Science topics: Agricultural Plant ScienceChickpeas
Science topic
Chickpeas - Science topic
Explore the latest questions and answers in Chickpeas, and find Chickpeas experts.
Questions related to Chickpeas
'm doing SNP genotyping in the chickpea association panel, I have fetched 1KB up and downstream sequences flanking SNPs. m trying to find out restriction sites at the particular position i.e. the restriction sites within SNPs. Please provide the details except for the NEB cutter.
I am about to start my research on hydrolysis of raffinose family oligosaccharides in chickpea (Desi variety). My aim is to reduce the flatulence causing alpha galactosides by processing i.e., soaking with the natural source containing the enzyme alpha galactosidase and to produce quick cooking dhal.
Can you tell me the changing pattern of protein and carbohydrate during different period of storage in chickpea? and why?
Dear All
Have any effective management practice or application for controlling termite in chickpea where no irrigation facilities (rainfed crop). Please suggest which are effective and feasible for farmers
I am doing research on lentil and chickpea with relay cropping, zero tillage and conventional tillage with two different sowing dates. I want to calculate the moisture related extraction patterns for such pulses. So please suggest me whether the moisture content in soil will be more in surface layer or in 45 cm depth.
I was trying to isolate fusarium spores from chickpea infected tissue stained with lactophenol blue
I am trying to dissolve chickpea protein isolate in water but it's not soluble even with raised temperature and constant shaking. Can anyone please suggest the appropriate method or solvent other than water in which chickpea protein isolate gets completely soluble.
From literature and my own experience, to culture Ascochyta rabiei without supplementing the media with chickpea powder is not possible. I am curious to know what's the active ingredient in chickpea powder which is actually required to nurture its culture and can we supplement it chemically instead of raw chickpea powder or chickpea extract?
What is the current status of biofortification programs in chickpea. Recent progress in this research area. How many percentage of chickpeas are biofortified with agronomic, transgenic and breeding methods?
In my experiment with chickpea, the chlorophyll content increases with advancement in growth stages...but the photosynthetic rate was highest during flowering stage, but during pod formation stage it declined though chlorophyll content increased.
I have got the negative heritability (-3%) for Harvest Index in pooled analysis for RILs. But interestingly the heritability for harvest index was high in individual year (75% and 91%). My design was alpha lattice and 300 RILs were evaluated in two stress seasons for heat tolerance in Chickpea. Analysis was done in SAS proc Mixed model.
Could you please tell me why I got these results and if it is okay then how to interpret the results?
Cool season pulses such as chickpea, lentil, grass pea, faba bean, etc are affected by a number of root and foliar diseases. Empirical observation revealed that there was minimal incidence of root diseases (wilt and dry root rot) during this crop season in both chickpea and lentil. However, Stemphyllum blight was most severe in lentil. In late down chickpea, we observed significant effect of phyllody and other foliar diseases. In grass pea as well, powdery mildew appeared in severe form ac compared to other diseases in preceding crop season. Whether it should be assumed that occurrence of one disease affects the intensity and severity of other plant diseases??
Hello,
Considering sustainability and environment negative impacts of animal based products, I would like to calculate food footprint in a Portuguese university campus through students inquiring. For instance, to inquire individual lunch intakes of protein animal based (e.g.: beef, pork, chicken, dairy, etc.) and protein planted based (soya, beans, lentils, chickpeas, etc.) and calculate water usage, plus measure carbon footprint.
So, any suggestion on how to calculate food carbon footprint?
Thanks
Pedro
In Bundelkhand region of Central India, Asphodelous tenuipholius is major problamatic weeds on farmers field. Any suggestions from weed scientists
I have determined CWSI using the theoretical approach of Jackson et al., (1982) based on canopy temperature measurement in chickpea. at the final stages of crop growth some of my values of CWSI under moisture stressed treatments are higher than 1 (1.2 -1.4). usually the value of CWSI ranges between 0-1. some of the publication also showed higher values such as 1.15, 1.2 etc, but they did not explain the reason for the values exceeding 1. what may be the possible reasons for that?
In chickpea, little information is available on the impacts of irrigation on dry root rot and very less information is known about how the disease is affected by different methods and levels of irrigation.
I tried ACN and methanol but uric acid is not soluble in these two. Also, my sample is infested chickpea flour. Is there any hplc method for analysis in such a sample matrix?
I have not observed phyllody infected chickpea plants in any genotype under normal sown plantings (sown during November) at Patna (North East plain). The same set of genotypes, when gown under late sown condition (January 1) to study the effects of heat stress, expressed symptoms of phyllody (pale green foliage, bushy appearance and excessive axillary proliferation). It was interesting to note that the intensity across genotypes was variable and more prominent in irrigated than rainfed crop. Plants which were relatively free from phyllody within the genotypes maintained their disease-free condition when progressed from vegetative to reproductive stage. Whether we should conclude from the observations of the last two years that chickpea phyllody is stage-specific, and commonly encountered in heat-stressed, irrigated condition.
I' m going to analyze Transcriptional profiling of some drought related genes among field selected chickpea drought tolerant genotypes under contolled condition by RT-PCR and Real-time RT-pcr, but I don't know how and on what basis I should choose these genes ( two or three genes I want to select). please guide me to what genes should I select ??
I infested the soil with Fusarium pathogen but want to know when to apply the Basil extracts directly with the pathogen or wait for days and then add it, before sowing the seeds or after?
*Climate change
*Global warming
Recently I work on Isolation & Identification of rhizobia bacteria of chickpea & groundnut.I want to know which rhizobia bacteria can create nodule of chickpea & groundnut/peanut.Please anyone help me so I will gratitude to you.Advance thanks.
Greetings all,
After streaking the extract of crushed chickpea's nodules on YMA+Congo red, colonies that didn't absorb the red dye or had a weak absorption were chosen for Gram stain.
Rod shaped Gram - bacteria were kept as potential Rhizobia.
What identification tests can i perform before runing a nodulation test?
I want to conduct research on chickpeas.
Hello ,
I am doing an RT-qPCR experiment to assess relative expression of my gene in chickpea plant to disease. I have read that we have to validate primers and reference genes specifically to my experiment and also we should use optimum dilution to my experiment. These are my questions.
1. I have cDNA from 3 control and 3 treated samples at 6 time points . i.e 36 samples. Should I run the dilutions on all 36 samples or randomly select some. I have used 1 micro gram of RNA to convert to cDNA for every sample.
2. Same question for primer pair and reference gene validation. I have two primer pairs and 5 reference genes, which I have to validate for my experiment. Should I use all my samples or can I used some smaple cDNA to validate the, >
3. What is the best plating method/ plating map for the 96 well plate ?
FOR GROWING OF CHICKPEA KABULI VARIETY.
Hello,
I am doing a RT-qPCR and need to design a primer that spans intron-exon boundaries. I am working with chickpea plant. Can anyone of you help with the method of designing this? Here are the details of the gene
The gene is CaCAC. / AP-2 complex subunit mu.
Details from NCBI:
Genomic: NC_021167.1
mRNA: XM_004511726.3
Gene ID: 101504010
Thanks in advance.
Improved variety is one of the main factor to increase yield and production but still, the desired result may not achieved in the ground or farmers field, therefore, a combination of different factors will support and assist to bring changes and improvement in production and yield but these factors or elements should be addressed based studies, experiences and field works
"I am performing zinc biofortification in chickpea so I want to know that at what dose of Zinc (100ppm or 500ppm) , the better growth parameters at the end of the experimental trial will be seen ?"
I am finding some methods for determination of iodine (not ICP-MS) in wheat, chickpea, canola and mungbean grains.
Chickpea Kabuli variety BG-1053
The topic of my phd thesis is "Diversoty and characterization of dry root rot of chickpea caused by rhizoctonia bataticola" for which I have to study diversity.
I am working on wilt complex of chickpea, wilt caused by F. oxysporum f.sp. ciceri and black root rot caused by F. solani, so how can I identify particular Fusarium species?
Sugarcane was planted at 120 cm spacing with an objective to have intercropping of Chickpea, linseed, lentil and garlic. Sugarcane crop was sprayed with Metribuzin ( 500 g/ha) 30 days after sowing to control some weeds. Now the sugarcane crop is of 60 days old and we want to sow intercrops like Chick pea, lentil, linseed and garlic . Is it safe to grow these crops after one month of application of Metribuzin ?
Hi scientific community, can you help me in choosing the best method for purifiying my acetone water extract (50/50) of polyphenols from chickpea.
Indeed there is two methods : liquid liquid extraction or column chromatography using silica gel (apolar stationnary phase). If we choose the second how can we do to obtain an extract with a maximum yield of polyphenols in order to succeed the derivatisation.
Many thanks in advance!
I am pursuing Ph.D in plant pathology. My research topic is "Diversity and Management of Dry Root Rot of Chickpea". please also tell me the countries from where I can do post doctoral.
I am interested to map micro nutrient traits such as zinc and iron in chickpea using using association mapping approach. Can any one suggest that what type/kind of genotypes and how many genotypes should be included in the study?
hello every one,
I am working on soil born pathogen like Fusarium , i want to coat seeds with nano particles to control disease of chickpea and other economically crop. please guide me it possible or not ? if possible then please guide me to procedure for coating
.
I am trying to check the in protein quality of a chickpea cultivar and for that we need to calculate the in vitro digestibility of the chickpea protein.I am following the protocol of Hsu.et al. but m bit confused how to calculate the digestibility percentage using casein as standard.
I am interested to know the range for zinc and iron content in chickpea seeds?
Please suggest me primers for Masterovirus or Chickpea chlorotic dwarf virus?
Hello, I am using chickpea DNA to amplify a gene of size 1041 bp and I have a problem in the amplification. There are many repetitive bases in the starting and end sequence of my gene. Like ATGAAGAACAAAATATTATCATCAT is the starting sequence where you can find AAAAT in that. The end sequence is TTCTCCTCTTCCACCCTGCAAAACT and when you reverse compliment it for reverse primer you get TTTTG, which is 5bp compliment between both. so i tried with KOD High Fidelity , with DMSO and I am not unable to amplify it. But when I delete the last 6bp AAAACT and make a reverse primer without it, I am getting amplification very easily.
My question is.
1. I need full gene for cloning and sequencing
2. Is there any method to amplify this kind of gene without deleting sequences.
3. I have to clone and sequence it, what is your suggestions.
Thank you . Please suggest.
Any relation between ascochyta blight and chickpea type (desi/kabuli)?
I determine the percentage of nitrogen in Cicer arietinum plant through kjeldhal method.I apply various fertilizer dose & with or without rhizobium inoculum.After 2 month measure weight (gm) in wet & dry whole mass of chickpea plant. and determine percentage of nitrogen.I want to know generally how percent contain nitrogen at cicer arietinum plant as a whole body mass.
Hello everyone I am doing a research on chickpea plant. I have to collect the fungal infected samples of plants through various regions of country and then isolate the fungus from root stem and leaves of plants, some of the areas take 2-3 days traveling time. So I need a protocol for the preservation of my plant samples which help me in the preservation of my samples at least 3 days.
Recently my experiment on plant growth effect of chickpea with rhizobia isolate and chemical fertilizer.This experiment on pot at polyhouse.Chemical fertilizer and inoculum containing pot plant leaf end show yellow color.But which pot no added chemical fertilizer, only given inoculate that pot plant leaf are green. At first i think it may be potassium deficiency, but which pot no add any fertilizer thats pot no deficiency show.Then i think it may be over fertilizer dose is the responsible this fact.
I want to know what are the reason this yellow color of chickpea leaf of end.Please anyone help me to give suggestion
Thanks advance to him/her which researcher give me advice.
Is WR 315 chickpea genotype Resistant to all the eight races of Fusarium wilt pathogen? For phenotypeing
Recently, I work rhizobia bacteria which can create nodule at chikpea & groundnut root.But can't sequencing of this isolate.But some biochemical test perform of this isolate.I want to know which rhizobia bacteria create nodule at chickpea & groundnut/peanut separately.Anyone help me through suggest.So i will gratitude for you & advance thanks.
One of the famous example of natural control of plant disease, Take All disease Wheat caused by Gaeumannomyces graminis var. tritici through monocropping.
Is the similar kind of thing happen in the case of soybean.
I worked on R.solani and found that fungus isolated from maize plant infecting the rice, greengram, maize etc.
So whether the concept of formae specialis hold good in this case?
Presently, I am using "A helpful technique for artificial hybridization in chickpea" but want to know if there are more working protocols.
- Chickpea seeds germinate at an optimum temperature (28-33°C). I will grow plants at 28/16°C in a growth chamber and then expose them to high temperatures at the first appearance of flowers.
- I want to know that for how long this heat treatment should be given and for how many days? Let's say Should the temperature in the growth room be increased daily by 1°C, e.g. 28 to 40°C during the day and 16 to 25°C during night. or should I give the heat treatment of 35°- 40°C for 5 hrs everyday in a separate chamber and then place them back to growth chamber having 28/16°C temperature.?
In chickpea crop production, there is wet substance which appears on leaves called axalic or maleic acid, the question is, are there any genotypic differences in the production of oxalic acid and maleic acid? 2. Do management practices affect the production of these acids? 3. Do these acids have any beneficial effects on the plants themselves?
i study on effects of climate change on dryland wheat and chikpa. therfore i want know to what is the best plant growth simulation model for dryland wheat and chickpea? (similar to DSSAT. WOFOST, SUCROSE, APSIM, ...)
THANKS FOR INTEREST.
I am trying to grow chickpea plants in pots and every time they die because of blight. We thoroughly sterilise the soil, pots and everything. May I please be advised with some systemic fungicide. I have already used Fongarid, mancozeb with no success till now.
Rhizoctonia solani causes root rot of chickpea. I wish to know if there are any known resistant accessions of chickpea to this necrotrophic root rot pathogen.
I am currently working on several local varieties that are endangered.
I wonder if anyone would be interested in working with me on this project.
I work on varieties of durum wheat, soft wheat, chickpeas, carob, olive and barley.
My wish is to find a lab that could support one of my PhD students conducting a genetic characterization of microsatellites on one of these species.
I want to select resistant lines of chickpea for Ascochyta blight
In the case of inter-specific crosses of cultivated chickpea (Cicer arietinum) with C. pinnatifidum, some cross combinations were normal while in one cross combination the F1 hybrid plants were albino. What can be the reason ?
If someone can help me in getting a Rhizobial strain that infect chickpeas (Cicer arietinum) to produce N2 fixing nodules and it should have GFP/GUS/DsRED or anything like that as a visualization tag.
During direct regeneration of Chickpea, the shoot tips start to get brown just after a few day of sub-culturing to multiple shooting medium or to rooting medium and stop responding. What may be the reason?
What is the solution to this problem?
As a student of plant tissue culture, I am doing direct regeneration of Chickpea from in vitro grown explants. For root induction, I have tried MS medium alone, half strength MS, NAA, IBA, IAA, in different conc. (0.1 to 2 mg/l) in full and half strength MS, and these auxins with lower BAP conc. but found no response.
Suggest me something for root induction of in vitro regenerated shoots of Chickpea.
Also, what is appropriate for DNA quantity? Is a DNA quantity of 12ng okay? Is a primer of 1 microlitre of 2pmole okay?