Cleaner Production - Science topic

Dear experts, authors, professionals and professors, I cordially invite interested professionals to contribute in the next issue. Important Dates: Submission Deadline: June, 1, 2024 Reviewers Feedback to Authors: 10th June 2024 Revised Submission Deadline: 15 th June 2024 Final Decision: 20th June 2024 Publication Date: July 2024 Important Notes: 1- Before submitting your content, please check the Author Guidelines ,Ethics,.... from the webpage of QOR Newsletter Here is the link: https://organizationalexcellencespecialists.ca/newsletter/ 2- Communication related to the newsletter should be directed to the Editor, Mohammad Hossein Zavvar Sabegh, Email: mohammad@organizationalexcellencespecialists.ca / quality20zavvar@gmail.com 3- The scope of QOR Newsletter includes: Leadership and Management, Operational Research, Excellence Models and Challenges in Digital Era, Industry 4.0 and Quality 4.0, The Future of Quality and Organizational Excellence, Continuous Improvement, Quality Management and Innovation, Quality and Risk Management, Customer Satisfaction, Quality Standards, Quality Systems, Supply Chain Quality Management, AI and Quality, Lean Six Sigma, Operational Research and Smart Cities, Project Management, Smart Optimization, Machine Learning, Big Data Analytics, Digital Process Operation, Robotic Process Automation, Supply Chain Management, Optimization Theory and Applications, Climate Change, Cleaner Production, Circular Economy. 4- The content of QOR Newsletter includes: Papers and opinion articles on quality, excellence and operational research; insightful reviews about publications; important events such as conferences, workshops and webinars; success stories about projects; calls for a chapter or paper; book announcement, introductions to new technology; career opportunities with potential employers and resumes from prospective employees.

5- Author-guidelines attached. Kind regards, Mohammad Hossein Zavvar Sabegh, Editor at QOR Newsletter https://organizationalexcellencespecialists.ca/newsletter/

Dear Colleagues, It is our greatest pleasure to announce the launch of a Special Issue of Cleaner and Circular Bioeconomy (CLCB) from Elsevier, entitled "Towards Carbon Neutrality in the Bioeconomy." The submission period is from 15 February 2024 to 15 September 2024. This special issue aims to explore both theoretical and practical solutions that can effectively lower the carbon intensity of the bioeconomy. Potential approaches include introducing sustainable agricultural practices; optimizing biomass production; minimizing waste in agricultural and forestry operations; promoting recycling and reuse of biomass; enhancing energy efficiency in processing and converting biomass into biofuels, bioenergy, and other bioproducts; utilizing renewable energy sources like solar, wind, and hydroelectric power; implementing Carbon Capture and Storage (CCS) technologies in bioenergy production; and conducting Life Cycle Assessments (LCA) to fully understand the environmental impact of bio-based products and processes. Additionally, implementing public policies that encourage greenhouse gas (GHG) emission reductions in the bioeconomy, such as carbon pricing, subsidies for sustainable practices, and regulations promoting low-carbon technologies, can also be effective. For more information, please refer to: https://www.sciencedirect.com/journal/cleaner-and-circular-bioeconomy/about/call-for-papers#towards-carbon-neutrality-in-the-bioeconomy CLCB (ISSN: 2772-8013) is an international, cross-disciplinary companion journal to the prestigious Journal of Cleaner Production. It publishes original full-length research articles, perspectives, and reviews aimed at fostering a cleaner and more circular bioeconomy. Additionally, it is free to publish since CLCB is currently waiving all publishing costs for articles published in this special issue. We thank you for your attention and look forward to hearing from you. Please spread the word around you. Arnaud Z. Dragicevic, Chulalongkorn University, CIRANO Florent Allais, FRSC, AgroParisTech, URD ABI - AgroParisTech Guest Editors

Hello,

Can someone kindly help me to download the supplementary data file from the paper published in Journal of Cleaner Production.

I could not find the position where the supplementary file is actually located in the website.

There is a note in the article which is "Supported information associated with this article are available free of cost at website"

Thank you for your time

With regards,

Waheeba

Sugarcane filter cake is one of the sugar industry waste which produce in a large quantities and has a potency to process as a biomass. What is the future idea for the utilization of sugarcane filter cake in industry?

Is it possible to download the "Appendix A. Supplementary data" of the article "A multi-objective optimization model for decision support in water reclamation system planning" from the "Journal of Cleaner Production" and from where?

The editor of Journal of Cleaner production referred my paper to Journal of Cleaner Waste System which is a partner Journal. It is a new Journal with only one issue published and no information regarding IF, H-factor etc. The email says the article will be indexed by SCOPUS. Is it worth publishing there?

Research within the environmental science is pretty interesting and practical in nature. The journals focusing on environmental studies often have very high impact factor compared to other journals in social sciences. What is the secret?

I have just seen two media treatments at the Nobel speech of O. Tokarczuk (Nobel Prize in Literature 2018):

1. Reprinted speech with underlined fragments

2. Article entitled: three words to remember from speech: "I am", "myth" and "tenderness"

I consider such media practices as an example of generating modern intellectual slavery because: (1) the media suggest learning selected content by heart instead of initiating a discussion of these fragments, (2) the media skip other fragments and the context of all speech (3) the media put themselves in the position of hierarchs of ready-made unquestionable values ​​and the auditorium in the position of someone ... (4) the media does not give the auditorium any benchmark or tool for independent analysis.

I think the role of an intellectual or leader is to give the auditorium (auditoriums) tools for independent analysis/use.

For example, if we use the metaphor 'art is a tool' (Ernst et al 2016) for analysis of the speech, we will obtain our independent result.

Consequently, the scientists' task is not only to do empirical research and suggest theorie, but also to identify and suggest methodological metaphors to immunize/empower the auditoriums against the above-mentioned practices.

 What do you think about this?

Literature:

Ernst D, Esche Ch, Erbslöh U (2016) The art museum as lab to re-calibrate values ​​towards sustainable development. Journal of Cleaner Production 135: 1446-1460

The European Parliament has approved a ban on single-use plastics by 2021. Currently there is a growing concern about the environmental and health issues caused by plastic and micro (nano) plastics wastes. This ban approved by the European Parliament means a scientific and economical challenge for both plastic industry and society in general, so I would like to discuss some points about it with the RG community.

Which could be the best replacement materials / products or perspective to adopt on the single-use plastics issue, which nowadays are everywhere in the daily life? Are we scientifically / technically prepared for these changes? I also would like to know if there are new proposals to deal with this challenges, and of course, deal with the existing contamination of plastics and micro (nano) plastics.

How to perform a power analysis to calculate the sample size for a change between two periods between control and treatment group (Dif-in-Dif)?

Butt, U. M., Letchmunan, S., Hassan, F. H., Ali, M., Baqir, A., & Sherazi, H. H. R. (2020). Spatio-Temporal Crime HotSpot Detection and Prediction: A Systematic Literature Review. IEEE Access, 8, 166553-166574.

This paper was published on the 8th of September 2020. The authors state in the abstract:

“The authors were unable to find a comprehensive study on crime hotspot detection and prediction while conducting this SLR. Therefore, to the best of author’s knowledge, this study is the premier attempt to critically analyze the existing literature along with presenting potential challenges faced by current crime hotspot detection and prediction systems.”

Below I enlist relevant papers omitted by the authors, including our SLR paper of the same scope:

1. Kounadi, O., Ristea, A., Araujo, A., & Leitner, M. (2020). A systematic review on spatial crime forecasting. Crime Science, 9(1), 1-22. https://doi.org/10.1186/s40163-020-00116-7

2. Hardyns, W., & Rummens, A. (2018). Predictive policing as a new tool for law enforcement? Recent developments and challenges. European Journal on Criminal Policy and Research, 24(3), 201–218. https://doi.org/10.1007/ s10610-017-9361-2.

3. Seele, P. (2017). Predictive Sustainability Control: A review assessing the potential to transfer big data-driven ‘predictive policing’ to corporate sustainability management. Journal of Cleaner Production, 153, 673-686. https://doi.org/10.1016/j.jclepro.2016.10.175

I wonder whether you can do a thorough review circle from submission to acceptance in 7 days and if incorrect information should be corrected.

Finally, what is the opinion of the authors and the Editor-in-Chief on this matter? We asked for it but received none.

Have you ever wondered about time-loops? How is it possible to publish a paper today that is published in December 2020? Have a look at the Journal of Cleaner Production. The issue in progress is the issue of December 2020. https://www.sciencedirect.com/journal/journal-of-cleaner-production/vol/277/suppl/C

It is announced that "This issue is in progress but contains articles that are final and fully citable". The Journal of Cleaner Production is not an exemption. Have a look at the Total Science of the Environment. https://www.sciencedirect.com/journal/science-of-the-total-environment/vol/747/suppl/C

or at Ecological Economics https://www.sciencedirect.com/journal/ecological-economics/vol/178/suppl/C

Always the same pattern.

How does this practice potentially affect the Impact Factor and why might this be considered as manipulation? Already in 2012 there was a paper published raising the issue of time loops as a way to manipulate IF. See https://www.researchgate.net/publication/266618323_Academic_publishers'_time-loop_Another_mechanism_to_manipulate_impact_factors

Sure, if you know how IF are calculated (https://en.m.wikipedia.org/wiki/Impact_factor) a possible manipulation is quite likely.

According to my knowledge most publishers stopped the practice of time-loops, except some major Elsevier journals. Due to modern publication technology time-loops can’t be justified on any kind of technological or workflow argument!

What is your opinion on this issue? Does it deserve further investigation?

Social innovation is a concept associated with changes that organizations develop and implement to primarily address pressing social needs (Silvestre & Tirca, 2019). Social innovation is a key driver for social change (Cajaiba-Santana, 2014) that derive from the intrinsic desire to resolve/attenuate existing social problems, instead of a marketing mechanism to make firms to sell more (Morais & Silvestre, 2018).

With this in mind, we are willing to enhance the debate on how we can advance the social innovation field from the theoretical, practical and policy stand-points. That is, what are the key issues/challenges on SOCIAL INNOVATION that research still needs to address?

REFERENCES:

Cajaiba-Santana, G. (2014). Social innovation: Moving the field forward. A conceptual framework. Technological Forecasting and Social Change, 82, 42-51.

Morais, D. O., & Silvestre, B. S. (2018). Advancing social sustainability in supply chain management: Lessons from multiple case studies in an emerging economy. Journal of Cleaner Production, 199, 222-235.

Silvestre, B. S., & Ţîrcă, D. M. (2019). Innovations for sustainable development: Moving toward a sustainable future. Journal of Cleaner Production, 208, 325-332.

In the 21st century, various solutions based on ecological innovations, renewable energy technologies, green economy, clean economy, reclamation of secondary raw materials, etc. should be developed. This way, added value can be generated based on the synergy achieved in parallel, mutually supporting processes. In this way, this kind of ecological added value can help to create a new economy in the future based on more sustainable development.

In view of the above, I am asking you: How can you describe, explore and measure the ecological added value resulting from the synergy of pro-ecological activities ...?

Please, answer, comments. I invite you to the discussion.

To minimize the pollution impacts of the old dirty economy only model on the environment is the goal of green markets to ensure environmental sustainability and addressing the economy polluting problem of the dominant non-renewable energy based economy.

But what would be really best for environmental sustainability would be a dominant, if not fully, renewable energy based economy.

Therefore, clean economies would be better than green economies in environmental sustainability terms. But the need to transition to the clean economy is not mention in millennium development goal # 7; it only has goals to reduce pollution, to increase renewable energy sources apparently as complements, but not goals for planning for as transition from green economies, still a partially dirty economy, to clean economies and have clean energy as permanent substitue for dirty energy..

Why neither of the 17 sustainable development goals including SDG #7 are capturing the need, which we know it will come, to transition to clean economies?

Hello to everyone.

I am working on the adsorption of Cu2+ from aqueous solution onto the biochar.

I found a strange result in thermodynamic analysis. At low temperature (15C), ∆G is 2 kJ/mol (∆G is positive). it means that the process is not spontaneous, and in fact, it shouldn't happen. But, adsorption happens in reality based on the experimental results.

At higher temperature, ∆G is negative.

I found ∆G > 0 results in a few papers but there is no explanations except that: adsorption is not easy if ∆G > 0.

{Yargic et. al., Assessment of toxic copper(II) biosorption from aqueous solution by chemically-treated tomato waste, Journal of Cleaner Production 88 (2015) 152-159

Hajjaji et. al., Adsorption of blue copper on a natural and electrochemically treated bentonite, Appl Water Sci (2016) 6:11–23}

I have used following equations found in literature:

∆G = ∆H - T∆S (equation 1)

∆G = -RTln(Keq) (equation 2)

Keq = (Qeq) / (Ceq) (equation 3)

Qeq is the amount of copper adsorbed divided by the mass of adsorbent (mg / g)

Ceq is the concentration of copper in the solution at equilibrium (mg/L)

Combining equations and the linearization will give:

lnKeq = ∆S / R - ∆H / (RT)

This equation was used for linear regression to estimate the values of ∆S and ∆H. ∆G was calculated by the definition.

I tried to find a reason. I really appreciate it if you could help me.

Explanation 1) Regression error

R2 is 0.96 in linear regression. There is an error in estimation of ∆S and ∆H, and therefore ∆G. Especially the value of ∆G is small.

Explanation 2) Physical adsorption

The equation (2) is defined for a reversible chemical reaction (Gibbs free energy isotherm equation). But, what if the adsorption is physisorption?

Is it necessary for ∆G to be negative even in case of physical adsorption? Especially, the formula used is defined for a reversible chemical reaction.

The value of ∆H is 30.2 kJ/mol. Based on literature, if the ∆H is less that 40 kJ/mol, the dominant mechanism is physical adsorption. It means that, in my experiment, adsorption is physical.

Explanation 3) Definition of Keq

if ∆G > 0, based on equation 2, Keq < 1 which means that:

Qeq < Ceq.

On the contrary, if ∆G < 0, Qeq > Ceq.

But, there is not any rule or limitation in the adsorption regarding the relationship between Qeq and Ceq. Especially, there quantities have different units and dimensions, and it is not possible to compare them.

It seems that the definition of Keq in adsorption is not appropriate. Based on equation (2), equilibrium constant must be dimensionless. Ln is a natural logarithm and therefore Keq must be a pure number and cannot have a dimension, since logarithms can only be taken of pure numbers. But, in adsorption, Keq is not dimensionless.

-------------------------------------------------------------

There is another confusing issue for me. If the assumption is equilibrium, ∆G must be zero. But, in all papers that I read, ∆G has a value either negative or positive. So, why?

Thank you very much for your time and patience to read such a long question.

In the RE-FUEL POWER projects, we are considering a number of conventional power cycles, such as supercritical reheated steam cycle, and advanced power cycles, such as supercritical CO2, ethane, helium or HAT cycles. Based on your experience, what other cycles can compete with these in terms of techno-economic performance? 

#powercycle #thermodynamic #economic #feasibility #cleanenergy #refuelpower

I cant seem to put my own data in the software openLCA. can anyone walk me through the process?

I am currently optimizing PCR for amplification of the ITS2 region for fungi and V4 region for archaea/bacteria from environmental gDNA.  This amplification is being done using degenerate primers appended with Illumina Nextera adapters (as detailed below).  The PCR product from this first round will be submitted to a sequencing facility on campus for a second round of PCR where indices will be added, then sequencing will be carried out on an Illumina MiSeq. 

I have encountered two issues:

1) After running an annealing temperature gradient, I am still uncertain which annealing temperature to use for the V4 primer set.

2) Both ITS2 and V4 primer sets are yielding non-specific product which show up as a faint smear with some diffuse 'bands' in my gel. 

I've attached a gel image of the Ta gradient (annotated in PowerPoint) which depicts both issues. 

For issue (1), my Ta gradient yielded virtually identical bands across more than 20C span of annealing temperatures – from 50C all the way up to 72C.  This makes it difficult to select an annealing temperature based on the gradient results.  Based on these results, I could select a Ta as high as 72C and run a two-step protocol, but I’m worried that I may miss some taxa by selecting a Ta which is so far above the lower Tm.  I am using a popular V4 primer set (515f-Y/806rB, see below) that has a large difference in melt temperatures.  Under the buffer conditions used, the Tm of the forward primer is 74C, whereas the Tm of the reverse primer is only 56.6C. 

Does anyone have experience with this primer set? 

Is it expected to get similar amplification over such a wide range of annealing temperatures?

Why do so many people use a primer set that does not conform to the basic rules of primer design, yet nobody talks about this in the literature or elsewhere?  ;)

For issue (2), both the ITS and V4 product has non-specific smears at higher molecular weights above the expected bands.  For ITS some of this may be due to varying ITS length in the potentially complex community from which the gDNA was derived, but the V4 product is expected to be ‘cleaner.’  I tried titrating the primer and shortening the extension time for the ITS reaction to little affect, but haven’t had time to troubleshoot the V4 reaction yet.  I suppose I would start by titrating the primer concentration.  The cycle count is high, but I would like to optimize at the highest expected cycle count assuming that lower cycle counts will yield cleaner product.

I’m wondering if anyone has experience with these primer sets and whether this amount of non-specific product is common? 

Is this caused by degeneracy in the primers? 

I anticipate that the presence of non-specific product will reduce the number of usable reads in my sequencing results at the very least.  Should I be concerned about this, or proceed with the second round of PCR and sequencing?

Polymerase:  Invitrogen Platinum SuperFi 2X MM

MasterMix (2X)                   5 uL

Forward primer (10 uM)     0.5 uL

Reverse primer (10 uM)     0.5 uL

Tmeplate  (10 ng/uL)         1 uL

PCR Water                         3 uL

Total Reaction volume       10 uL

Thermocycler Program (based on Invitrogen suggested protocol for SuperFi polymerase):

Cyc1 (1X)     98C for 2 min

Cyc2 (35X)   98C for 10 s

                      (50-72C) for 10s

                      72C for 15 s

Cyc3 (1X)     72C for 5 min

Cyc4              4C HOLD

All primers have the following Illumina adaptors appended:

Forward – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

Reverse – GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Tm listed below for each primer was calculated at www.thermofisher.com/tmcalculator

CATCGATGAAGAACGCAG  61.1

CAACGATGAAGAACGCAG  61.2

CACCGATGAAGAACGCAG  63.7

CATCGATGAAGAACGTAG  54.5

CATCGATGAAGAACGTGG  60.8

CATCGATGAAGAACGCTG  61.1

TCCTSCGCTTATTGATATGC 62.5

Tedersoo, L., Anslan, S., Bahram, M., Põlme, S., Riit, T., Liiv, I., … Abarenkov, K. (2015). Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys, 10, 1–43. http://doi.org/10.3897/mycokeys.10.4852

GTGYCAGCMGCCGCGGTAA 74

GGACTACNVGGGTWTCTAAT 56.6

Walters, W., Hyde, E. R., Berg-lyons, D., Ackermann, G., Humphrey, G., Parada, A., … Jansson, J. K. (2015). Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems, 1(1). http://doi.org/10.1128/mSystems.00009-15.Editor

Can anyone suggest, how to find cleaner production index?

They may recommend material on Management of Environmental Sustainability : Cleaner Production

Fate of solid waste:

1) For landfil.

2) For incineration.

I want to explore how to make strategic management to manage solid wastes in an industrial area in a developing country. What is the proper method for this? SWOT analysis and/or any other recent methods?

The factors that would cause industry to adopt CP at higher rates (>50% of target population) than currently practiced worldwide. The types of interventions and at what levels (country, network, company).