Science topic

Chickpeas - Science topic

Explore the latest questions and answers in Chickpeas, and find Chickpeas experts.
Questions related to Chickpeas
  • asked a question related to Chickpeas
Question
6 answers
'm doing SNP genotyping in the chickpea association panel, I have fetched 1KB up and downstream sequences flanking SNPs. m trying to find out restriction sites at the particular position i.e. the restriction sites within SNPs. Please provide the details except for the NEB cutter.
Relevant answer
Answer
  • asked a question related to Chickpeas
Question
3 answers
I am about to start my research on hydrolysis of raffinose family oligosaccharides in chickpea (Desi variety). My aim is to reduce the flatulence causing alpha galactosides by processing i.e., soaking with the natural source containing the enzyme alpha galactosidase and to produce quick cooking dhal.
  • asked a question related to Chickpeas
Question
6 answers
Can you tell me the changing pattern of protein and carbohydrate during different period of storage in chickpea? and why?
Relevant answer
Answer
  • asked a question related to Chickpeas
Question
3 answers
Dear All
Have any effective management practice or application for controlling termite in chickpea where no irrigation facilities (rainfed crop). Please suggest which are effective and feasible for farmers
Relevant answer
Answer
If Problems coming in standing crop which are totally rainfed then? @Kouadri Mohamed EI sir
  • asked a question related to Chickpeas
Question
7 answers
I am doing research on lentil and chickpea with relay cropping, zero tillage and conventional tillage with two different sowing dates. I want to calculate the moisture related extraction patterns for such pulses. So please suggest me whether the moisture content in soil will be more in surface layer or in 45 cm depth.
  • asked a question related to Chickpeas
Question
3 answers
I was trying to isolate fusarium spores from chickpea infected tissue stained with lactophenol blue
Relevant answer
Answer
The first structure (Micrograph) is Alternaria spp.
  • asked a question related to Chickpeas
Question
1 answer
I am trying to dissolve chickpea protein isolate in water but it's not soluble even with raised temperature and constant shaking. Can anyone please suggest the appropriate method or solvent other than water in which chickpea protein isolate gets completely soluble.
Relevant answer
  • asked a question related to Chickpeas
Question
2 answers
From literature and my own experience, to culture Ascochyta rabiei without supplementing the media with chickpea powder is not possible. I am curious to know what's the active ingredient in chickpea powder which is actually required to nurture its culture and can we supplement it chemically instead of raw chickpea powder or chickpea extract?
Relevant answer
Answer
Dear @Amina Ilyas
Phytoalexins accumulate in plants or cell cultures only transiently, because they are degraded or polymerized by extracellular peroxidases. The degradation of phytoalexins may be important for the development of particular plant diseases. For example, Ascochyta rabie causes the oxidation and reduction of the phytoalexins (medicarpin and maackiain) in chickpeas. Thus a knowledge of phytoalexin catabolism will underpin the development of compounds resistant to degradation by pathogens. I have attached two pdfs. Please check whether both are useful to you.
Best wishes, AKC
  • asked a question related to Chickpeas
Question
1 answer
What is the current status of biofortification programs in chickpea. Recent progress in this research area. How many percentage of chickpeas are biofortified with agronomic, transgenic and breeding methods?
Relevant answer
Answer
  • asked a question related to Chickpeas
Question
7 answers
In my experiment with chickpea, the chlorophyll content increases with advancement in growth stages...but the photosynthetic rate was highest during flowering stage, but during pod formation stage it declined though chlorophyll content increased.
Relevant answer
Answer
@GirmaHailemichael Thank you very much. It is indeed quite a helpful suggestion.
  • asked a question related to Chickpeas
Question
10 answers
I have  got the  negative heritability (-3%) for Harvest Index in pooled analysis for RILs. But interestingly the heritability for harvest index was  high in individual year (75% and 91%). My design was alpha lattice and 300 RILs were evaluated in two stress seasons for heat tolerance in Chickpea. Analysis was done in SAS proc Mixed model.
Could you please tell me why I got these results and if it is okay then how to interpret the results?
Relevant answer
Answer
Dear Paul, I recommend you to read a very good paper on negative heritability. Despite all the resistance of the scientific community to admit it, I strongly agree with those who think that negative heritability may occur in situations were individuals grouped under similar criteria like genotype are likely to have more divergent traits. Here is the reference:
On Negative Heritability and Negative Estimates of Heritability
David Steinsaltz, Andy Dahl, Kenneth W. Wachter
Genetics June 2020 215: 343-357; https://doi.org/10.1534/genetics.120.303161
Thanks
  • asked a question related to Chickpeas
Question
26 answers
Cool season pulses such as chickpea, lentil, grass pea, faba bean, etc are affected by a number of root and foliar diseases. Empirical observation revealed that there was minimal incidence of root diseases (wilt and dry root rot) during this crop season in both chickpea and lentil. However, Stemphyllum blight was most severe in lentil. In late down chickpea, we observed significant effect of phyllody and other foliar diseases. In grass pea as well, powdery mildew appeared in severe form ac compared to other diseases in preceding crop season. Whether it should be assumed that occurrence of one disease affects the intensity and severity of other plant diseases??
Relevant answer
Answer
I fully agree with Dr. Alex Ignatov in his perspective, as even in the field of animal diseases, the incidence and severity of infection depend on this triangle (host, pathogen, and environment) and every one of these parts affects depending on the factors that pertain to it, and in general, as the doctor indicated, we rarely find two severe pathogens for the same host at the same time, in the field of our specialty, we find more than one pathogen sometimes, but one of them is a predisposing factor for the other because the former works to weaken immunity, which prepares for infection with the other. And in our field of specialization, there is the primary pathogen, which has the ability to cause disease even when the immunity is normal, and the secondary pathogen that cannot compete with the primary but is waiting for the appropriate opportunity to occur for the disease. I'm sorry because I generally answered, that this is not my exact specialty, but I tried to give my view from a general perspective on infections and how pathogens compete for disease events. My sincere gratitude Doctor.
  • asked a question related to Chickpeas
Question
4 answers
Hello,
Considering sustainability and environment negative impacts of animal based products, I would like to calculate food footprint in a Portuguese university campus through students inquiring. For instance, to inquire individual lunch intakes of protein animal based (e.g.: beef, pork, chicken, dairy, etc.) and protein planted based (soya, beans, lentils, chickpeas, etc.) and calculate water usage, plus measure carbon footprint.
So, any suggestion on how to calculate food carbon footprint?
Thanks
Pedro
  • asked a question related to Chickpeas
Question
4 answers
In Bundelkhand region of Central India, Asphodelous tenuipholius is major problamatic weeds on farmers field. Any suggestions from weed scientists
Relevant answer
Answer
You can use a general pesticide such as the glyghseat herbicide if there is no crop or if the herbicide is used in the presence of the crop You can use an optional herbicide.
  • asked a question related to Chickpeas
Question
3 answers
I have determined CWSI using the theoretical approach of Jackson et al., (1982) based on canopy temperature measurement in chickpea. at the final stages of crop growth some of my values of CWSI under moisture stressed treatments are higher than 1 (1.2 -1.4). usually the value of CWSI ranges between 0-1. some of the publication also showed higher values such as 1.15, 1.2 etc, but they did not explain the reason for the values exceeding 1. what may be the possible reasons for that?
Relevant answer
Answer
I don't know what equation you are using, but it can only be 1 or < 1 if CWSI = 1 – the evapotranspiration ratio :)
  • asked a question related to Chickpeas
Question
1 answer
In chickpea, little information is available on the impacts of irrigation on dry root rot and very less information is known about how the disease is affected by different methods and levels of irrigation.
Relevant answer
I hope that this work on different levels of irrigation in chickpea cultivars will provide information on this.
  • asked a question related to Chickpeas
Question
5 answers
I tried ACN and methanol but uric acid is not soluble in these two. Also, my sample is infested chickpea flour. Is there any hplc method for analysis in such a sample matrix?
Relevant answer
Answer
Prepare a stock uric acid solution of 100 mg/L. Dilute it to give working concentrations of 5, 10, 20, 30, 40, and 50 mg/L. Weigh 100 mg uric acid, transfer to a 1 L volumetric flash, add about 900 ml distilled water, and then add about 100 µl of 0.6 N NaOH to help dissolve the uric acid.
  • asked a question related to Chickpeas
Question
3 answers
I have not observed phyllody infected chickpea plants in any genotype under normal sown plantings (sown during November) at Patna (North East plain). The same set of genotypes, when gown under late sown condition (January 1) to study the effects of heat stress, expressed symptoms of phyllody (pale green foliage, bushy appearance and excessive axillary proliferation). It was interesting to note that the intensity across genotypes was variable and more prominent in irrigated than rainfed crop. Plants which were relatively free from phyllody within the genotypes maintained their disease-free condition when progressed from vegetative to reproductive stage. Whether we should conclude from the observations of the last two years that chickpea phyllody is stage-specific, and commonly encountered in heat-stressed, irrigated condition.
Relevant answer
Answer
I am curious to see the answer to this, and whether it is driven by heat, daylength, or other factors.
  • asked a question related to Chickpeas
Question
6 answers
I' m going to analyze Transcriptional profiling of some drought related genes among field selected chickpea drought tolerant genotypes under contolled condition by RT-PCR and Real-time RT-pcr, but I don't know how and on what basis I should choose these genes ( two or three genes I want to select). please guide me to what genes should I select ??
Relevant answer
  • asked a question related to Chickpeas
Question
6 answers
I infested the soil with Fusarium pathogen but want to know when to apply the Basil extracts directly with the pathogen or wait for days and then add it, before sowing the seeds or after?
Relevant answer
Este tipo de manejo seria, un control biologico.
primero hacer analisis del suelo para ver si hay inoculo de Fusarium (Cuantas u.f.c.)y que especie de Fusarium hay en el suelo.
Seria mejor aplicar en dos momentos, a la siembra y despues de 30 dias, ya que brasil llueva bastante.
  • asked a question related to Chickpeas
Question
4 answers
*Climate change
*Global warming
Relevant answer
Answer
Possibly yes. These two are mandated crops of ICRISAT, Patancheru, Telangana.
  • asked a question related to Chickpeas
Question
3 answers
Recently I work on Isolation & Identification of rhizobia bacteria of chickpea & groundnut.I want to know which rhizobia bacteria can create nodule of chickpea & groundnut/peanut.Please anyone help me so I will gratitude to you.Advance thanks.
  • asked a question related to Chickpeas
Question
2 answers
Greetings all,
After streaking the extract of crushed chickpea's nodules on YMA+Congo red, colonies that didn't absorb the red dye or had a weak absorption were chosen for Gram stain.
Rod shaped Gram - bacteria were kept as potential Rhizobia.
What identification tests can i perform before runing a nodulation test?
Relevant answer
Answer
Please take a look at this useful RG link.
  • asked a question related to Chickpeas
Question
7 answers
I want to conduct research on chickpeas.
Relevant answer
Answer
  • asked a question related to Chickpeas
Question
4 answers
Hello ,
I am doing an RT-qPCR experiment to assess relative expression of my gene in chickpea plant to disease. I have read that we have to validate primers and reference genes specifically to my experiment and also we should use optimum dilution to my experiment. These are my questions.
1. I have cDNA from 3 control and 3 treated samples at 6 time points . i.e 36 samples. Should I run the dilutions on all 36 samples or randomly select some. I have used 1 micro gram of RNA to convert to cDNA for every sample.
2. Same question for primer pair and reference gene validation. I have two primer pairs and 5 reference genes, which I have to validate for my experiment. Should I use all my samples or can I used some smaple cDNA to validate the, >
3. What is the best plating method/ plating map for the 96 well plate ?
Relevant answer
Answer
Dear Vishnutej Ellur,
to validate your primer i would propose to perform in silico analyses for theoretical bindin and hairpin formation. Moreover, to validate your primer for binding and production of the expected amplicon, you can use one (maybee pooled) cDNA sample (of a source known to express your gene of interest). Using this sample you can perform a gradient RT-(q)PCR to find an optimal annealing temperature. Melting point analyses will show you whether only one product is generated or maybe more than one (specificity of your oligos). After that you should have information on: optimal RT-(q)PCR condition and specificty of your primer pair.
Regarding reference gene expression you can use 5 or more genes of non-modified expression under our experimental conditions). However, it is also ok to use one, two or three references for expression normalization (see various publication available via NCBI Pubmed).
  • asked a question related to Chickpeas
Question
11 answers
FOR GROWING OF CHICKPEA KABULI VARIETY.
Relevant answer
Answer
25°C and you can go to 30°C for a fast germination.
  • asked a question related to Chickpeas
Question
3 answers
Hello,
I am doing a RT-qPCR and need to design a primer that spans intron-exon boundaries. I am working with chickpea plant. Can anyone of you help with the method of designing this? Here are the details of the gene
The gene is CaCAC. / AP-2 complex subunit mu.
Details from NCBI:
Genomic: NC_021167.1
mRNA: XM_004511726.3
Gene ID: 101504010
Thanks in advance.
Relevant answer
Answer
Dear Vishnute,
As I understand, You need to design custom primers for real time PCR. Do you consider TaqMan or only Sybr? I strongly recommend you to use TaqMan to estimate of gene expression (mRNA).
For me, first of al you should present for yourself exact structure of your gene with introns and exons. It is very comfortable for me to use VectorNTI, but if you can not an opportunity to use it, please use Your preferable soft.
If you haven't any soft - you can easily do it in powerpoint or even on the sheet of paper and intefrated functions of NCBI. But you should view the last 20 bp in each exon end and next exon start: ex1/ex2 connection with 40 bp (20 bp from the end of ex1 and 20 from the start of ex2).
Next, you have to choose your future TaqMan probe on the base of ex1/ex2 connection. If you use LNA or MGB (provided by companies that can produce your you primers after your design) you can use only 15 bp to do your probe. But if no (cheeper) you should use about 25-30 bp (depends on the sequence) to receive Tm about 65oC. To check probe Tm please use https://www.idtdna.com/pages/tools/oligoanalyzer of something by your choice.
After probe design (may be it is not a final probe because of subsequent analisys and quality estimation) you have to use primer3 like Mohammed said, and design forward and reverse primers in automatic way by soft.
Arter that your primers Tm (it is preferable) should be about 59-61oC and your probe Tm about 65-70oC.
Finally, using https://www.idtdna.com/pages/tools/oligoanalyzer you can estimate dG of your primer/primer primer/probe hetero and selfdimers. If dG<-3 it is ok, but better dG>0
To check potential reaction effectiveness your should use http://unafold.rna.albany.edu/?q=mfold/DNA-Folding-Form for your primers and probe, amplicon. It provide you information about secondary structures under experimental conditions and after that you can correct conditions of reaction to increase effectiveness.
As your understand it is only general information. The best way to design for me. But of course you can easily design your primers with commertiol soft or with a help of appropriate companies, like Primetech (they provide full volume of work from design to reaction optimization) http://buyolig.com/
I hope that it will usefull for you.
  • asked a question related to Chickpeas
Question
1 answer
Improved variety is one of the main factor to increase yield and production but still, the desired result may not achieved in the ground or farmers field, therefore, a combination of different factors will support and assist to bring changes and improvement in production and yield but these factors or elements should be addressed based studies, experiences and field works
Relevant answer
Answer
The choice of a suitable variety for you climatic conditions.
Irrigation and fertilization management is also a limiting factor
  • asked a question related to Chickpeas
Question
11 answers
"I am performing zinc biofortification in chickpea so I want to know that at what dose of Zinc (100ppm or 500ppm) , the better growth parameters at the end of the experimental trial will be seen ?"
Relevant answer
Answer
Dear Ravindra Kumar Panigrahi, This document might be of use in relation to zinc deficiency.
  • asked a question related to Chickpeas
Question
8 answers
I am finding some methods for determination of iodine (not ICP-MS) in wheat, chickpea, canola and mungbean grains.
Relevant answer
Answer
No Sir Ivan Andújar I just want to determine concentration of iodine uptaken after foliar application of KI.
  • asked a question related to Chickpeas
Question
6 answers
Chickpea Kabuli variety BG-1053
Relevant answer
Answer
The best temperature for growing chickpea seedlings is about 25 °C .
  • asked a question related to Chickpeas
Question
1 answer
gene expression
Relevant answer
Answer
You could try measuring expression of aquaporins or even delve into the expression of enzymes implicated in the polyamine synthesis.
Have a look below:
  • asked a question related to Chickpeas
Question
4 answers
The topic of my phd thesis is "Diversoty and characterization of dry root rot of chickpea caused by rhizoctonia bataticola" for which I have to study diversity.
Relevant answer
Answer
Look to characterize the range of variability in the fungal pathogen use morphological and pathogenicity testing.
Develop a standardized assay for the pathogenicity and morphological differentiation.
Test a range of chickpea cultivars for their pathogenicity.
Develop a evaluation of endophytes of chickpea and test the isolates for biological control of charcoal rot.
Test out factors of systemic acquired resistance for its influence.
Test a range of mycorrhizal and rhizobia for their influence on the disease.
This would make a good thesis if these are well planned and executed.
  • asked a question related to Chickpeas
Question
7 answers
I am working on wilt complex of chickpea, wilt caused by F. oxysporum f.sp. ciceri and black root rot caused by F. solani, so how can I identify particular Fusarium species?
Relevant answer
Answer
Characters of F.oxysporum on CLA.
Macroconidia are formed in pale orange, usually abundent, sporodochia. the macroconidia are short to midium in length, falcate to almost straight, thin walled and usually 3-septate. The apical cell is short and is slightly hooked in some isolate. The basal cell is notched or foot-shaped. Macroconidia are formed from monophialides on branched conidiophore in sporodochia and to a lesser extent from monophialides on hyphae. microconidia usually are 0-septate , may be oval, elliptical or reniform (kidney-shaped), and are formed a bundantly in false heads on short monophialides .Chlamydospores are formed a bundantly in hyphae on the agar surface by most isolates .
Characters of F.solani on CLA:-
Macroconidia are relatively wide, wide straight to slightly curved, 3-7 septate with rounded ends and found abundantly in cream and less frequently in blue or green sporodochia. oval ,ellipsoidal or reniform ,0-or 1-septate microconidia are formed in round false heads on relatively long monophialides. some isolate are homothallic and my produce red or orange perithecia. Chlamydospores are produced abundantly in pairs in hyphae an in the agar.
Leslie and Summerell (2006).The Fusarium Laboratory Manual.
Best Regard
  • asked a question related to Chickpeas
Question
3 answers
Sugarcane was planted at 120 cm spacing with an objective to have intercropping of Chickpea, linseed, lentil and garlic. Sugarcane crop was sprayed with Metribuzin ( 500 g/ha) 30 days after sowing to control some weeds. Now the sugarcane crop is of 60 days old and we want to sow intercrops like Chick pea, lentil, linseed and garlic . Is it safe to grow these crops after one month of application of Metribuzin ?
Relevant answer
The half life of Metribuzin is about 30-120 days. So if you had high rainfall conditions, and I guess sandy soil, the Metribuzin would be reduced by half by now, in the best scenario, because it would be washed out quite a bit. There would still be too much of it for sensitive crops like pulses. You had a rather low dose, so you could be lucky, but I would not risk it.
  • asked a question related to Chickpeas
Question
2 answers
Hi scientific community, can you help me in choosing the best method for purifiying my acetone water extract (50/50) of polyphenols from chickpea.
Indeed there is two methods : liquid liquid extraction or column chromatography using silica gel (apolar stationnary phase). If we choose the second how can we do to obtain an extract with a maximum yield of polyphenols in order to succeed the derivatisation.
Many thanks in advance!
Relevant answer
Answer
Thank you very much Dr Silver for your precious answer. As I understand in the final step, we will mix all the extracts (hexane, ethyl acetate,methanol,50%water) and after this we will eliminate the solvents as we entend to analyse the total polyphenolic composition by GC MS using BSTFA for derivatisation.
The problem is how to be sure that our sample is cleaned from other impurities such as sugars, amino acids...
Thank you very much for your precious answer
regards
  • asked a question related to Chickpeas
Question
5 answers
I am pursuing Ph.D in plant pathology. My research topic is "Diversity and Management of Dry Root Rot of Chickpea". please also tell me the countries from where I can do post doctoral.
Relevant answer
Answer
thanks a lot sir
  • asked a question related to Chickpeas
Question
1 answer
I am interested to map micro nutrient traits such as zinc and iron in chickpea using using association mapping approach. Can any one suggest that what type/kind of genotypes and how many genotypes should be included in the study?
Relevant answer
Answer
Please have a look at these documents...
  • asked a question related to Chickpeas
Question
2 answers
hello every one,
I am working on soil born pathogen like Fusarium , i want to coat seeds with nano particles to control disease of chickpea and other economically crop. please guide me it possible or not ? if possible then please guide me to procedure for coating
.
Relevant answer
Answer
Hello
Please have a look at pdf attachments.
Good luck!
  • asked a question related to Chickpeas
Question
7 answers
I am trying to check the in protein quality of a chickpea cultivar and for that we need to calculate the in vitro digestibility of the chickpea protein.I am following the protocol of Hsu.et al. but m bit confused how to calculate the digestibility percentage using casein as standard.
Relevant answer
Answer
It is good.
  • asked a question related to Chickpeas
Question
5 answers
I am interested to know the range for zinc and iron content in chickpea seeds?
Relevant answer
Answer
Please have a look at enclosed PDF..
  • asked a question related to Chickpeas
Question
2 answers
Please suggest me primers for Masterovirus or Chickpea chlorotic dwarf virus?
Relevant answer
Answer
Is this paper any help to you..?? 
  • asked a question related to Chickpeas
Question
6 answers
Hello, I am using chickpea DNA to amplify a gene of size 1041 bp and I have a problem in the amplification. There are many repetitive bases in the starting and end sequence of my gene. Like ATGAAGAACAAAATATTATCATCAT is the starting sequence where you can find AAAAT in that. The end sequence is TTCTCCTCTTCCACCCTGCAAAACT and when you reverse compliment it for reverse primer you get TTTTG, which is 5bp compliment between both. so i tried with KOD High Fidelity , with DMSO and I am not unable to amplify it. But when I delete the last 6bp AAAACT and make a reverse primer without it, I am getting amplification very easily. 
My question is.
1. I need full gene for cloning and sequencing
2. Is there any method to amplify this kind of gene without deleting sequences.
3. I have to clone and sequence it, what is your suggestions. 
Thank you . Please suggest. 
Relevant answer
Answer
you could try amplifying first with the short primer that works then a reamplification with the longer primer when the increased amount of template means you can get product with a less efficient pcr. 10-15 cycles of a 1in 1000 dilution of first round pcr should be wprth a try
  • asked a question related to Chickpeas
Question
4 answers
Any relation between ascochyta blight and chickpea type (desi/kabuli)?
Relevant answer
Answer
ICARDA scientists are working on this area.
  • asked a question related to Chickpeas
Question
5 answers
I  determine  the percentage of nitrogen in Cicer arietinum plant through kjeldhal method.I apply various fertilizer dose & with or without rhizobium inoculum.After 2 month measure weight (gm) in wet & dry whole mass of chickpea plant. and determine percentage of nitrogen.I want to know generally how percent contain nitrogen at cicer arietinum plant as a whole body mass.
Relevant answer
Answer
You most welcome
Houda
  • asked a question related to Chickpeas
Question
7 answers
Hello everyone I am doing a research on chickpea plant. I have to collect the fungal infected samples of plants through various regions of country and then isolate the fungus from root stem and leaves of plants, some of the areas take 2-3 days traveling time. So I need a protocol for the preservation of my plant samples which help me in the preservation of my samples at least 3 days.
Relevant answer
Answer
for 3 days you can keep your plant samples in cold condition (4-8C) in high humidity....good luck
  • asked a question related to Chickpeas
Question
14 answers
Recently my experiment on plant growth effect of chickpea with rhizobia isolate and chemical fertilizer.This experiment on pot at polyhouse.Chemical fertilizer and inoculum containing pot plant leaf end  show yellow color.But which pot no added chemical fertilizer, only given inoculate that pot plant leaf are green. At first i think it may be potassium deficiency, but which pot no add any fertilizer thats pot no deficiency show.Then i think it may be over fertilizer dose is the responsible this fact.
I want to know what are the reason this yellow color of chickpea leaf of end.Please anyone help me to give suggestion
Thanks advance to him/her which researcher give me advice.
Relevant answer
Answer
 Waterlogging is a stress on a chickpea crop and when combined with other stresses such as moisture stress, damaged root systems, disease, herbicide injury, or sodic and saline soils can be a disaster. Watering during flowering or podfill when the crop is more sensitive further increases the risk of yield loss. Avoid waterlogging and observe yellowing.
  • asked a question related to Chickpeas
Question
3 answers
Is WR 315 chickpea genotype Resistant to all the eight races of Fusarium wilt pathogen? For phenotypeing 
Relevant answer
Answer
NO
  • asked a question related to Chickpeas
Question
2 answers
Recently, I work rhizobia bacteria  which can create nodule at chikpea & groundnut  root.But can't sequencing of this isolate.But some biochemical test perform of this isolate.I want to know which rhizobia bacteria create nodule at chickpea & groundnut/peanut separately.Anyone help me through suggest.So i will gratitude for you & advance thanks.
Relevant answer
Answer
Thank you very much Prof. Houda Kawas
  • asked a question related to Chickpeas
Question
1 answer
One of the famous example of natural control of plant disease, Take All disease Wheat caused by Gaeumannomyces graminis var. tritici through monocropping.
Is the similar kind of thing happen in the case of soybean.
Relevant answer
Answer
From my experience in North America maize and soybean cropping the maize after maize or the soybean soybean systems do less than a cereal legume rotation. The ability of maize to be high yielding is about 18% higher in the maize after soybean compared to maize after maize. In soybean after maize the increase of soybean is about half of the 18% because unlike maize which gets a Nitrogen response the soybean response is strictly related to soilborne pathogens. One of the most effect ways of increasing wheat production is the planting of oats before the rotation to wheat. The pathogenicity of take is related to take all ability to oxidize Manganese putting the plant into a susceptible state from Manganese deficiency. Apparently oats stimulates a soil microflora which mobilizes the Manganese making the virulence of take all from its Manganese oxidizing capacity not so critical. The oat wheat forage soybean maize rotation with winter cover crops is very effective in building soils and improving plant health and yield including counteracting the greenhouse gases of input practices and improving environmental and economic results. 
  • asked a question related to Chickpeas
Question
1 answer
I worked on R.solani and found that fungus isolated from maize plant infecting the rice, greengram, maize etc.
So whether the concept of formae specialis hold good in this case?
Relevant answer
Answer
Dear Pankaj Kumar Mishra
The concept of formas specialis were discussed long ago in several  Books type ( Arnoldi Senguerdii Idea metaphysicæ generalis et specialis..), as taxonomic grouping allowed by the International Code of Botanical Nomenclature, that is applied to a parasite (most frequently a fungus) which is adapted to a specific host (there being minimal or no morphological differences); this classification may be applied by authors who do not feel that a subspecies or variety name is appropriate. formas specialis defined by physiological characteristics, especially as they affect pathogenicity. The abbreviation is used in binomial names, between the species name and a special qualifier
Pls. find the attached files may help
McNeill, J.; Barrie, F.R.; Buck, W.R.; Demoulin, V.; Greuter, W.; Hawksworth, D.L.; Herendeen, P.S.; Knapp, S.; Marhold, K.; Prado, J.; Prud'homme Van Reine, W.F.; Smith, G.F.; Wiersema, J.H.; Turland, N.J. (2012). International Code of Nomenclature for algae, fungi, and plants (Melbourne Code) adopted by the Eighteenth International Botanical Congress Melbourne, Australia, July 2011. Regnum Vegetabile 154. A.R.G. Gantner Verlag KG. ISBN 978-3-87429-425-6.  Chapter I. Article 4.4. Note 4.
Regards
Prof. Houda Kawas
  • asked a question related to Chickpeas
Question
2 answers
Presently, I am using "A helpful technique for artificial hybridization in chickpea" but want to know if there are more working protocols. 
Relevant answer
Answer
Thanks Prashanth for your reply. Indeed I am using the same strategy for crossing. Can you please share the working protocol for crossing if you have any?
  • asked a question related to Chickpeas
Question
4 answers
  • Chickpea seeds germinate at an optimum temperature (28-33°C). I will grow plants  at 28/16°C in a growth chamber and then expose them to high temperatures at the first appearance of flowers.
  • I want to know that for how long this heat treatment should be given and for how many days? Let's say  Should the temperature in the growth room  be increased daily by 1°C, e.g. 28 to 40°C during the day and 16 to 25°C during night. or should I give the heat treatment of 35°- 40°C for 5 hrs everyday in a separate chamber and then place them back to growth chamber having 28/16°C temperature.?
Relevant answer
Answer
Hallo Ms. Pareek,
I must agree with the comment made by Ms.  R. Pushpavalli . You need to decide the purpose for your treatment.
If you want to screen for high temperature tolerance plants, I would suggest to increase the temperature gradually in the Controlled  Environment Rooms. I am not familiar with chickpea. However, in Brassica, the arrangement of humidity and water maintenance are very important during heat treatment. 
  • asked a question related to Chickpeas
Question
4 answers
In chickpea crop production, there is wet substance which appears on leaves called axalic or maleic acid, the question is, are there any genotypic differences in the production of oxalic acid and maleic acid? 2. Do management practices affect the production of these acids? 3. Do these acids have any beneficial effects on the plants themselves?
Relevant answer
Answer
There are genotypic differences in chickpea. An un-planned "evaluation" was done by rabits that invaded one of my experiments: The kabuli chickpea cultivar Gharb2 remained untouched, while cultivar Gharb3 (low axalic acid) was eaten and  almost grazed to the ground.
  • asked a question related to Chickpeas
Question
5 answers
i study on effects of climate change on dryland wheat and chikpa. therfore i want know to what is the best plant growth simulation model for dryland wheat and chickpea? (similar to DSSAT. WOFOST, SUCROSE, APSIM, ...)
THANKS FOR INTEREST.
Relevant answer
Answer
Dear Yousef,
As per my opinion you can go with DSSAT. 
  • asked a question related to Chickpeas
Question
4 answers
I am trying to grow chickpea plants in pots and every time they die because of blight. We thoroughly sterilise the soil, pots and everything. May I please be advised with some systemic fungicide. I have already used Fongarid, mancozeb with no success till now.
Relevant answer
Answer
Dithane -M-45 is good fungicide to control Ascochyta blight. Alternatively, 'Tilt' can also be used for this purpose.
  • asked a question related to Chickpeas
Question
2 answers
Rhizoctonia solani causes root rot of chickpea. I wish to know if there are any known resistant accessions of chickpea to this necrotrophic root rot pathogen.
Relevant answer
Answer
I couldn't trace anything in literature, IIPR website, mini-core collection of chickpea for resistance against Wet root rot although information is there for Dry root rot.
  • asked a question related to Chickpeas
Question
8 answers
I am currently working on several local varieties that are endangered.
I wonder if anyone would be interested in working with me on this project.
I work on varieties of durum wheat, soft wheat, chickpeas, carob, olive and barley.
My wish is to find a lab that could support one of my PhD students conducting a genetic characterization of microsatellites on one of these species.
Relevant answer
Answer
Dear Semir Bechir Suheil Gaoua
I am interested in your project because
  • asked a question related to Chickpeas
Question
2 answers
I want to select resistant lines of chickpea for Ascochyta blight 
Relevant answer
Answer
 
Thank you for your interest.  
I guess you are working on with chickpeas . maybe we can carry out joint activities in the future . Thanks again
  • asked a question related to Chickpeas
Question
2 answers
In the case of inter-specific crosses of cultivated chickpea (Cicer arietinum) with C. pinnatifidum, some cross combinations were normal while in one cross combination the F1 hybrid plants were albino. What can be the reason ? 
Relevant answer
Answer
Research report showed that it due to poorly formed Chloroplasts during inter-specific crosses. See attached paper (2011).
  • asked a question related to Chickpeas
Question
2 answers
If someone can help me in getting a Rhizobial strain that infect chickpeas (Cicer arietinum) to produce N2 fixing nodules and it should have GFP/GUS/DsRED or anything like that as a visualization tag.
Relevant answer
Answer
thanks, i am looking for positive things
  • asked a question related to Chickpeas
Question
5 answers
During direct regeneration of Chickpea, the shoot tips start to get brown just after a few day of sub-culturing to multiple shooting medium or to rooting medium and stop responding. What may be the reason?
What is the solution to this problem?
Relevant answer
Answer
This "browning" or "blackening" as usually referred is due to the accumulation of phenolic compounds, principally because of the activation of the secondary metabolism due to the stress that in-vitro culture is causing to the explants.
For solving this problem there are many things you can try... I leave a link that may help
  • asked a question related to Chickpeas
Question
8 answers
As a student of plant tissue culture, I am doing direct regeneration of Chickpea from in vitro grown explants. For root induction, I have tried MS medium alone, half strength MS, NAA, IBA, IAA, in different conc. (0.1 to 2 mg/l) in full and half strength MS, and these auxins with lower BAP conc. but found no response.
Suggest me something for root induction of in vitro regenerated shoots of Chickpea.     
Relevant answer
Answer
Dear Batool,
You haven't mentioned the amount of BAP you use. If lower rate still doesn't help, why not remove BAP altogether and have IBA in half MS with 2% sucrose. If it still doesn't help, dip the shoot in 5 mM IBA and grow in half MS with no PGR.
  • asked a question related to Chickpeas
Question
6 answers
Also, what is appropriate for DNA quantity? Is a DNA quantity of 12ng okay? Is a primer of 1 microlitre of 2pmole okay?
Relevant answer
Answer
Hi, check in some publications.
  • asked a question related to Chickpeas
Question
6 answers
growth and productivity
Relevant answer
Answer
Studies on the effect of chickpea are available in plenty in the experiments of Agronomy in India and abroad.You can browse the internet and get some studies of your interest.