was 100 ul, and then added 100 LB broth. After the incubating stage, out of 4 plates, only two plates had colonies (but each plate only had like 2 visible colonies), and these two plates were the ones with 100 ul transformation.
And then I continued to carry out mini-prep and restriction digest, and it was not surprising that I did not get what was expected, meaning that I did not get the expected entry clones from the colonies and they must have been contaminants anyway.
Any folk that has experience with Gateway cloning, what do you think went wrong? Why did I get a few colonies? And why did the colonies not have the expected entry clones? How can I troubleshoot? I am suspecting that maybe I should not have diluted with LB broth. And there could have been something wrong in the transformation stage like plating. The plates did have the compatible antibiotics, which was kanamycin, hence I don't think it has to do with the plates. I am planning to either confirm the attB-PCR product with restriction digest to see whether I might have done something wrong in the PCR stage or redo the transformation.
Thank you so much
Relevant answer
Answer
Transformation controls are:
  • spread some of your competent cells on plain LB & grow overnight. You should see a lawn. This will tell you if your competent cells are alive.
  • doing a "mock transformation" where you do the heat shock/electroporation, but don't add any plasmid to your cells. Spread on plain LB (no selection) & grow overnight. Again, you should see a lawn. This will tell you if you are doing something wrong during the transformation protocol.
  • using a plasmid that you know has a high transformation efficiency (like pUC18) and transforming that into your cells. Spread on selective media and grow overnight. You should see a LOT of colonies. This will also tell you if the competent cells have high enough transformation efficiency (and if you are doing something wrong during the transformation process).
This will help narrow down the list of possible issues (competent cells, protocol, your technique, etc.). If you can rule out those issues, then the problem is likely with the PCR or ligation steps.
You can do all 3 controls at the same time. Have someone who is experienced in the transformation protocol watch & help.
Good luck!
  • asked a question related to Colonialism
Question
5 answers
For a Product Design project, I will have to play with bacteria and petri dishes but I am a bit scared of how challenging this could become.
Specifically, I would like to isolate bacteria colonies (apparently staphylococcus epidermidis is one of the most common bacteria in human bodies), and find a way to have the biological life survive within an enclosed space. The bacteria should remain dormant until it is exposed to the external environment where it should start thriving.
Any advise on how to create such dormant condition and what would be the best environment for this to happen?
Relevant answer
  • asked a question related to Colonialism
Question
4 answers
Hi all,
I'm working with Gram positive swarming bacteria which have transparent colonies on agar plates (LB/NA). I'm looking for an elegant way to stain the colonies after incubation period or alternatively add some pigmented element to the medium.
Does anyone has a clue?
Thanks in advance,
Adi
Relevant answer
Answer
Try adding surfactants, bile salt to limit swarming and TTC to stain colonies.
I nhibitors of Bacterial Swarming Behavior
  • asked a question related to Colonialism
Question
4 answers
Hello everyone:
I am trying to clone an overexpression construct (gene HVO_2922-CFLAG into vector pTA927,p.chuck).
Insert size=270 bp, vector size=7574 bp.
Enzymes used to digest vactor: NdeI, EcoRI (both fast digest enzymes)
I am sure that amplified product is ok.
There is something wrong at either ligation step or transformation.
I am getting no colonies or few satellite colonies on the plate.
Can someone please guide me where am i possibly going wrong?
Thanks in advance.
Relevant answer
Answer
Michael J. Benedik Thank you for these tips. I am definitely going to try these. I hope it works.
  • asked a question related to Colonialism
Question
3 answers
Hello, I have transformed pcDNA vector into DH5 alpha bacteria and confirmed it with antibiotic test, then I did PCR colony and I also observed the band related to my gene, but after the plasmid extraction, there was no visible band ,and I don't know where the problem might be, please help.
Relevant answer
Answer
Amy Klocko, thank you so much. I'll check the antibiotic and extraction kit.
  • asked a question related to Colonialism
Question
3 answers
Hi everyone!
A little backstory: we have these samples of Staphylococcus aureus that are representative of multiple colonies (we call these pooled samples) and we want to test their susceptibility in the Sensititre GPALL3F assay. We are looking to see if these pooled samples have more AMR genes than single colonies picked off the same plate.
To do this, we figured that growing these up in broth rather than picking the 3-5 colonies would represent the diversity more, as it'll give all of the colonies a chance to grow, not just the random 3-5 I would have picked off if following the protocol for these Sensititre plates.
I was told I would have to do a dilution scheme from this broth, and I wasn't sure where to start because I am subpar at math (pls don't judge)!!!!
Basically, my plan so far is to grow up these samples from a frozen stock to a blood agar plate and passage them twice to ensure optimal growth, then put them into 5 mL of TSB broth and allow them to grow overnight. Here is where I'm not sure about the next steps.
To create the 0.5 McFarland standard, how much will I have to dilute my 5mL sample? Should I do a 1:10 or 1:100 dilution of the staph TSB juice and then put that diluted broth into the Sensititre water? Or will I dilute the 5mL TSB by just putting the stock 5mLs into the water and not diluting it in TSB first? Has anyone tried doing a 0.5 McFarland from the broth before, and if you did, how much TSB did you put in to achieve the proper turbidity?
Thank you so much everyone! I hope this makes sense.
Relevant answer
Answer
Jessie Gu your strategy is fine, although I suggest doing this slightly differently.
If you want to do an inoculum directly from broth to Sensititre assay, I would avoid TSB, since the presence of cations in the media is important for accurate readings of some antibiotics.
Sensititre has their commercial CAMHB buffered with TES and you can use this same broth for the overnight culture of S. aureus. From that, you can use your broth to make an inoculum in DI water (supplied with the system) until densitometer shows 0.5 MFa and dillute as recommended by the Sensititre in their media.
It is important to use densitometer or at least OD600 nm. to reach the CLSI defined inoculum. Too many or too little bacteria will show different MIC values.
  • asked a question related to Colonialism
Question
3 answers
I did a transformation with a Golden Gate ESP3I reaction in DBH5 e coli. However, I got just one colony and it is very different from what I am used to. Instead of a circled format colony, I get a "flower" format. At first I thought it could've been a contamination. However, I looked in the microscope and it looks like a e.coli bacteria.
Relevant answer
Answer
The colony shape can be influenced by how dry the agar plate is as that affects the surface tension which in turn can encourage horizontal growth.
  • asked a question related to Colonialism
Question
3 answers
I am attempted to clone one mammalian gene which is 1095bp in length into pAcGFP1-N1 vector for overexpression study into mammalian system, every time whenever i screen colonies after transformation i got gene specific band but no results after restriction digestion and PCR from plasmid isolated from positive colonies. where i must check the process and what is going wrong here exactly?
Relevant answer
Answer
There are a few possibilities. It could be that the colonies you pick have both plasmids with an insert and plasmids without. So the PCR can detect the rare ones with an insert but the restriction digest is only showing no insert since most the plasmids don't have it.
It could also be that you have the right clone but your restriction digest is not working properly. Is the "plasmid" band you see (I presume you are only getting one band) the correct size for the parental plasmid, or could it be plasmid plus insert sized?
It might also be that you are getting false positives from the colony PCR if there was too much DNA in the transformation and enough was picked up from the plates when you picked the colony.
  • asked a question related to Colonialism
Question
4 answers
Hi, I am currently performing Site Directed Mutagaennesis with a plasmid that I had ordered from Origene. I want to make a mutation, for which I had designed the primers. My primers are 31 bp in length with a GC content of 61.29% and their basic Tm is 68C.
I am following the protocol mentioned below:
25ul Forward/Reverse primer: 1.25ul (10pm/ul)
Template DNA- 100ng
Water- Variable
Q5Mix- 12.5ul
Cycling conditions:
98C- 3 minutes
98C- 30 seconds
54,56C- 60 seconds 16 cycles
72C - 7 minutes
Mix 25ul of Forward and Reverse reactions and add 1ul of Q5 polymerase
Cycling conditions:
98C- 3 minutes
98C- 1 minute
56C- 90 seconds 20 cycles
72C- 7 minutes
72C- 10 minutes
4C- hold
Treat the PCR product with Dpn1 at 37C for 14 hours.
Then I transform 50ul of competent cells with 25 ul of the above reaction next day.
I have performed this protocol 5 times now and still haven’t got any colonies. What should I do?
Relevant answer
Answer
I think you should phosphorylate and ligate your PCR product before Dpn1 digestion.
  • asked a question related to Colonialism
Question
2 answers
Hi all,
I'm trying to clone a very small insert (142 bp) into a large plasmid (12,200 bp) with LTR sequences. I was able to digest the plasmid as well as the the insert purified from a PCR reaction with two restriction enzymes (NdeI and SpeI). To prevent reannealing, I also phosphatase treated the digested plasmid.
Then, I prepared three ligation reactions:
- 3:1 insert : vector
- 7:1 insert : vector
- control with vector and ligase but no insert (background control)
After transforming the ligations in Stbl3 bacteria and streaking I found 1 colony in the control plate, 1 colony form the 7:1 reaction, and 4 colonies from the 3:1 reaction. I proceeded to pick these colonies and grow them in LB with Ampicillin for a few hours before miniprepping the cultures and running the plasmids on a gel. All the plasmids, including the background control, were in the 3-4 kbp range, meaning that I've lost 70% of my original plasmid somewhere in the process.
It looks like the LTR sequences in my plasmid are recombining since they are 3500 bp apart, however I used Stbl3 cells which are specifically used to avoid recombination events. Moreover, I can transform cells with the original vector quite efficiently so the plasmid itself is not damaging the cells.
Has anyone run into this issue before? Could you please advise how I can overcome this problem?
I did the digestion, phosphate removal, and ligation following the instructions of their respective manufacturers. I make sure to degrade the restriction enzymes before preceding to the ligation.
Thank you for your time.
Riccardo
Relevant answer
Answer
With your insert you may want to run it on a gel and perform a gel extraction to remove any traces of the plasmid backbone. You may also want to change the kit type being used for the miniprep as the zeolite filters in the columns are for specific size ranges with larger plasmids becoming trapped in the filter along with the bacterial genomic DNA. If vector digestion is a concern consider longer digestion times eg. 6-8h for the first enzyme and then overnight for the other.
  • asked a question related to Colonialism
Question
1 answer
I am working with Small Cell Lung Cancer (SCLC) cell line H82. It's colonies are formed in suspension form in the form of clusters. My question is how will I know that it's now the right time to subculture my cells? How to count my cells? Also, how will I know whether the cells are dead or alive?
Please guide me.
Relevant answer
Answer
How will I know that it's now the right time to subculture my cells?
Cells in suspension should be passaged when they are in log-phase growth before they reach confluency. When they reach confluency, cells in suspension clump together and the medium appears turbid when the culture flask is swirled.
How to count my cells?
Collect the cells when they are in log-phase growth before they reach confluency, and centrifuge the cells at 1500 rpm for 10 mins. Discard the supernatant, tap the cell pellet, and add 1ml growth media. Pipette the cell suspension up and down few times to obtain single cell suspension. Take 10ul of cell suspension into a microfuge tube which already contains 10ul of trypan blue dye. Mix well and take the cell count using hemocytometer.
How will I know whether the cells are dead or alive?
You will have to use the trypan blue exclusion test to check the percent viability of your cells. In this assay, trypan blue stain is used to stain the cells. This dye trypan blue is a diazo membrane-impermeable dye that selectively stains dead cells. The dye can pass the membrane of a dead cell, but not a viable cell's intact membrane. Once diffused inside, trypan blue binds with intracellular proteins to give an overall bluish color. The stained cells which you will count using the hemocytometer will be the dead cells. You can then calculate the percentage viability of your cells before you subculture.
Best.
  • asked a question related to Colonialism
Question
12 answers
I am looking for a way to preserve my fungal colonies that grew on PDA already. Something similar to bacterial glycerol stock. I appreciate your help.
Relevant answer
Answer
We would put agar plugs in 25% glycerol and stick them in the minus 80. I will say that 25% is not appropriate for all species. I would test a range between 10% and 25% to see what gives the best recovery rates.
  • asked a question related to Colonialism
Question
3 answers
We performed transformation on Saccharomyces cerevisiae, where we introduced a gene mutant library (roughly 14 mil. mutants). Because of the high transformation efficiency, many colonies appeared and created a lawn (the attached picture displays 1 out of 20 transformation plates).
It is very important to be able to calculate the exact transformation efficiency in order to estimate the size of the library.
Does anyone know a way to count the cells despite the 'lawn' formation?
Also, does anyone have any suggestions on how to stock the library?
(could it be as simple as scraping all the cells of the plate and making a glycerol stock?)
Thanks a lot for your help!
Relevant answer
Answer
How do you get such high transformation efficiency of Saccharomyces cerevisiae? Can you share your experience?
  • asked a question related to Colonialism
Question
3 answers
Hello,
I'm trying to create a mutation with the kit. In the first picture, 8 different colonies have PCR results for Sanger sequencing and the band size I expected, but as you can see in the second picture, there is confusion. I did exactly the same things, the only difference is that I made the DPN1 cut in the first picture after the transformation, this time I did it before transformation. That's what PhD told me to do, it didn't make sense, and the result is obvious. What should I do now? Is it okay if I send these samples to Sanger sequencing? My primers don't bind anywhere in nature, they just bind to my plasmid, and the plasmid was made from zero.
Relevant answer
Answer
It is hard to predict whether there will be a problem for your Sanger sequencing or not, but I would go ahead and try. If you find that some are the mutants you wish, then reconfirm carefully your plasmid to be sure it looks right by digestion (correct size, correct insert etc)
  • asked a question related to Colonialism
Question
4 answers
I have done a few transformations using homemade BL21 (DE3) and used an auto-induction medium to culture the cell at 37C for 24 hours, weight out 20mg wet weight of cell pellet lysate by sonication in PBS. Running an SDS page using Bolt™ 4 Bis-Tris gel. No sign of protein overexpressed.
I am new in that field and have a lot of questions.
Not confident with the transformations, how can I know the colony I pick is not just a cell naturally resistant to antibiotics or is a continmation?
The reason I ask is that I have failed the transformations many times and sometimes it succeeds with the exact same protocol for no reason.
Should I always see some sign of expression from the whole cell lysate SDS page when using the e.coli cell as host? I have done 8 different plasmids, and one of them shows a low mass protein which is not the mass of my protein.
Attached is the SDS page of 8 different transformed cell lysates, the ladder is page ruler plus, running buffer is MES.
Relevant answer
Answer
Muhammad Israr It was 20mg (wet weight) of cell lysate, as it wasn't purified and have no idea of the expression level. No ideas of protein concentration but I was expect I could have a band slightly different with the other protein when using e.coli cell as host.
  • asked a question related to Colonialism
Question
2 answers
During bacteriological analysis of water and sediments from pond shrimp I have seen black round colonies grown on TCBS and TSA supplemented with 2.0% NaCl
Relevant answer
Thanks Jamaica Aranas Caras Jamaica Arana Caras ita a good answer
  • asked a question related to Colonialism
Question
1 answer
Hi:)
I'm researching on encapsulation of bacteria, and I am struggling with calculating encapsulation efficiency.
How can I apply gram of capsule and dilution factor on calculation?
In my case, I use these formula.
- Liquid sample (bacterial solution, which means before encapsulation)
Log CFU/mL=Log(colonies * 10^dilution factor)
- Solid sample (encapsulated bacteria)
Log CFU/g=Log[{colonies *(Sodium citrate(mL)+sample gram) *10^dilution factor}/sample gram]
Ex) Capsule 0.1 g + Sodium citrate 0.9 mL
Log[{colonies * (0.9 + 0.1) * 10^dilution factor}/0.1]
When I calculate along these equation, the encapsulation efficiency is over 100%.
Could you please let me know how to calculate the number of cells during encapsulating process?
Relevant answer
Answer
Hi,
Usually this is the formula used for bacteria encapsulation :
- Colony - for g unit (CFU mL) = Average number of colonies / (Dilution factors * volume plated)
- encapsulation efficiency (%) = (N/N0) *100
with N is the number of entrapped cell counts (CFU/g) released from the microcapsules and N0 is the number of free cells (CFU/mL) in culture.
hope that this helps,
Regards,
Chanez BENNACEF.
  • asked a question related to Colonialism
Question
3 answers
Hello colleagues,
I am planning to transform pRC vector into DH5alpha E.coli (C2987H NEB). One of the protocol steps requires to perform several serial 10-fold dilutions of the bacteria before plating (see image). What is this step for? Is this step necessary? If bacteria are so concentrated, can I split the vial into two parts for each plasmid I am propagating? Would I have too many colonies if I do not perform the serial dilutions?
Thank you.
Regards,
Maria
Relevant answer
Answer
In general you can get away with just pipetting less of the culture onto the plate. I typically use 150ul or 50ul. The next day if the plate is overgrown I then dilute by the approximate order of magnitude.
  • asked a question related to Colonialism
Question
4 answers
All the steps of Cloning were carried out carefully, including positive colony selection. The colonies appear successfully in LB (ampiccillin-containing) plates and almost no colony in negative control plate. After performing mini-prep, the concentrations of ligated vector samples vary to some degree. But the real problem occurs when enzyme digestion is performed, the corresponding bands to vector and insert are not observed, meanwhile PCR results show the correct band of the insert. Also, sequencing with these obtained results definitely tend to fail. How can I solve this issue and which step might be wrong?
Relevant answer
Answer
Colony PCR has a very high false positive rate due to the excess insert used in transformation. Re-streak any potential positives on a new plate (LB + amp) and grow a quick liquid culture (LB + amp) to use for colony PCR.
My bet is that these are false positives. "Almost none" on your control plates is not the same as "none". That means you either have contamination or the selection isn't strong enough.
Check that your ampicillin isn't expired.
Good luck!
  • asked a question related to Colonialism
Question
3 answers
I want to isolate fusobacterium nucleatum from colon biopsy from CRC patients. I did PCR for molecular detection, but I have problem in isolating the bacteria using selective media. I used Columbia Blood agar+ EVN antibiotics, I also tried with FAA blood agar, but I cant obtain pure colonies. However, I have very nice microscopic pictures of bacteria (Long fusiform bacilli), but I observe other shapes after sub culturing the same colonies. I dont know how can I gain the pure colonies with the the same shapes.
Appreciate your answer......
Relevant answer
Answer
I done PCR for the tissue biopsies after DNA extraction and using F. nicleatum primer , not for bacterial culture
  • asked a question related to Colonialism
Question
2 answers
I extracted gDNA from various bacterial colonies and ran the samples through a 0.8 % agarose gel. I viewed it in gel doc. I've attached the image to this message. Can any one explain me why I'm getting these smears and bands and how I can fix it? I also checked the DNA quality and quantity with nanodrop. The DNA concentration in smeared samples is greater than 600ng/uL.
Relevant answer
Answer
A high concentration of gDNA would cause smearing.
In order to obtain a higher resolution image, you may:
1. Purify the gDNA using a purification kit -> however, this may result in concentration loss
2. Apply less DNA (~20ng is fine as well.)
Hope it helps!
  • asked a question related to Colonialism
Question
4 answers
In short, I am trying to get a clone of 1664 bp insert in a mammalian expression vector (Size of vector is 6250 bp) by using NEBuilder HiFi DNA assembly Cloning kit with commercial Comp cells provided with the Kit. I tried this strategy three times and all got failed while I got huge number of colonies in positive control provided with the kit. Firstly, I am explaining a bit about the primer I designed for this strategy. I designed the primer based on the region where I want to put insert in vector. In vector primer sequences, I kept overlap for insert while In insert primer sequences I kept overlap for vector. I am providing primer sequences here
Vector Forward: CACCACCCTTCTCTTCCTGAATGGCCCCAGGCATCTGCC
Vector Reverse: CCATCCCCACCTGCCAAGATCTTGTCATCGTCGTCCTTG
Insert Forward: CAAGGACGACGATGACAAGATCTTGGCAGGTGGGGATGG
Insert Reverse: GGCAGATGCCTGGGGCCATTCAGGAAGAGAAGGGTGGTG
After this, I followed this strategy for cloning and transformation according the manual provided for HiFi Assembly kit. I am getting huge numbers of colonies in positive control while I am not getting a single colony of my sample plate. I also run ligated product on the gel and it seems that ligation is happened. I am attaching its gel image as well as transformation result of positive control.
Could, someone help me out here that why I am not getting any colony of my sample. Thanks in Advance!
Relevant answer
Answer
If the primers sequences are designed right, then there is a chance that there is some problems with the primers you received from the company themselves (few bp mismatch for example). If you already tried optimizing the vector:insert ratio or increasing assembly incubation time (up to 4hrs), then you might consider order the new primers set and try again. Good luck!
  • asked a question related to Colonialism
Question
1 answer
What can be the alternative chemical to TTC for morphologically differentiating bacterial colony on solid medium based on colouration.
To do and promote research at low budget college/institutions such alternatives are very important.
Relevant answer
Answer
TTC is best and cheaper also sir, it is biologically safe and differential staining krta hai, means sabko alag alag stain karta hai. canada balsom sabko ek hi colour karta hai
  • asked a question related to Colonialism
Question
4 answers
Recently, as a result of an increase in water temperature and a decrease in the concentration of dissolved oxygen in the water, whitening of corals has been recorded (death of algae in the symbiosis of algae and polyps). Why have colonies of algae colonized coral reefs in the Red Sea in recent years? What is the reason for this contradiction?
Relevant answer
Answer
I think the most important thing to consider is the type or species of algae colonising those coral reefs and the optimal growth conditions. Some (especially tropical) algae are highly invasive and can withstand highly hostile conditions. Moreover, corals are sensitive to the slightest changes in their environment.
Perhaps, the thriving species are invasive one that have been introduced through the common pathways, such as ships, accidental discharge and fishing gear.
Or maybe, the situation is similar to terrestrial weeds vs flowers or vegetables in a garden or farm. There is not only competition for nutrients; the death of the corals could be contributing to the aggressive growth of existing algae in the Red Sea.
  • asked a question related to Colonialism
Question
1 answer
We have a pBluescript vector (expressing X-gal) and we clone with TA cloning inserts, using it as a level 1 vector. Although picking white colonies from the plate, we do make restriction digestions of the pDNA extracted and the pattern is wrong (not always as empty vector). We do have sequenced the vector and is correct. Does anyone have any ideas? Thank you!
Relevant answer
Answer
1. Are you checking the PCR products on a gel to see if there's one prominent band? If not you might just be cloning in incomplete/off target products.
Smaller fragments stain less brightly on agarose gels and in general ligate in easier than bigger fragments so even a band that looks 0.25x the brightness of your intended product could potentially be significant.
2. Are you cleaning up the PCR product after it's generated?
Primer dimers/small aborted extension products/nucleotides can actually clone into TA/TOPO vectors.
3. pBluescript has a high copy number and your insert could potentially be toxic.
At high enough copy numbers even inserts that are normally non-toxic can become problematic and this will select for clones with indels, transposon insertions, etc.
4. Sometimes blue/white screening also gives false positive clones because the X-Gal isn't even across the plate or a clone grew a little too fast to accumulate much blue product, or the concentration is low. Putting them in the refrigerator for a day or two can help identify false positives. I've definitely had "white" clones that turned faintly greenish-blue after storage at 4°. This is more of a "background vector" problem though.
  • asked a question related to Colonialism
Question
1 answer
I am having difficulty in obtaining transformants, the positive control plasmid pKLAC2(malE) was prepared for transformation and only small colonies were observed. These did not secrete malE protein. I am worried that my competent cells are bad and I am reaching out for any tips, tricks and advice that you might have for me to determine if they are good or not. I will try to summarize my concerns, observations and questions. Q1: Are transformants on YCB (yeast carbon base) + acetamide (sole nitrogen source) expected to grow similarly to K. lactis on rich media? Even when I plate a very small volume of the transformation reaction, I get >300 small (0.1 mm) colonies after 24 hours. They proceed to grow slowly and I am aware that untransformed cells have weak acetamide degrading ability. I have subcultured a few select colonies and they grow fine on YCB + acetamide, albeit half as well as colonies growing on rich PDA media. They must not be transformants? Q2: Untransformed cells appear to be growing better than they should be....could it be possible that impurities in agar could be supplying nitrogen for growth? Small colonies after 24 hours can't be normal but I can't determine what is weakening the selection method. Or selection by acetamide is not as selective as I thought. Q3: After adding the transformation reagent to competent K. lactis cells, they remain in small (0.1 - 0.4 mm) visible clumps and aggregate. Is this normal? The solution never quite reaches a uniform turbidity, even after the incubation, heat shock and recovery steps. Q4: Unrelated question, galactose wouldn't go bad would it? I have a bottle from at least 30 years ago. I know that glucose has an indefinite shelf life (pretty much) but I'm not certain if "bad" galactose would explain the absence of protein expression.
Relevant answer
Answer
You should compare colony numbers between your selection plate and a rich media plate inoculated with the same volume from the transfection. If numbers are similar your transfection has failed.
Depending on your rich media you should find that there is always a slight reduction in growth on poorer media.
Any of your reagents could be contaminated. Could even be nitrogen fixing bacteria if any of your powders got damp.
If kept dry the galactose should be fine if not exposed to sun light.
  • asked a question related to Colonialism
Question
4 answers
I got transformed E.coli plates and I isolated plasmid successfully from this. But when I laid a new plate from the Glycerol stock (stored in -80 degrees) of colonies from same (previous) plate, I got comparatively smaller colonies and was not able to recover plasmid from that. Can anyone suggest what could be the possible error?
Relevant answer
Answer
  • asked a question related to Colonialism
Question
6 answers
Hello everyone,
I want to know what should be the optimum incubation time for ligation? In our lab, we are using Thermo Scientific™ Rapid DNA Ligation Kit Catalog number: K1422 for ligation, the datasheet of the respective kit says to incubate the reaction mix at 22°C for 5 min. Although I have done ligation followed by transformation once at 22°C for 1hr as suggested by our senior members. But there were no transformed colonies?
Relevant answer
Answer
Hi Pooja, it completely depends on how well you have prepared and stored the competent cells. If it is stored at minus 80 it could be used for the long term, so one month shouldn't be a problem if they are normal E.coli competent cells.
  • asked a question related to Colonialism
Question
3 answers
Hi!
I'm in the initial phase of my PhD in aquaculture and this is the phase of isolating the bacterial strain that I'm going to work with. I'm trying to isolate a bacteria (Rubrivivax gelatinosus) from the water in Pfennig media, but my sample is contaminating with different fungi strains. Do you know which antifungal I can add to the culture medium to purify my bacterial strains?
Relevant answer
Answer
Hi!!!
In my research i used chloramphenicol to prevent unwanted fungal and bacterial growth and u can also use cyclohixamind
  • asked a question related to Colonialism
Question
6 answers
I have used the following factors,
1.7kv/cm , 25uF and 200 ohms, in biorad gene pulser electroporator.
Should the colony morphology change after transformation?
Please help. Also what should be the ideal cell density for electroporation?
Thanks.
Relevant answer
Answer
I am curious if you have a protocol that eventually worked
  • asked a question related to Colonialism
Question
6 answers
Guys, I just got a problem with my colony PCR. The DNA template I used is ~1.3kbp and it's cDNA in a plasmid with AmpR as my supervisor said. (There is not enough of this DNA template so I want to replicate the plasmid to get more)
So I just transformed the DNA template with about ~29ng into 100 uL Top10 competent cells.
Then I spare it on an Amp+ LB plate and incubated the plate overnight.
On the second day, I got a lot of colonies. I performed a colony PCR with a positive control (from the exact same tube of the template for transformation). I picked the colony by using 10 ul pipette tips to touch and swirling a little bit and placing them into corresponding tubes. And then I pipetted the tips in the pre-mix added in the tube and swirled a bit.
But all I got is positive control and there is no band in the 18 colony sample lanes.
Relevant answer
Answer
Shibo Bai the number of cycles are enough. true you just need to confirm you placed the colony properly in to the tube. better to put the colony first with sterile toothpick or pipette tip in to the bottom of the tube, then add your master mixture.
  • asked a question related to Colonialism
Question
1 answer
I inserted a 1.8kb DNA fragment into a 14k vector by T4 ligation, but There weren't many colonies. What should I do to improve the number of colonies?
Relevant answer
Answer
Dear Chen,
Before going further, can you explain what bacterial/yeast/microorganism you used for the transformation? and is there any particular reason to use a plasmid that big? In my opinion, for cloning purposes pUC plasmid is give excellent result also pET vector for protein expression
  • asked a question related to Colonialism
Question
4 answers
I am in process of cloning, after colony PCR, whenever i inoculate the liq culture (5ml 2YT+15ul Amp) with a streak of colony from plate, i always get low yield of plasmid like below 80ng/ul.
Where am i going wrong, time duration, amount, etc?
Relevant answer
Answer
use fresh bacterial colony for overnight, No more than 16h for o.n , payattention at setp 3 of plasmid extraction (neutrilization) very quick mixing and finally use warm water or elution buffer for elution and you can repeat this step . Good luck
  • asked a question related to Colonialism
Question
2 answers
Honey bee algorithm uses particles to mimic actual honey bees; annd I preferred it because:
Although other species of bees are five to ten times more efficient, on a per-bee basis, at pollinating certain fruits, honeybees have bigger colonies, cover longer distances, and tolerate management and movement better than most insects. They're not picky - they’ll spend their time on almost any crop.
Relevant answer
Dear Prof. Аабу Абед ,
I have two papers related to this valuable subject:
Here are some from the first paper:
  • The differentiation between honeybees’ behavior and computer also attracted hundreds of researchers in proposing some artificial intelligence algorithms used to solve many real-life problems. The researchers found these bees live in groups called colonies where each bee colony, also referred to as hive, has at least three well-known subgroups of bees: scout bees that responsible for searching for the new food sources (i.e. solutions) which are the flower nectar, onlooker bees which knew the amounts and determine the exact places of any food source by watching the dancing ways of the scout bees, and the employed bees which are responsible for gathering the food from the resources' places that are defined by the scouts. They also found the members of each group (i.e. colony), as well as the subgroups, have their own structure for the working tasks and dominance hierarchy. [31][29]
  • By studying the behaviors of these colonies especially how all the bees contribute together in generating the optimal solution of the nectar harvest, the research work held by Saab et al. (2009) introduced a novel and valuable optimization algorithm based on using the Artificial Bee Colony (ABC) optimization. With the condition that the probability of choosing any candidate solutions (i.e. flower nectar as the food source) is directly connected with the fitness function (i.e. nectar's amount, nectar's quality, and the distance between the colony and the food’s source), the importance of their algorithm in the real-world is its ability to balance between the two searching phases exploration and exploitation in the searching iteration steps around finding and reaping the flower nectar. For a more detailed explanation and illustration of this algorithm, the interested reader can refer to the mentioned paper. According to the real implementations of the two scenarios of scouting and forging processes, this algorithm can be used to employ many real-life optimization problems that don't demand supervision which includes, but are not limited to, the following examples: combinatorial optimization problems, stochastic problems, multi-targets, data-mining-search-engine crawling, parallel implementation, multi-targets, and parallel implementations. [31]
  • asked a question related to Colonialism
Question
6 answers
I have tried the transformation of this plasmid in different strains of E. coli (Stbl3 and DHQ5-alpha) with different protocols but I didn't get the transformed colonies. Once after the transformation in DHQ5-alpha strain, I got the colonies but after isolating the plasmid from those colonies when I checked it on agarose gel, there was no band for the plasmid. Even after increasing the ampicillin concentration, colonies were visible on the plate but the problem remained the same as I didn't get plasmid bands. I guess there is some problem in transformation. Please help me troubleshoot this issue.
Relevant answer
Answer
Thanks, i will try these and then revert back, may be with the positive results 🤞.
Wish me luck.
  • asked a question related to Colonialism
Question
9 answers
Hello,
I am supervising a PhD study on water and irrigation in Egypt. To submerge in the context I would like to read a good environmental history book about Egypt and the Nile covering the period 1800-2000s.
Some books I already found:
Jennifer Derr (2019) The Lived Nile: Environment, Disease, and Material Colonial Economy in Egypt
Alan Mikhail (2017) Under Osman's Tree: The Ottoman Empire, Egypt, and Environmental History
What is your recommendation, and why?
Thanks in advance for your time to read and answer this question!
Kind regards
Chris Seijger
Relevant answer
Answer
I don't think you will find all the information you are looking for in a single book. You have to look for the subjects one by one to get the old and the new.
The Delta. past and present. Archaeological remains?
The Nile since its birth with the problems of sharing, the health issue and its impact on agricultural life in the past and today.
The Aswan dam which solved the problem of floods but created problems on the environment.
The demographic question of Egypt. Egyptians live from the Nile, on the Nile without using the Mediterranean Sea sufficiently, etc…
  • asked a question related to Colonialism
Question
5 answers
Hello all,
I have been trying to transform my plasmid ~10kb in comptent E.coli DH5a cells for the past one and a half months by heat shock method but haven't been able to get a single colony. I am doing transformation by the standard protocol i.e., by thawing competent cells (50ul) on ice in microfuge tubes, adding around 5ng of plasmid, incubating on ice for 30 mins and then giving a heat shock at 42°C for 90 seconds in a water bath (also tried giving heat shock for 40 seconds) and then putting cells on ice for 5 mins again. After that I added pre-warmed 1ml LB and kept them for 1hr in shaking incubator. Then spreading it on amp+ plates with a conc. of 100ug/ml.
I can't understand what am I doing wrong. I always prepare fresh ampicillin stock for my plates and made competents cells many times by CaCl2 method but never have been able to get colonies. Can someone guide me regarding this?
Relevant answer
Answer
Thankyou all for your valuable suggestions. I tried electroporation and it worked.
  • asked a question related to Colonialism
Question
2 answers
I'm studying three different species of bees (16 colonies) and comparing data on feed consumption, honey production, and pollen cell production. However, because the colonies I'm looking at all have different numbers of bees, will this affect the results of my data, and if so, is there a way to make the results more even and accurate?
Relevant answer
Answer
To carry out a inferential statistical test even groups isn't required. You can use dunnett's test for unequal variances and fisher test for equal variances.
  • asked a question related to Colonialism
Question
8 answers
Doing SDM, getting PCR but not getting transformation colonies. What could be the issue? Comp cells are fine when used control.
-PCR: 10 cycles (40ng plasmid template), Can See right size PCR band on the gel.
-PCR digestion with DPN1 (1ul 2hr)
-Heat Inactivation 72℃ for 20 min.
-For transformation 0.5, 1, 5, 10 ul of above mixture in to 30ul of JM109 competent cells Kan+plates. (Control plasmid total 10ng in 1ul volume for 30 ul cells(same) gives colonies)
So no colonies on SDM mixture. What could be the issue?
Relevant answer
Answer
OK!! of course it is not possible to see the template plasmid. The PCR product is a circular DNA with two "nicks' at the 5' ends of the oligo; I don't know how it will run on a gel, not sure that it will run as a linear DNA (it got sticky ends the size of the oligos) . I think you have to look at the design of your oligos, maybe makes longer ones) do you have repeated sequence in your plasmid? ... good luck with your mutagenesis
regards
  • asked a question related to Colonialism