Science topic

Circularity - Science topic

Explore the latest questions and answers in Circularity, and find Circularity experts.
Questions related to Circularity
  • asked a question related to Circularity
Question
2 answers
Have you bought groceries or food lately? Have you noticed that the cost of items that form part of the production cost of the product or service you are buying, like bags or food containers that once were free pollution, are now being charge extra to consumers when buying passing to them the apparent environmental responsibility of dealing with them, but the extra money now you are required to pay goes directly to the company profits, not to any private nor government nor even to the same company recycling program as perhaps there is none. And governments seem to be okay with this new practice which is now spreading from major corporations to small businesses leaving consumers with no protection.
In a sense, dwarf green markets provide a cover for companies to pass their cost of production plus the “green grab” to consumers usually without having to disclose in advertising what they are doing so, a kind of deceiving as if those items cost more to companies now increasing their production costs that way, then they should increase the prices of their products or services instead, giving that way the option to consumers to buy at a higher price or not.
So consumers pay more, but their extra pay has not clear environmental benefits from consuming at a higher price, which raises the question, under dwarf green markets are consumers currently being scammed by the business community?
What do you think? Please detail your own view.
Relevant answer
Answer
Sabilar, would you like to expand your answer? If not, that is fine,
Lucio
  • asked a question related to Circularity
Question
1 answer
I am trying to design phase shifter , but I am not able to figure out the impedance required to each arc of microstrip such that all the ports are matched at 50 ohms
Can anyone help me out with the impedance calculations?
I am attaching the reference image for understanding .
Relevant answer
Answer
  • asked a question related to Circularity
Question
3 answers
I tried to make riboseq library in my host strain B.subtilis which overexpress protease. The cells were grew in fermentor with soy media. I collected cells by flash frozen it in liquid nitrogen. But I always faced issue about the polysome degradation before MNase treatment. I tried to add protease inhibitor and RNAse inhibitor in the cells lysates but still got polysome degraded. Any suggestion?
Frozen cells were pulverized in freezer mill grinder in high magnesium buffer (20 mM Tris pH 8, 0.15 M MgCl2, 0.1 M NH4Cl, 5 mM CaCl2, 0.4% Triton X-100, 0.1% NP-40). The pulverized cells were thawed and the soluble cytoplasmic fraction was collected by centrifugation of insoluble material. Then the contents were layered on sucrose cushion (1.1 M Sucrose, 20 mM Tris pH 8, 500 mM NH4Cl, 10 mM MgCl2, 0.5 mM EDTA pH 8) and the ribosome was pelleted in ultracentrifuge  at 60000 rpm, 4 °C 1.5 hour. The ribosome was resuspended in the buffer containing 20 mM Tris pH 8, 15 mM MgCl2, 100 mM NH4Cl and 5 mM CaCl2 and treated with micrococcal nuclease (MNase, Sigma) to degrade DNA and to reduce polysomes to monosomes. Monosomes were further isolated by S400 column. mRNA was extracted from the monosome fraction by treatment with acid phenol and chloroform extraction, and isopropanol precipitation. Then polyacrylamide gel purification was performed for size selection of 15nt-45nt RNA fragments. The RNA molecules were further dephosphorylated by treatment with T4 polynucleotide kinase (New England Biolabs). The  dephosphorylated RNA fragments were ligated to a DNA linker (/5rApp/CTGTAGGCACCATCAAT/3ddC/) using T4 RNA ligase kit (New England Biolabs). rRNA from all samples was depleted followed by Ribo-Zero kit instructions (Ribo-Zero Plus rRNA Depletion Kit, Illumina). Then the RNA samples were reverse transcribed using SuperScript III (Life Technologies), and the primer RT primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG). The reverse transcription products were circularized by CircLigase ssDNA ligase (Epicentre). PCR amplification was performed using the circularized cDNA as a template and Ribo-F (AATGATACGGCGACCACCGAGATCTACAC) and IIlumina index primer (CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCG), and Phusion High-Fidelity DNA Polymerase (New England Biolabs). The PCR-amplified DNA libraries were deep sequenced by Illumina HiSeq.
Relevant answer
Answer
Flash freezing causes cell lysis :)
  • asked a question related to Circularity
Question
3 answers
I wonder how Circular Economy would be from the perspective of ordinary consumers, whether we could have circular consumers, or should this idea be anecdotic. Because Circular Economy seems pretty much perfect for humans. What do you think?
  • asked a question related to Circularity
Question
5 answers
Here, I am analysing Thin walled circular tube in Abaqus Software under Axial loading and I have only Two terms.
(1) Velocity
(2) Mass
And I am not able to solve Mean Crushing Acceleration and Peak Crushing Acceleration.
Relevant answer
Answer
Actually, Mass and Velocity are already given.
  • asked a question related to Circularity
Question
3 answers
i designed a circular array patch antenna around a breast model and i need to make SAR maximum at tumor locations but there is no hot spot neither in model nor at tumor location how i can fix this ?
Relevant answer
Answer
By mismatch I mean a mismatch in impedance. This is proportional to the ratio between the complex refractive index of two materials. There is a significant ratio between the impedance of skin and the impedance of fat, which can cause a large reflection. However, it depends on the thickness of the skin layer, and the frequency.
The materials can be treated as if they form a transmission line, and the reflections calculated. It is similar to radome design, and the paper below has some of the equations and concepts detailed.
  • asked a question related to Circularity
Question
2 answers
Hello,
I performed De Novo assembly of bacterial species. How to know If the assembled genome is circular or linear.
Thanks.
Relevant answer
Answer
If you have just one scaffold/contig it means that you have complete chromosome of the bacteria, otherwise you don't have the complete chromosome.
  • asked a question related to Circularity
Question
1 answer
Our myotubes are probably contaminated with other types of cells, these cells seem to be different from myoblasts, because they have different morphology, they are circular.
Can you help us to identify these cells?
Thank you
Relevant answer
Answer
I Have encounter the same problem like you. Have you solved this problem?
  • asked a question related to Circularity
Question
3 answers
do help me out with appropriate application
Relevant answer
Answer
@Robert adolf brinzer is right about ligases in the plasmids. The type of covalent binding helps to determine the shape of resulting plasmid.
  • asked a question related to Circularity
Question
3 answers
Hello,
I am doing quantitative research into motivations (6 types) and values (4 types) for circular use of materials (10 types). So motivations and values are independent variables and circular use dependent variable. Also I have a moderating variable, homeownership (4 types).
I am using SPSS.
What kind of analysis should I run? I was thinking of GLM multivariate, but how to incorporate the moderating effect?
Relevant answer
Answer
Hello Karismi,
Much of the answer depends on how you quantify scores for each of the ten circular use outcomes. As your question and Kelvin Jones' answer imply, the basic framework sounds like an anova (6 levels of IV motivation, 4 levels of IV values, 4 levels of proposed moderator, home ownership), with 96 cells and either 10 DVs or 10 univariate analyses or a repeated measures factor with 10 levels (scores). However, that requires your DV scores are rightly quantified as at least interval strength values.
If your attention is genuinely focused on the ensemble of 10 scores (and possible profile differences), then multivariate is likely the useful path. However, if your interest is really that of "which, if any, of these 10 scores is significantly influenced by IV1, IV2 & moderator," then univariate analyses, while repetitive, are likely the better option.
If there's something that we've missed here, please feel free to elaborate your query.
Good luck with your work.
  • asked a question related to Circularity
Question
4 answers
For my experiments I need circularly polarized laser light at 222 nm.
Can anyone tell me is there any important difference between a λ/4 phase plate and a Fresnel rhomb? Prices seem to be comparable. My intuition tells me that phase plate could be significantly less durable due to optical damage of UV AR coatings on all of the surfaces. Also it seems that it is much harder to manufacture the UV phase plate since there are very limited light sources for testing. While Fresnel rhomb seems to be more easy to produce and apochromat. What am I supposed to choose?
Relevant answer
Answer
I think that absorption is not a problem since I want to install the rhomb or λ/4 into the seed pulse before the final amplifier. The pulse that I will work with is only needed for injection locking of spectrum and to the large extent can be strongly attenuated. Same with space, it's not crucial.
It seems that in my case (nanosecond, narrow bandwidth pulse) the difference between rhomb and plate can be neglected. When in comes to ultrashort/broadband pulse the thickness of a rhomb becomes a drawback since it introduces additional dispersion (pulse stretching) and even self-focusing and absorption.
  • asked a question related to Circularity
Question
2 answers
Basically, the circular plasmid is more specific to identify its completeness. However, when we gain the metagenomic sequencing result from bacterial community or whole-genome sequencing result from bacterial isolates, after assembly of contigs, it is not clearly to confirm the completeness of linear plasmid.
Relevant answer
Answer
Unless you have overlapping contigs at either end of the plasmid it is impossible to tell in silico and would require experimental verification. It is possible to design primers near the ends of your plasmid assembly that would amplify across the remainder of the plasmid. This amplicon can then be sequenced to identify the remainder.
  • asked a question related to Circularity
Question
3 answers
what are the factors which affect the circular economy?
Relevant answer
The information on this page could be helpful
But it is in Spanish.
  • asked a question related to Circularity
Question
5 answers
I have designed two circular hollow waveguides in CST, one has a 1 mm radius and the other has 1.8 mm. i am plotting the phase constant (beta) vs frequency. I am confused about what this plot defines.
also, I get two different plots from the same design. 1 from the 2D results (s-parameters) and the other from the port information. (attached picture)
can anyone tell me whether these plots have the same meaning or relation? and what this plot defines. is it good or worse?
thanks
Relevant answer
Answer
Your top plot looks reasonable, but I would expect it to be in radians per metre. It looks like you have taken the phase change over a given length and divided by the length, but forgotten that the phase change can only get up to 2pi before it drops to zero again. The same applies to the second figure. You need to either use a very short length so that the total phase change never exceeds 2pi or unwind the phase by adding 2pi more at every step - some software packages have a function that does this.
The third figure looks like what I would expect for modes with different cutoff frequencies (wavelengths) in waveguide, where 1/(cutoff wavelength)^2+1/guide wavelength)^2 = 1/free space wavelength)^2. The vertical value is 2pi/(guide wavelength)
  • asked a question related to Circularity
Question
4 answers
Dear researches,
I am a Phd student and I want to study how digital platform enable circular supply chain. Do you have some relevant concepts or topics that need to be integrated in this study ? any suggestion of relevant articles?
BR,
Am
Relevant answer
Answer
You can use RFID,GPS for linking between digital IT platforms & SCM.
  • asked a question related to Circularity
Question
4 answers
This is a 2D meshing of airfoil NACA0012 by ansys 2020 R2. I have tried for thousands of times by viewing several tutorials using different airfoil profiles but I found the same issue. The whole area was not uniformly structured meshed (C type meshing). I have tried the same operation by splitting the face into 2/4/6 segments by face split tool, but I could not resolve the problem. When half circular side is uniformly meshed, the rectangular surface is not uniformed, and when the rectangular side is okay then half-circular side is defected. I have tried by varying the number of divisions from 50 to 200, also varied the bias, but failed. Would anybody tell me why does this happen and how to overcome it to get a uniformly distributed structured grid type meshing?
Relevant answer
Answer
The answer is very simple and has a geometrical basis: a structured mesh with quadrilateral elements (4 edges) is only possible for quadrangular area (that have 4 sides). In your model, you have a quarter of circle with 3 egdes, not 4. In fact, in the centre of curvature, for sure there is a degenerated element (not quadrilateral).
Furthermore, it is not clear why to use thousands of tiny elements in the right region, despite it has no stress raisers.
  • asked a question related to Circularity
Question
1 answer
Dear
i would like to calculate the absorption spectra for different orientation of circular polarization of the pumb laser for 2d materials .
to do this calculation i can use turbo_lanczos.x then turbo_spectrum.x , how i can include the orientation of circular polarization using quantum espresso ??
can you please give me some suggestion
Thanks alot
sabrine .
Relevant answer
Answer
I also wait for this answer.
  • asked a question related to Circularity
Question
3 answers
Hi all,
I have a linear fragment having overlapping ends. I wanted to know that whether by Gibson, can we circularize that linear fragment and use it as a rDNA for transfection or not?
If possible, kindly mention how?
As Gibson reaction requires the master mix, enzymes, vector as well as insert so how to modulate the protocol and whether it will give the expected result or not?
Relevant answer
Answer
That's nice. I would recommend to try atleast 10ul reaction. Let me know, how did it go for you.
  • asked a question related to Circularity
Question
1 answer
There is a steel shimmed circular tank of diameter 6.0 m which needs grout to be poured beneath its base plate. What is the proper way to apply grout under this area rather than just pouring using a circular formwork to ensure that the grout really sealed all the voids beneath the tank base plate, will using a grout pump make any difference than the normal manual pouring method?
Relevant answer
Answer
I think that there is no difference between these two method.
  • asked a question related to Circularity
Question
5 answers
Hello,
I have a background in sustainable business model innovation / circular economy but have spent the last 5 years or so working on a project focused on airport noise management. I am looking to get up to speed on what I might have missed and I'm wondering what people think is the essential academic literature on these themes in the past 5 years or so.
Any advice much appreciated!
Thanks,
Graeme
Relevant answer
Answer
Hi Graeme,
Here below are some great links of journal papers published during the last 5 years discussing your research interest, hope this helps, good luck with your future enterprises.
Best wishes,
Sofiane
1. A definition and theoretical review of the circular economy, value creation, and sustainable business models: where are we now and where should research move in …
T Lahti, J Wincent, V Parida - Sustainability, 2018 - mdpi.com
  • asked a question related to Circularity
Question
4 answers
The concept of Circular Economy (CE) in the Construction Industry (CI) is mainly about the R-principles: Rethink, Reduce, Reuse, Repair, and Recycle. Thus, if the design stage following an effective job site management would include consideration of the whole lifecycle of the building with further directions of the possible use of the structure elements, the waste amount could be decreased or eliminated. Analysis of the current literature has shown that CE opportunities in CI are mostly linked to materials reuse. Other top-researched areas include the development of different circularity measures, especially during the construction period.
In the last decade, AI merged as a powerful method. It solved many problems in various domains, such as object detection in visual data, automatic speech recognition, neural translation, and tumor segmentation in computer tomography scans.
Despite the broader range of works on the circular economy, AI was not widely utilized in this field. Thus, I would like to ask if you have an opinion or idea on how Artificial intelligence (AI) can be useful in developing or applying circular construction activities?
Relevant answer
Answer
  • asked a question related to Circularity
Question
3 answers
I am planning to do my dissertation on the topic bullwhip effect in service industry or circular economy , I am kind of stuck to on the literature review to submit research proposal. Please suggest if I can get some guidance will be of tremendous help
Relevant answer
Answer
Thank you Sofiane for your suggestions and kind gesture.
Thank you Michael for your inputs
  • asked a question related to Circularity
Question
2 answers
I have identified numerous barriers to the transition to circular economy from literature and I want to quantify the identified barriers
Relevant answer
Answer
Dear Seun Bello,
In my opinion, significant research methods and quantitative data analysis in the area of ​​the analysis of the determinants of the pro-environmental transformation of the economy towards a sustainable, green, emission-free circular economy can be statistical analyzes of data collected and published by national statistics institutions, quantitative data from surveys and Big Data Analytics carried out as part of the sentiment analysis of data collected from entries, comments, posts, etc. posted on social media websites. I have described the methods of this analysis in some publications that I have posted on my profile of this Research Gate portal.
Best regards,
Dariusz
  • asked a question related to Circularity
Question
4 answers
I have designed a microstrip patch antenna for circular polarization. The axial ratio of the antenna is less than 3 dB, but the return loss is only -5dB. How to increase the return loss without affecting the axial ratio.
Antenna Structure: It is a single feed square patch antenna with truncated corners
Relevant answer
Answer
Hello,
Few papers are attached for your references:
Thanks,
  • asked a question related to Circularity
Question
3 answers
I am looking for a formula which will help in calculating the number of equal circular components that than fit inside the circular shapped tray.
For the number of smaller circles upto 3000.
Relevant answer
Answer
If you only take away half the area of the circles that will fit around the perimeter, then this is close to the result of the website Vincenzo Antonio Rossi recommends.
pi R^2/(2sqrt(3)r^2) - pi R/(2r), which is pi R/(2r) (1/(sqrt(3)) R/r - 1)
  • asked a question related to Circularity
Question
3 answers
Hi everyone, I have designed a circular patch array antenna(from paper) in HFSS 2018.2 environment working at the ISM band. I got negative gain(-10.6dBi) and realized gain(-10dBi) designed structure at operating frequency. After analysis I found that their radiation efficiency is very less means the antenna is not radiating. Further, I plot the matching parameter to see whether the matching is good or not. I found matching is already good. I have used microstrip feed. Please help me to get positive gain. I have attached my HFSS file here. Please help me to get positive gain(dBi) and make the antenna radiate?
Relevant answer
Answer
Kindly share images of antenna, radiation pattern, Z11 (real&im) and s11 parameters to understand the problem and suggest accordingly
  • asked a question related to Circularity
Question
4 answers
I have to join two circular discs which have to be joined by any epoxy resin but service temperature of tthe disc is 250 degree Celcius. Can anybdy suggest me a commercially available epoxy adhesive That can withstand the above mentioned temperature. I found some of them but not easily available in india.
Relevant answer
Answer
PTM&W resin PT286 A/B
  • asked a question related to Circularity
Question
1 answer
The Euler-Bernoulli formula for beams is not valid for short beams (beams with length less than the depth). So, Is the torsion formula for circular shafts applicable to short shafts?
Relevant answer
Answer
If the following assumptions get fulfilled then it's applicable:
1. Shaft must be straight and consist of uniform cross section
2. Shear stress induced in shaft should not exceed its plastic limit
3. Twist along the shaft should be uniform
Hope it helps
  • asked a question related to Circularity
Question
3 answers
Good Day Sir/Miss,
My name is Jackson Liew and I am a Master student in University Tun Hussein Onn Malaysia (UTHM) currently undergoing my Master's research with the title "A Study of Circular Economy Model for Product Packaging based on  Analytical Hierarchy Process".
I wish that this survey can be responeded by researcher who are expertise in the area of packaging, Circular Economy and also sustainability. I wish that you could participate in this research study by completing the attached survey which is in the type of google form (https://forms.gle/MGqkeGQo32AameDs9). The survey will require a short time to complete. I will ensure that all the information provided will remain confidential.
Thank you for taking your time to assist me in my educational endeavors. The data collected will provide useful information for the next phases of my research. It will be much appreciated if you could participate in my academic survey. If you require additional information or have questions, kindly contact me through this email address (jackliew0074@gmail.com).
Sincerely,
Jackson Liew
Relevant answer
Answer
Just like Jan H said, i would help you share the url with my Linkedin network as researchgate might be limited with just researchers some who might not be in the industry.
  • asked a question related to Circularity
Question
5 answers
Circular Economy and Triple Bottom line are two main tools in achieving sustainable development goals. But many academics, professionals and stakeholders are finding difficult to distinguish the difference between them and also fail to interconnect them. In this aspect, how they are inter related in terms of construction industry and technological applications?
Relevant answer
Answer
The Built Environment sector consumes a substantial portion of non‐renewable energy and prompts the emission of a significant amount of CO2; contributing approximately 39% of the annual global CO2. A third of the usage of total energy and CO2 emissions is a result of the Construction Sector in the developed and developing nations.
The Smartcrusher is a classic example of Circular economy by Netherlands Circular, 2018. Concrete is strong enough to last for centuries. But every kilogram of cement produces one kilogram of CO2 emissions. This means that today’s concrete and cement industry emits about three times as much CO2 as all aircraft combined. Crushed pieces of concrete can now only be used as low-grade gravel replacements. SmartCrusher is a device that separates the unused cement stone from the concrete rubble. It also produces residual flows of good quality sand and gravel. The cement stone can be used directly in concrete production and thus saves cement and CO2 emissions. With SmartCrusher, 50% of the world’s largest concrete construction flow can be made circular. The revenue model shows that the investment can be recouped within 1.5 years and that the price of concrete is halved. And that without including CO2 pricing
In the category of PROFIT, the price of concrete is halved, allowing more headroom for profit. There is ample savings from less waste and Carbon Tax.
In the category PLANET, the impact of CO2 emissions is the rise in global temperatures that result in shrinking changes of water supplies, changes in weather patterns and increase in sea levels; among others. By reducing emissions these consequences of global warming are curbed.
PEOPLE are better off with less CO2 emissions. Air pollution from construction has a direct effect on construction workers’ health, and the health of citizens near construction sites. As an example, the UK’s Health and Safety Executive has found that over 200 construction workers die yearly prematurely from diseases caused by exposure to diesel fumes (Bellona, 2019). There is no safe amount of air pollution, which means that the less air pollution we can have, the safer it will be for construction workers, and citizens exposed to construction sites.
*The triple bottom line is a business concept that posits firms should commit to measuring their social and environmental impact—in addition to their financial performance—rather than solely focusing on generating profit, or the standard “bottom line.” It can be broken down into “three Ps”: profit, people, and the planet
*A circular economy is "a model of production and consumption, which involves sharing, leasing, reusing, repairing, refurbishing and recycling existing materials and products as long as possible."
  • asked a question related to Circularity
Question
16 answers
I really appreciate every answer because this project is going to be my Master Degree Thesis.
I have already studied a lot of softwares, such as: Ecolizer, openLCA, GaBi, SimaPro, Ecochain and Umberto, and many databases: Eco-invent, US LCI, ELCD, Environmental footprint and BioEnergieDAT.
Relevant answer
Answer
Beatriz Lopo Teixeira Muchas gracias!!
  • asked a question related to Circularity
Question
10 answers
Together with some dear colleagues we are working on a new project. what do you think about the relationship between green chemistry and circular economy models applied to the clothing industry?
Relevant answer
Answer
  • asked a question related to Circularity
Question
8 answers
Hi,
I have noticed that my DAPI staining (in the hippocampus of 20 micron thick brain sections) has a lot of variation in the staining intensity. In particular, larger circular cells appear lighter whereas smaller oval-shaped cells are more intense. Does anyone know whether these differences might be due to differences in cell type or cells being in a different stage of the cell cycle?
I attached an image and hopefully it is clear.
I stain my sections by directly pipette the DAPI (1:500 diluted in PBS) onto mounted tissue sections and incubating for 20 minutes at room temperature.
Relevant answer
Answer
Chloé Dupuis okay thank you! just another quick question - do you ever use triton in PBS to dilute DAPI? I was going to test that out quickly to see if the variation is reduced
  • asked a question related to Circularity
Question
2 answers
Hi
I would like to design a phase shifter for uniform circular array of array radius of 0.5 lambda which has 4 microstrip patch antenna elements, using cst software and 1 port.
Please help me out.
Thanks.
FF
Relevant answer
Answer
any references can you send
  • asked a question related to Circularity
Question
3 answers
Hello! I'm curious whether anyone has used sectoral input-output modelling to test or identify circular (as in Circular Economy) patterns in the economy. My impression is that most publicly available economic data is very "linear" in nature, reporting income, output, and flows among sectors. I'd be curious if anyone in the economics or regional economics fields have applied these methods with an eye toward circular patterns like resource recirculation, re-use, durability, adaptability, value retention, etc.
Relevant answer
Answer
A circular economy (also referred to as circularity and CE) is "a model of production and consumption, which involves sharing, leasing, reusing, repairing, refurbishing and recycling existing materials and products as long as possible"
  • asked a question related to Circularity
Question
3 answers
I have some polar transformed data that I would like to represent in a graph. I was used to do that in Statistica; however, I cannot find a way to do it in SPSS. Does someone know if/how to do it on this software?
Thanks a lot for your help!
Relevant answer
Answer
Andrew Wheeler is an expert on producing all sorts of graphs via SPSS. You might find some useful material on his website. E.g., take a look at this page:
HTH.
  • asked a question related to Circularity
Question
21 answers
I have designed one patch later I used transform option and rotated it to 45 degrees for 8 element circular array.
But it throws an error saying "Waveguide ports must be aligned with Cartesian coordinate planes for the transient solver."
I think when I rotate it to 45 degrees obviously then cartesian coordinate what I want is tilted. Then how should I design circular array.
Relevant answer
Answer
A curved bend with the inside radius more than 3 times the track width should be fine.
  • asked a question related to Circularity
Question
9 answers
Currently, two distinct types of indicators are being developed: (1) monitoring frameworks based on macro indicators that summarize progress at the national level, and (2) micro indicators aimed at analyzing circularity at the product level.
How to bridge the gap between the macro and micro levels of Circular Economy using any Logistic approach? My focus is to incorporate logistic strategies which could help in bridging the gap between the macro and micro levels of CE. Any reference papers or suggestions will be highly appreciated.
Relevant answer
Answer
Scfviscat meso level!
  • asked a question related to Circularity
Question
3 answers
I want to assess performance of a 4 and 5 antennas (arranged in the form of circular array), by calculating different parameters such as CRB and RMSE. However, as I have seen in theory, a number of different formulas and methods are implemented. Moreover, what I learnt till now is that you have to deduce a different CRB formula for different scenario. Is there some basic guide or some instructions which can point me in the right direction for calculating CRB as per given antenna design?
Relevant answer
Answer
It mean if math. formula is complicated, try some thing else, outcomes of tryout is a data, the standard deviation of data has the same meaning of RMS. GOOD LUCK
  • asked a question related to Circularity
Question
2 answers
What is the relationship between circularity, cylindricity and roughness of drilled holes and how to control the roughness of holes?
Relevant answer
Answer
Thanks a lot for the replay.
  • asked a question related to Circularity
Question
4 answers
Dear Researchers,
What are some of the possible indicators in the Circular Economy(CE) in terms of the Food Industry?
Is there any research paper that could possibly show the CE indicators in the context of the Food Industry?
Any paper link would be highly appreciated. Thanks and regards.
Relevant answer
Answer
kindly check the following link that includes propose a modification of one of the few available tools for measuring the circularity, the Material Circularity Indicator (MCI), for adapting it to biological cycles, then applied to the poultry sector, integrating the results with the Life Cycle Assessment methodology. I hope it is useful:
  • asked a question related to Circularity
Question
2 answers
Esteemed peers,
Please answer a few questions, while I assure you that the answers are confidential and that they will be used exclusively for research purposes. The average duration of completing the questionnaire is 10-15 minutes. Please note that this questionnaire is anonymous and does not collect personal data.
Understanding your time constraints, we would be grateful if you could complete the questionnaire by 21.02.2022.
To complete the questionnaire, go to the following link: https://forms.gle/s8YW4kthVYdv2XBJ7
P.S. The questionnaire is in Romanian, to translate, please follow these simple instructions:
1. Right click in the form
2. Select translate Translate to English
3. Choose the language you would like it to be translate to.
Relevant answer
Answer
My advice is make an English translation ( responden do not have time to do is) and perhaps publish it on LinkedIn, so you will have more professional response
  • asked a question related to Circularity
Question
2 answers
What is the best software tool, from people's experience, for designing primers to clone via circular polymerase extension cloning (CPEC)? Is there a software that can smartly design primers (optimal Tm, no self dimerizing) to linearize a plasmid and add an insert, stating optimal annealing temperatures?
Many thanks in advance
Relevant answer
Answer
For any primer design and sequence manipulations I always used the software called Serial Cloner
  • asked a question related to Circularity
Question
2 answers
in my opinion, directly no because the shape of the resin after performing mechanical stirring will be mixed up and maybe it gets a circular shape but then we can modify the shape ( by some chemical processes) to obtain a honeycomb structure. I would like to know what do you think.
Relevant answer
Answer
Thank you!
  • asked a question related to Circularity
Question
8 answers
Dear Colleagues,
I am in problem in measuring the transition temperature of a Superconducting sample.
I am getting absurd behaviour.
I am using four probe method with a disc type pellet.
Is it not possible to do the experiment by circular disc?
Please suggest.
Thanks and Regards
N Das
Relevant answer
Answer
Dear Rajan Gnanarajan,
My sample is 1 mm thick. Disc diameter is 13 mm.
As the sample starts cooling, the voltage drop starts increasing initially.
Then it reaches a value and then comes down.
I have tried several times but the same think occurs.
I wonder about this horrible result.
I can't think of any reason.
Thanks
N Das
  • asked a question related to Circularity
Question
4 answers
We are beginning a meta-analysis to compare electronic waste production, processing, and transportation. This is a new field for our group, and we would love to know what available international, national, or regional databases are available. Likewise, if anyone is interested in a collaborating on this project, a M.S. student in our group is highly motivated to push this forward.
Key terms: e-waste; Waste from electrical and electronic equipment (WEEE); circular economy; electronic waste; electronic recycling; end of life; life cycle analysis.
Relevant answer
Answer
The best reference to find e-waste generation, collection, regulation, and other relevant data is e-waste monitor website which presents the most reliable data gathered by United Nation University
  • asked a question related to Circularity
Question
1 answer
I recently learnt how to use Plaxis for my thesis, however I do not know how to interpret the result correctly.
The displacement profile is showing that the maximum displacement is 47.54 x 10^6 m, and the red colour failure region is circular shape. I would like to know does it mean the failure plane is circular and total soil displaced is 47.54 x 10^6 m?
While the displacement mesh diagram, what does it mean by "displacement scaled up to 200.00 x 10^9 times"?
I would greatly appreciate it if someone could explain to me.
Relevant answer
Answer
Dear Ong,
Regardless the software used, looking at the pictures, I suspect there is something wrong with the model (e.g. boundary conditions, material properties, etc.). Perhaps, it is worth checking the units of your input parameters as well as their magnitude.
I do not know the order of magnitude of the loads applied onto the structure, but I would expect the max displacement to not exceed 0.X meters.
The deformed shape of the structure has been scaled down by 200x10^-9 times as, indeed, the displacement/deflection is way too large to be displayed in a larger scale.
I hope this helps
Vincenzo
  • asked a question related to Circularity
Question
3 answers
I finished my Ph.D. in 2020, majoring in Biology and environmental science, at the University of Helsinki. I wish to do a postdoc by applying for the podoco grant. You can find more information about podoco - www.podoco.fi/companies/
To apply for the podoco grant, I need to collaborate with an organization or a company and prepare a project plan that is beneficial for that organization. I am asking your help to provide names of companies and non -governmental organizations in Finland working within the area of food and sustainability issues, circular economy, natural resource management, environment, and climate change. Looking forward to getting your advice. Thanks in advance.
Sincerely-Mohammad Mozumder,PhD
Relevant answer
Answer
Have you tried local institutes or universities?
  • asked a question related to Circularity
Question
1 answer
Dual-Band linear to circular polarization converter
Relevant answer
Answer
You can use a Fresnel rhomb to resolve RHCP and LHCP into orthogonal linear polarizations which can then be measured with a polarization diversity detector? Alternatively you can use a Fresnel rhomb or a photoelastic modulator to create circular polarization from linear polarization.
  • asked a question related to Circularity
Question
36 answers
  • Will companies align circular economy initiatives with climate goals, or continue to treat these as discrete initiatives?
  • How will technological innovation deal with the problems identified around natural resource depletion?
  • Will moving toward a circular economy require changes in consumer behaviour? Are those happening?
Relevant answer
Answer
economic balance in the world will never happen. like Charles Darwin's theory. who is strong he wins. life evolution
  • asked a question related to Circularity
Question
23 answers
Dear colleagues,
I would like to request your collaboration to take part in the survey, available at the links: (EN): https://lnkd.in/djVdWne (IT): https://lnkd.in/dnvK3eJ (PT-BR): https://lnkd.in/dVGWmHv This questionnaire is part of the project aiming to analyze the transition from a linear economy to a circular economy, comparing developed and developing countries, at a macro level (nations, regions, cities). The project is a partnership between the University of Brasilia (Brazil), coordinated by Professor Patricia Guarnieri and the University of Bologna (Italy), coordinated by Professor Augusto Bianchini.
Your participation is very important to us. Please share with your network! Sincerely,
Patricia Guarnieri, Dr. Professor and Researcher Faculty of Economics, Business Administration, Accounting and Public Policies Management (FACE/UnB) - http://www.adm.unb.br/ University of Brasilia - UnB -  http://www.unb.br/ ORCID : http://orcid.org/0000-0001-5298-5348
Relevant answer
Answer
The transition to a circular economy is not uniform and varies depending on a series of factors such as the degree of industrialization, the level of technological development, the availability of qualified human resources and access to financing, among others.
  • asked a question related to Circularity
Question
6 answers
Hi
A Linear Polarization wave incident to a structure and then transmit a circular polarization to another side, in this way how can I calculate S21 parameter?
Relevant answer
Answer
I don't know the answer to your question. One way to understand what is happening is to simulate something you know the answer to, such as an empty cell, and see how the results compare to what you expect. Relating the phase of circular polarization to the phase of linear polarization requires the definition of where zero phase is for the circular - is it when it crosses the V-plane or the H-plane, for instance? You may be able to sort this out by a few simulations varying simple things.
  • asked a question related to Circularity
Question
5 answers
Dear researchers,
I am interested in collating evidence on circular solutions for recovery and reuse of nutrients from different waste streams in the agricultural sector. Therefore, I would like to know the findings, case studies, challenges, barriers, and opinions of experts on circularity in food systems.
Relevant answer
Answer
Dear Felipe Romero-Perdomo,
A very good research topic. Unfortunately, the circular economy is still used on a too small scale in food systems, including as part of the development of sustainable organic farming operating in accordance with the principles of pro-environmental, green circular economy. In my opinion, systems for the use of food waste in sustainable organic farming, which are thrown away by people and by stores selling food products, should be developed. Waste segregation and recycling systems are being developed, but the scale of re-use of waste from food products is too small. On the other hand, the scale of the application of the circular economy in agriculture could be multiplied if the current global structure of the production of agricultural crops, of which 3/4 of the crops produced is used as feed for livestock farming, would be reversed, i.e. that min. 3/4 of the production of agricultural crops was intended for the production of food products for humans. In this way, the problem of greenhouse gas emissions (30% of greenhouse gas emissions, including a significant amount of methane on a global scale comes from livestock farming) would also be significantly reduced. The problem of hunger in many countries could also be solved in this way. Farms producing only plant crops are easier to convert to a model of sustainable organic farming, taking into account the principles of the circular economy, than livestock farms. Meat can be produced under the so-called cell agriculture based on the cultivation of cells collected from animals on the basis of biopsy. In vitro meat can be healthier because it can have less unfavorable fats, and can be enriched with Omega-3 acids, etc. In classic meat production based on meat breeding, antibiotics are used and antibiotic resistance is created. Crowded animals in farms are a breeding ground for new pathogens, new viruses that can be passed on to humans. Genetically modified yeast can produce a milk substitute for the production of e.g. cheese, ice cream. On the other hand, if someone who wants to contribute to reducing the scale of global warming turns to vegetarianism, now there are techniques for preparing meals and dishes that look and taste very similar to meat and are made from plant crops, e.g. legumes. In view of the above, farms producing plant crops as part of pro-environmental, sustainable organic farming have greater opportunities to operate in accordance with the principles of circular green economy than classical farms where organic farming is not applied and there is also livestock breeding. Therefore, in this type of sustainable farms operating in organic farming, agricultural wastes can be used to a much greater extent as, for example, compost for fertilization on arable fields. In this way, there is little organic waste and a more circular economy is realized.
Regards,
Dariusz
  • asked a question related to Circularity
Question
18 answers
Hi! I'm looking for conferences/summits regarding circular economy and social/sustainable entrepreneurship that are indexed in scopus and/or are the best worldwide. Can you suggest me one?
Relevant answer
As already reported by Gianmarco Bressanelli
This is the 3rd version that goes physical this year.
Not indexed in scopus but we have partnered with prestigius journals for special issues.
Both 1st and 2nd version (see the above link) web pages are still live for more information
  • asked a question related to Circularity
Question
4 answers
Dear all,
As we all know that the rate of using display technologies has been soaring up with each passing day. The need for glass materials for display devices such as smartphones, touch screens, or the like emerges as indispensable. In this sense, what are their rate of recycling and/or reusing for fostering the circular economy model, as well as towards carbon neutrality aims? Can anyone help to realize the facts in terms of statistical data?
Many thanks in advance for your kind contributions.
Relevant answer
Answer
in general two to three times
  • asked a question related to Circularity
Question
6 answers
I have three configuration of heat sinks(Fins) which are made up of Aluminum that are pin(circular) type, square type and triangular type configuration has better heat transfer rate comparatively?
Relevant answer
Answer
I will read these articles and choose a best option of heat sink configuration
  • asked a question related to Circularity
Question
3 answers
I have an almost edited manuscript completely free from plagiarism. The editor of the book has given the article an approval to be published. Need a copy editor who can work with me on the book chapter publication and review the article. The work deals in the aspect of circular economy and the life of rag pickers.
Relevant answer
Answer
اشارك لكن ما هو المطلوب من المشارك الكتابة ام غير ذلك
  • asked a question related to Circularity
Question
6 answers
I'm working on a Research focused on this theme and I would be grateful if some of you can share his/her knowledge about the topic. Any input is appreciated, thank you.
Relevant answer
Answer
You are welcome!
  • asked a question related to Circularity
Question
2 answers
Can bacteria use same stretch of genes for producing different proteins? Should be theoretically possible in a circular chromosome by changing the origin of replication.
Relevant answer
Answer
The start codon is AUG , it also codes for Methionine. The Ribosome binding site is the Shine Del Garno sequence AGGAGG which also codes for two Arginine. Then why it is not possible for Methionine and Arginine coding portions of one structural gene to become start codon and riobosme binding site for another  structural gene
  • asked a question related to Circularity
Question
19 answers
I am looking for a research topic for conducting systematic literature on circular economy. Can you please suggest some research about circular economy for the systematic literature review? I will appreciate your cooperation.
Relevant answer
  • asked a question related to Circularity
Question
3 answers
Hi All,
I am looking for an efficient way for punching out circular scaffolds from a sponge like material. I think, a biopsy punch should work, but the ones I have tried till date have failed. Can anyone suggest a biopsy punch from any company that can do the job or any other method?
Thanks a lot
Relevant answer
Answer
Rani P Ramachandran
, do you have any specific company in mind regarding the biopsy punch? I tried 2 companies and they could not punch through. Have you used onefrom any specific company?
  • asked a question related to Circularity
Question
3 answers
Here, it means the distance from a point on the surface of the cylinder to the point itself(taking a uniform route with out twisting).
Thanks!
Relevant answer
Answer
Dear
Sergio Flores
thanks!
  • asked a question related to Circularity
Question
3 answers
I'm doing a subcloning experiment with a pTNT vector and I treated it and my inserts (engineered with RE recognition sites) with EcoRI and KpnI, then incubated the digested vector with alkaline phophatase. I did a control experiment with each enzyme individually to confirm that they were both active. Upon doing a ligation experiment and screening the colonies, all of them had circular vector with no insert. To make matters more confusing, I was able to successfully ligate one gene into the double digested pTNT vector already, so I'm completely baffled as to why my vector is now showing signs of self-ligation.
Relevant answer
Answer
There is no such thing as a reaction going to 100% completion. The transformants yielding recircularized vector arise from vector molecules that were incompletely digested by one or both of the restriction enzymes and further escaped dephosphorylation by akaline phosphatase. Recircularization is a very efficient reaction, thus even a minute fraction of the vector that is cut only once and not dephosporylated will be recircularized and and show up in transformed cells. In order to avoid such background, you can treat the ligation mixture before transformation with a restriction enzyme whose site is located between the two restriction sites of the vector that you chose for cloning and that is of course absent from the cloned insert
  • asked a question related to Circularity
Question
2 answers
hello
I am trying to calculate the axial capacity of a circular column which is warped by spirally wrapped and striped wrapped. I have attached two figure which will help you to understand my question.
Relevant answer
Answer
  • asked a question related to Circularity
Question
3 answers
Hello,
I have a circular loop absorber with two dielectric substrates. I want to reduce the reflection at 3GHz. When i set the circumference to half of the effective wavelength, I got this simulation result.
My equation is why the second resonance is obtained at 12 GHz instead of the 2nd harmonic (6GHz)? And why is the reflection coefficient at 12 GHz smaller than at 3 GHz?!
Relevant answer
Answer
I think you will need to provide a better description of your ring absorber, the direction it is illuminated from, and the polarization you used, if you want an explanation.
  • asked a question related to Circularity
Question
6 answers
Some theories of physics require (not merely allow) magnetic monopoles. [See, for example, David J. Griffiths, Introduction to Electrodynamics, Fourth (Kindle) Edition (Cambridge University Press, Cambridge, UK, 2017.] But how can a theory that requires (not merely allows) magnetic monopoles be consistent with the fact that magnets with circular magnetic fields — and hence with no poles (neither a north pole nor a south pole) — exist? Two examples: (i) A horseshoe iron, alnico, or other permanent magnet bent into a circle, with the poles cold-welded together. (Cold welding is possible in a vacuum for surfaces planed very smooth.) (ii) A toroidal-solenoid electromagnet (with or without an enclosed iron core for increased strength). The magnetic field lines in such magnets are circular — and hence with no poles — neither a north pole nor a south pole.
Relevant answer
Answer
As I understand, your question is not about horseshoe magnet.
First of all, there is no problem with existence of circular magnetic fields even if there are magnetic monopoles (somwhere else). Such fields can be produced by electric currents. Simplest example of the circular magnetic field produced without magnetic monopoles is the field around the wire with electric current.
As for theories that require (or, at least, admit) existence of magnetis charges, their consistency with experimental data depends on the viewpoint.
For instance, there is an interesting theory of superluminal particles developed by Italian physicists (see e.g. Recami, E., & Mignani, R. (1974). Classical theory of tachyons (special relativity extended to superluminal frames and objects). La Rivista Del Nuovo Cimento Series 2, 4(2), 209–290).
According to this theory, superluminal velocity flips electric and magnetic fields, i.e. electric fields become magnetic and vice versa. Prticularly, superluminal magnetic charge will be seen as electric charge (i.e. the divergence of the electric field (div E) will be non-zero).
To undestand this, consider (again) the simplest example of magnetic field around the wire with electric current. In fact, this is the case of superluminal electric charge: it's time-like component (charge density in the wire) is zero, while space-like component (electric current) is non-zero. And, as we know, this "superluminal" electric charge produces magnetic field, not electric.
Similarly, superluminal magnetic charges (if exist) will produce electric field.
According to Recami & Mignani referred above, protons can be regarded as superluminal magnetic currents inside the proton. Since these currents are superluminal, they are seen as electric charges (not magnetic).
What are the reasons to think that currents inside the proton are superluminal? Well, according to experiments on inelastic scattering of electrons on protons, the number of proton constituents (termed partons) that scatter electrons is dependent on the reference frame. The faster the observer is moving with respect to scattering particles, the more proton constituents will be observed (you can read about this here: https://profmattstrassler.com/articles-and-posts/largehadroncolliderfaq/whats-a-proton-anyway/).
But according to Special relativity, this can only happen if proton constituents are moving faster than light. As you certainly know, slower-than-light objects can be at the same place at different times. Similarly, in Special relativity faster-than-light objects can be at different places at the same time. And the "number of places" where superluminal objects can be observed at the same time depend on the reference frame of the observer.
If we accept the idea of Recami & Mignani, we obtain very nice picture of the world with both electric charges (subluminal, inside electrons, muons and tau) and magnetic charges (superluminal. inside protons). But they both look like electric charges from our frame, hence we have an impression that there are no magnetic charges in nature.
I hope this is a good example of the theory that admits magnetic charges and is consistent with our experimental observations.
  • asked a question related to Circularity
Question
4 answers
I'll be working on how circular economy can be implemented in the forestry sector and people dependent on those forests.
Relevant answer
Answer
Very interesting is production of wood chips from wood waste. Wood chips are source of renewable energy, who grows the fastest from all sources of renewable energy in EU, by the Eurostat data.
Best regards
Ladislav
  • asked a question related to Circularity
Question
2 answers
Kuhn's Structure of Scientific Revolutions represents a watershed moment in the study of the history of science. His terminology of the paradigm, and particularly the paradigm shift, have entered the popular lexicon.
Yet, as noted in three generations of reviewers (corresponding to the first, second, and 50th anniversary editions) the ideas presented in the volume have been controversial from their inception, ranging from accusations of vagueness, through circularity, to extreme relativism.
Of the responses to Kuhn's ideas which would you recommend as the best reading.
Relevant answer
Answer
  • asked a question related to Circularity
Question
4 answers
Frontiers of LCA knowledge tend to expand while circularity indicators tend to disperse sporadically. Mainly, what some circularity indicators can quantify that LCA does not is monetary value retention. Is the goal of developing new circularity indicators to progress on our comprehension of absolute sustainability assessment? Why wouldn’t they integrate more of current knowledge while LCA does? What's the environmental contribution of quantifying/assessing circularity ?
Relevant answer
Answer
First I recognize that ISO 14040-44 type LCA may be a limited method to assess circularity. While product category rules (PCR) are important to standardize LCA and allow comparison between products they may be slow to update with the current state of knowledge and society's needs. Given that circularity assessment methods are still in a state of consolidation (e.g., the ISO standards for CE are still under development https://www.iso.org/committee/7203984.html) this is rather normal that standardized LCA and PCR are still limited in providing answers to circularity-type questions.
However, I disagree that LCA as a method cannot assess circularity in a research context. LCA researchers are fond of using a (very) wide range of methods in combination with the basic LCA framework. To name just a few: optimization techniques (multiple-criteria decision analysis, linear programming...), material flow analysis, system dynamics, agent-based modeling, partial and general equilibrium models, input-output analysis, and so on. The reasons are simple: it brings an original methodological contribution (always useful when trying to publish academic articles) and enables the researchers to apply LCA to a more difficult question/product system to analyze (say a fleet of vehicles (https://pubs.acs.org/doi/abs/10.1021/es5060868?casa_token=uJ0zllzDrL8AAAAA:UcvFPy8NI7kDSnrXEnSF2mvSP90tGRFbKXCfPcZJzJzeuBiOvSyoDWt7BfSa08D1rWSFS-gImEHKiPJg)) than what a standardized LCA would allow. Therefore, with appropriate goal & scope and functional unit definitions (see the still very relevant 1999 report from Goedkoop et al. on product-service systems https://simapro.com/wp-content/uploads/2016/05/Product-Service-Systems-main-report.pdf) and the use of appropriate methods to complement LCA, I can't see why LCA would not be able to assess the environmental performance of any CE strategies (but I remain open to being clearly demonstrated why not!)
Second, regarding CE indicators I will just repeat what I understood from the excellent article by Boyer et al. ( ) as I quite agree with their proposition. In the same way that sustainability assessment should include economic, social, and environmental aspects, circularity assessment should include three dimensions: recirculation, utilization, endurance. According to the authors, developing indicators around these dimensions would provide enough flexibility to adapt to specific product systems and enough standardization and transparency to enable product comparison. I think such standardized indicators in those three dimensions could complement existing LCA-based environmental product declarations (EPD) (in the same way that french EPDs (FDEP) include additional information on indoor air quality and water and soil pollution).
In the end, I think new standards and PCR need to be developed to i) define how CE systems should be assessed (with an emphasis on the goal & scope and functional unit definitions), ii) define what CE indicators should be used to assess the three dimensions of circularity for the particular product system.
  • asked a question related to Circularity
Question
5 answers
I would like to request your collaboration to take part in the survey, available at the links (you can choose your preferred language):
This questionnaire is part of the project aiming to analyze the transition from a linear economy to a circular economy, comparing developed and developing countries, at a macro level (nations, regions, cities). The project is a partnership between the University of Brasilia (Brazil) and several other universities (University of Bologna (Italy); University JAUME I (Spain), University of Aalborg (Denmark); Federal University of Pernambuco (Brazil); Federal Technological University of Parana (Brazil); Ghulam Ishaq Khan Institute of Engineering Sciences and Technology (Pakistan); Shaheed Benazir Bhutto University (Pakistan), coordinated by Professor Patricia Guarnieri (University of Brasilia).
It will be great to have your participation in our research, mainly because we would like to get the opinion from experts and stakeholders involved in the transition towards a circular economy and sustainability studies. Please share with your contacts
If you have any doubt, please let me know.
Kind regards.
Relevant answer
Answer
I will be happy to support your research which is in parallel with our research activities.
  • asked a question related to Circularity
  • asked a question related to Circularity
Question
7 answers
I am planning to analyze the Hertzian contact stress and contact radius for Pin-on-dis wear testing, where pain with the flat end was employed. If possible, I would like to know whether I can treat the contact between the pin and disc as circular contact or point contact.
Relevant answer
Answer
Hello Pavel,
I agree that if pin is flat then hertz model can not ne used. Then, the contact pressure can be calculated as load/area. It comes into conclusion that modulus has no effect on pressure in flat on flat contact case i.e., flat pin of two different materials will have a same contact pressure under a constant load for a particular counter body? Also, why we dont consider modulus values in this case?
  • asked a question related to Circularity
Question
1 answer
Dear All,
I am doing ligation of the padlock probe. The efficiency is pretty good (more than 90%). But I have a very simple question about this process.
As shown in the following figure, in normal ligation process of a padlock probe, a single padlock probe is circularized by ligase. But according to simple math, events like two padlock probes are ligated in a head-to-tail fashion should also happen.
So I just wander, why the ligation process does not go on according to the theoretical probability, but insteand, prefer a intramolecular circularization reaction?
Best regards
Binbin
Relevant answer
Answer
I've never done a padlock probe ligation, but I suspect that circle formation vs dimerization is an issue of concentration: at lower probe concentration, circle formation is favored, at higher probe concentration, dimerization is favored. I saw similar effects in blunt end ligations of cloned fragments into plasmids, which do tend to be done at higher DNA concentration that staggered end ligations.
  • asked a question related to Circularity
Question
2 answers
Hi,
I'm modelling in Ansys APDL a circular plate with a circular hole in its center loaded by a unitary compressive load (as in the brazilian disk test). I'm modelling only one fourth of the geometry. In the evaluation of the SIF I have a difference of one order of magnitude (0.019301 of Ansys vs 0.001914 of the analytical results). Can anybody tell me what could be the mistake?
Relevant answer