Science topic

CPR - Science topic

Explore the latest questions and answers in CPR, and find CPR experts.
Questions related to CPR
  • asked a question related to CPR
Question
1 answer
My Objective is to simulate the impact of climate change on maize yields in Isingiro District under future climate scenarios. 0.8435° S, and 30.8039° E
Where can I get the above R Scrit for simulation for RCP4.5 and RCP 8.5 from?
Will be greatful if any one who has can share with me
regards
Wycliffe Tumwesigye
Relevant answer
Answer
Hi Wycliffe Tumwesigye here is a script to download data from CMIP6 or CMIP5 using Python that can be useful for you:
"""
! pip install esgf-pyclient==0.3.0
!pip install requests-cache==0.4.1
from pyesgf.search import SearchConnection
import os
import requests_cache
requests_cache.core.CachedSession
#from pyesgf.search import SearchConnection
#import os
#import pandas as pd
import requests
from tqdm import tqdm
import xarray as xr
#import requests_cache
requests_cache.core.CachedSession
lista_modelos= ['ACCESS-CM2','ACCESS-ESM1-5','AWI-CM-1-1-MR','BCC-CSM2-MR',
'CAMS-CSM1-0','CAS-ESM2-0','CMCC-CM2-SR5','CMCC-ESM2','CanESM5',
'EC-Earth3','EC-Earth3-Veg','EC-Earth3-Veg-LR','FGOALS-f3-L',
'GFDL-ESM4','IITM-ESM','INM-CM4-8','INM-CM5-0','IPSL-CM6A-LR',
'KACE-1-0-G','MIROC6','MPI-ESM1-2-HR','MPI-ESM1-2-LR','MRI-ESM2-0',
'NESM3']
conn = SearchConnection('https://esgf-node.llnl.gov/esg-search', distrib=True)
ctx = conn.new_context(project='CMIP6',
experiment_id=['historical'],
realm=['atmos'],
variable='uas',
frequency='mon',
source_type=['AOGCM'],
variant_label='r1i1p1f1',
source_id= lista_modelos
)
ctx.hit_count
ctx.facet_counts['source_id'].keys()
# Obtain urls lists
lista_urls=[]
for i in range(len(ctx.search())):
try:
result = ctx.search()[i]
print(result.dataset_id,'..............ok')
lista_urls.append(result)
except:
pass
print('-------------------------------')
print('Lista finales')
lista_urls
# Download the first model for example
tr=[x for x in lista_urls if lista_modelos[0] in x.dataset_id]
files = tr[0].file_context().search()
lista=[]
for i in range(len(files)):
lista.append(files[i].opendap_url)
print(lista)
ds = xr.open_mfdataset([x for x in lista], chunks={'time': 120}, combine='nested', concat_dim='time')
ds_mei=ds.where((ds.lon>=-90+360) & (ds.lon<=-60+360) &(ds.lat>=6) & (ds.lat<=25),drop=True)
ds_mei=ds_mei.sel(bnds=1)
# Plot example
data = ds_mei.uas[0,:,:]
print(type(data))
data.plot.contourf(levels=35,cmap='jet',add_colorbar=True, x='lon',y='lat');
# Write the netcdf to a route
ds_mei.to_netcdf('uas_'+lista_modelos[0]+'_Historical.nc',format='NETCDF3_64BIT', mode='w')
"""
I hope it helps
Best regards!
  • asked a question related to CPR
Question
11 answers
Nuclear waste is one of the major problems posing a threat to the world. Researchers are trying to find a method for permanently disposing of this waste. The Geological Disposal of HLW is gaining importance. Will it be suitable to use granite rock for this purpose?
Relevant answer
Answer
As far as granite-hosted final waste disposals are concerned, current requirements are a long-term safety of approx.. 1 million years which is reasoned by the half-life period of plutonium isotopes and the granite´s apical part being located at a depth a greater than 300 m under ground with a good sealing capacity of the non-granitic roof rocks above.
The granite is the natural source rock of uranium (background appr. 4 ppm U) with hot granites reaching a level of 20 ppm U. Moreover, a lot of U-vein-types and low-grade large tonnage deposits (e.g., Namibia) are hosted by magmatic rocks of the granite suite.
I studied for more than 6 years mainly the Variscan U deposits in Europe which formed around 300 Ma ago, and underwent supergene alteration during a period of time of less than 60 Ma. During that time strong fracturing on a regional scale was overprinting the country rock around, its wall rocks and the granite themselves which display a characteristic joint pattern. There were also mantle plumes sparking basic and alkaline volcanic rocks in the period of time younger than 60 Ma. Neither the structural, nor the temperature events have affected the U-bearing granites and their U deposits. This can be proved by a meticulous U/Pb age dating, paleogeographic and terrain analyses during the recent past including the study of the U/Pb equilibrium (< 0.8 Ma).
On the other hand, there are also self-sealing capacities to be observed in the granites caused by nontronite (smectite group clay mineral) and kaolinite-group phyllosilicates) which developed along with post-granitic hydrothermal processes and per descensum supergene alteration. The immigration of meteoric and hypogene fluids is hampered despite of the strong fracturing to be observed especially in shallow granites.
By and large, where mother nature has accumulated and preserved uranium for more than 300 Ma , human beings should not try and create by hair-splitting arguments a dangerous setting which does not exist. There is no doubt that radon and radiation is harmful to men but taking into account the three important issues: Time, distance and thickness may minimize the risk of causing radiation-induced diseases.
HGD
  • asked a question related to CPR
Question
1 answer
How to Incidence of LCP (Left-handed circularly polarized ) or RCP (right-handed circularly polarized) polarized wave at any unit metasurface in CST?
I want to design a metasurface for circular dichroism as the reference paper is attached. I have designed the attached paper in CST but I am not getting the same result. I am using a plane wave of RCP and LCP.see the attached image.
Relevant answer
Answer
I suggest you plot the same things that they have plotted. For instance, plot your graphs against frequency in GHz rather than wavelength in nm.
Also plot the same thin on the vertical scale, such as reflection coefficient or absorption rather than the real part of Reflectance-Transmittance-Absorbance, which I don't understand.
Their plot is either the magnitude or magnitude squared (power) more likely, I think.
  • asked a question related to CPR
Question
2 answers
I'm wondering to understand the SDSM package. Did the SDMS package modified for the RCP scenario?
Relevant answer
Answer
I think Dr Jasia Bashir may help you with this problem. You may contact her through the below-mentioned link.
Good Luck
  • asked a question related to CPR
Question
3 answers
Is there a blood flow test setup that can measure the amount of blood a CPR device delivers from the heart to vital organs during compression?
Relevant answer
Answer
In normal heartbeats, the stroke volume (the amount of volume that the heart pumps in each beat) can be calculated by echocardiography. If echocardiography can be performed during CPR, stroke volume can be calculated. However, since the compressions applied to the chest during CPR may not be equal, there may be errors in the calculation. Another challenge is the difficulty of performing echocardiography while performing CPR. If it is a very necessary situation, a few beats can be calculated and averaged. Kind regards...
Normal kalp atımlarında ekokardiyografi ile stroke volüm (kalbin her atımındaki pompaladığı volüm miktarı) hesaplanabilir. CPR esnasında ekokardiyolgrafi yapılabilirse stroke volüm hesaplabailir. Fakat kişilerin yaptığı CPR sırasında göğüse uygulanan kompresyonlar eşit olmayabileceği için hesaplanmasında yanlışlıklar olabilir. Diğer bir zorluk CPR yapılırken ekokardiyografi yapmanın zorluğudur. Çok gerekli bir durum ise bir kaç atım hesaplanıp ortalamaları alınabilir. Saygılarımla...
  • asked a question related to CPR
Question
7 answers
Ventilation during adult cardiopulmonary resuscitation (CPR) is poorly understood. Therefore, guideline recommendations are limited. The use of waveform capnography is in part recommended to monitor frequency. Other ventilation measurements such as tidal volume or inspiratory pressure are not regularly obtained, especially when a bag-valve system is used. The use of new monitoring devices can improve guideline adherence and could lead to better understanding of ventilation during CPR. Different EMS systems have varying levels of training, equipment and resources during CPR of out-of-hospital cardiac arrest (OHCA) patients. To better understand the current state of ventilation monitoring during OHCA CPR researcher/practitioner feedback and international perspectives on this question are needed and very much appreciated.
Relevant answer
Answer
Current guidelines recommend giving the maximum feasible inspired oxygen during CPR based on the premise that restoring depleted oxygen levels and correcting tissue hypoxia improves survival.
  • asked a question related to CPR
Question
6 answers
The study of ventilation during adult cardiac arrest remains challenging due to the unexpected nature of sudden cardiac arrest and the limited resources/personnel on site. This is especially true for interventions that influence outcomes when applied early in the cardiac arrest phase. Therefore, animal models (i.e. pigs, dogs), manikins, human cadavers and computer models have been used to study intra-arrest ventilation. Also, some data has been made available from registries and clinical studies in humans.
While the possible answers to my question heavily depend on the respective research question, personal perspectives on the well known experimental models, as well as lesser known models for this niche of cardiac arrest research, would be very much appreciated.
Please note, that I do not to intend to discuss airway management during cardiac arrest. Although, I'm aware that both intra-arrest ventilation and airway management are closely connected.
Relevant answer
Answer
Yet to be developed
  • asked a question related to CPR
Question
18 answers
Hello everybody,
My research is related to kinetic facade for building energy efficiency. I am using EnergyPlus to do simulations at the moment. I also want to study how my facades work in future climate change scenarious.
Could someone let me know where I can download the epw. file related to RCP 2.6, 4.5, 6.0 and 8.5?! I would so much appreciate your help!
With the best regards,
Anh Tu Pham
Relevant answer
Answer
Hello,
The software Meteonorm (https://meteonorm.com/en/) allows to obtain future weather data on the basis of the IPCC Scenarios.
  • asked a question related to CPR
Question
14 answers
In simulation practice/training, are there set standards for monitoring quality of a resuscitation attempt? beyond rate/depth of compressions and time off chest?
Relevant answer
Answer
The ERC and AHA guidelines recommend teaching CPR using CPR feedback devices. In my opinion, the simplest device is CPRMeter 2. Relatively cheap and at the same time very nice in terms of science and research.
  • asked a question related to CPR
Question
18 answers
In my research I came across a relatively large number of criminal manslaughter cases where death was caused by improper CPR administration (about 30 cases in 10 years all over Russia). The validity of the established practice remains to be established because Russian criminal law provides for immunity from criminal prosecution for harm done negligently in exceeding the limits of extreme necessity (Part 2 Article 39 of the Russian Criminal Code).
Trying to broaden my research a came across a vast number of articles on Good Samaritan Laws in the common law countries, and, as far as I understand, they provide immunity only for civil charges.
Is there any research on the criminal liability for providing improper emergency care or any case law on it?
Relevant answer
Answer
Good Samaritan Laws affirm that: Anyone who renders aid or rescue services in good faith as the result of an emergency that was not caused by such person, in actions that are not willful or gross negligence, are granted immunity from legal action for any mistakes or actions that lead to further injury or death
  • asked a question related to CPR
Question
10 answers
Hi, I am currently undertaking a species distribution modelling project using maxent and RCP predictions.
However I am encountering issue where when I put it the required number of replicates (5) it will complete the first replicates (labelled 0) and then stop displaying an error saying layer bio 1 is missing and then failing to produce the further replicates. Any help would be much appreciated.
Relevant answer
Answer
The error occurs due to the difference in cell size. If your layers are in ASCI format, open it with notepad and check the followings -
ncols
nrows
xllcorner
yllcorner
cellsize
In all layers, all these parameters should be the same, if different you can clip again.
Sailesh
  • asked a question related to CPR
Question
2 answers
There are total of nine GCM from CIMP 6, and I am confused which model suits best for my study . I want to determine change in land suitibility with respect to 3 SSP, RCP 2.6, 4.5 And 8.5 for year 2060.
I would be grateful to your response.
Thank you
Relevant answer
Answer
Hi Arjun,
There is no right or wrong GCM perditions as long as you are forecasting the future. Different GCMs will predict different results and this model uncertainty need to be addressed and/or reduced in future forecasting.
V. Daksiya
  • asked a question related to CPR
Question
3 answers
Two weeks since cardiac arrest with 30 min CPR and ECMO. Unresponsive with clinical coma. Blinking spontaneously. Do you see the missing AP gradient. What would be your assessment from now.
Relevant answer
Poor ...
  • asked a question related to CPR
Question
2 answers
I am currently conducting a meta-analysis (using RevMan 5.3) for one of my classes.
I am interested in comparing the clinical pregnancy rate (CPR) between spontaneous ovulation and HCG-triggering in frozen-thawed embryo transfer.
The included articles either present a CPR per cycle, or per embryotransfer, so I have made two subgroups. I have one article that presents data for CPR per cycle, as well as CPR per embryotransfer, in the same sample.
My question is: can I include that article in both subgroups? Or does that mean I'm using the "same data" twice when I can't?
Thank you for any answers!
Relevant answer
Answer
This can be done by sub group analsysi.What will happen is that the software will automaticaly seprate the two groups you have spoken about and find an effect size and heterogenity for each of the groups this will help you compare the two groups
  • asked a question related to CPR
Question
4 answers
I have read in some articles about unstable crack growth which is sometimes referred to as RCP, however it seems that there is a clear difference between unstable crack growth and RCP. According to a paper from Leevers, P. (2001; ISBN: 0-08-0431526 📷 pp. 3322±3329 ;see attached image), he differentiated between an unstable crack growth which follows a slow crack Growth (SCG) when a critical value K1c is reached and an RCP which also follows SCG, however in a different way. I am grateful for any kind of explanation.
Relevant answer
Answer
Dear Mario,
RCP-Rapid crack propagation (RCP) is a phenomenon in which a long fast-moving brittle crack can propagate in a material body. Cracking of glass plates and frozen lakes is an example of RCP. RCP can also occur in pipes. Cast iron pipes and plastic pipes under certain conditions may also experience this phenomenon. Cracks are thought to initiate at internal defects on an impact of impulse event and can travel long distances quickly. RCP occurs in pressurized systems with enough stored energy to drive cracks faster than energy is released. Cracks tend to have a smooth fracture surface. RCP is affected by temperature, energy driving force, material, pipe size and processing efforts.
Unstable crack occur at load control, when the maximum load is reached, i.e. as soon as the preceding stable growth tends to occur under constant load.
The major differences are enlisted below.
(a) RCP can occur at fatigue striation load and material can get failed. There are fluctuations of stress. Maximum load is not required. There is no constant load. it can be instant fail.
Unstable crack growth occurs when the maximum load is reached, i.e. as soon as the preceding stable growth tends to occur under constant load.
(b) RCP occurs in pressurized systems with enough stored energy to drive cracks faster than energy is released.
For unstable crack, the stress-strain energy released, together with the energy supplied from the outer load goes to kinetic energy and to what is required by the dissipative region at the crack edge to sustain crack growth.
(c) RCP is smooth surface while unstable depicts brittle surface.
(d) RCP or Stable- Onset of stable crack growth (RCP) occurs at point S and fracture occurs at point F.
Unstable- During unstable crack growth, the stiff machine cannot supply the energy needed for dissipation in the crack edge region, and therefore all this energy is supplied by energy release from the stress-strain field in the specimen.
(e) RCP- RCP can be characterized by high crack speed, smooth surface with large plastic deformation, wavy propagation of the crack along the extrusion direction. It can be described by LEFM parameters, dynamic fracture resistance and dynamic fracture toughness. RCP is most common in plastic pipe as the majority of field failures in piping are attributable to slow crack growth (SCG) fractures or rapid crack growth. Shape is almost uniform. The crack edge generally accelerates to a very high velocity, often several hundred meters per second, and sometimes to a few thousand meters per second. The energy required for conversion from a static to a dynamic state of the structure is provided by stress-
Unstable- Shape of a small crack is generally non‐uniform growth. In addition, the deceleration and subsequent acceleration of crack growth corresponds to the transition from unstable to stable crack growth. Strain energy release from the body, sometimes assisted by energy supply from the loading device.
Ashish
  • asked a question related to CPR
Question
5 answers
Here is a question for everyone that I am currently stumped on:
Is there some standardized metrics or quality targets for in-hospital cardiac arrests rates?
Its related to the work I am doing to implement CCOT at SPH. The CCOT literature uses a variety of measures and it gets a little confusing:
· Code blue (all types) per 1000 admissions or per 1000 discharges
· Cardiac Arrest (only code blue with CPR) per 1000 admissions or per 1000 discharges
· Code blue or Cardiac arrest excluding critical care areas (i.e., ED, ICU, CCU, CSICU, OR/PACU) per 1000 admissions or discharges
I looked through CIHI and it does not look like they have any stats on in-hospital cardiac arrest rates that I could find. We keep track of code blue data, but I don’t think it is reported to any external organizations. The UK and Australia have done rapid response systems for far longer, but I haven’t come across any official standardized metrics or definitions of what is considered good, bad or ugly in the way of targets.
Thoughts?
Thanks in advance for any assistance you can offer.
Vini
Relevant answer
Answer
I agree with Nikola Bradic
  • asked a question related to CPR
Question
5 answers
Hi,
I have to excite the metasurface with the circularly polarized source(RCP and LCP). and I have to measure the Co-Pol and Cross-Pol Reflection coefficient from that. Any software is O.K
Thanks in advance
Relevant answer
Answer
Hello,
1)floquet port, fpr periodic structure
2)digital port excitation for single unit
links:
Thanks,
  • asked a question related to CPR
Question
6 answers
Teamwork is one of the most important components of non-technical skills in cardiopulmonary resuscitation. Efforts have been made more than two decades ago to clarify the dimensions of teamwork in a resuscitation situation. The purposes of this group are to share the experiences and knowledge of experts on the factors that influence teamwork, training programs or guides to promote teamwork, teamwork assessment tools, and teamwork barriers to resuscitation. I hope that by sharing teamwork knowledge and skills, we will play an important role in promoting the care of critically ill patients. so you can share your experiences, knowledge, and suggestions for improvement in CPR.
Relevant answer
Answer
Frequent mock exercise improves familiarity with equipment, medicines, maneuvers, consequences; develop synchronicity and synergy.
  • asked a question related to CPR
Question
3 answers
I am postgraduate student who is very stuck with some statistical analysis.
I am trying to calculate the biodiversity of continuous plankton recorder (CPR) data of phytoplankton which has been resolved to genus level. I was originally wanting to calculate average taxonomic distance but have had some technical difficulties there so have resulted to trying to find a different biodiversity index.
I know all the indexes have pros/cons based on research question, but am struggling to find anything to help inform my decision. So far am leaning towards Hill numbers?
If anyone had any advice about these biodiversity indexes, or could point me in the direction of some useful references, that would be very helpful!!
Relevant answer
Answer
For plankton biodiversity analysis, Shannon -Weaver index is the most popular index. You can measure it by using software like: R Srtatistix, Past etc.
Like you, I already identified plankton at genus level also find difficulties to do some statistical analysis. You can get technical help about using software from seniors or supervisor.
  • asked a question related to CPR
Question
7 answers
Aim: quantile mapping with scarce data
Limitation: 13 years of data only
Goal: climate projection (RCP 4.5 and 8.5)
Relevant answer
Answer
Thank you @Anne Marie ....I am going through the NASA NEX-GDDP... It looks promising
  • asked a question related to CPR
Question
14 answers
According to the new ERC 2015 Guidelines on Resuscitation
Relevant answer
Answer
Sure? For lay-people...?
  • asked a question related to CPR
Question
6 answers
I have recently repeatedly observed pulmonary haemorrhage in association to an appropriate use of the LUCAS device by different team for OHCA CPR. This was very different from haemorrhagic secretions, that can somtimes occur during prolonged CPR.
Any thoughts or experience?
Thanks
Tobias
Relevant answer
Answer
Are asking strictly on the Physio device or others (such as the Zoll model)?
  • asked a question related to CPR
Question
4 answers
I need the answer for research
Relevant answer
Answer
GCMs don't provide an accurate description of the local climate. To overcome this discrepancy, downscaling is applied to produce local-scale climate predictions based on corresponding GCM scenarios.
Downscaling can be done either dynamically or statistically.
Dynamic downscaling is computationally intensive as it makes use of the lateral boundary conditions alongwith with regional-scale forcings to produce Regional Climate Models (RCMs) from a GCM.
Statistical Downscaling is a 2-step process consisting of: 1) the development of statistical relationships between the local climate variables and large-scale predictors, and 2) the application of such relationships to large-scale output.
For more info, you may refer to:
  • asked a question related to CPR
Question
11 answers
Referred breath as energy and like to know the phenomenon when a person encounters Near Death Experience and revives back after CPR where does the breath/energy stay interim and return back to ignite consciousness.
Relevant answer
Answer
This is simply mechanics, without mystery. Where people record sense perception and experience after dying, before being brought back, it is probably just that period before neuron death rapidly floods the brain.
  • asked a question related to CPR
Question
4 answers
Dissertation is questioning whether CPR is the main priority in a traumatic cardiac arrest.
Relevant answer
Answer
HI Tammy In attached file, you can find HOT algorithm. Hope that will help Nikola
  • asked a question related to CPR
Question
13 answers
During CPR, we usually change the way of cardiac compression from maual to mechanical after 10-15 minute of CPR?
Is it reasonable ? which is the better way of cardiac compression?
Relevant answer
Answer
According to research, it seems that mechanical compression device is the same as human... But we have to know that:
1° it compares mechanical with highly trained human team using at least 2 people. Do we always have high performing teams in reality?
2° manual compression are done in good conditions were there is for example enough space to move around the patient,...
3° the studies DO NOT compare rcp while moving fro example to the cath lab or to ecmo. And that makes a lot of a difference.
In our HEMS base rcp protocol, we use a mechanical device. First we start manually and we place the device as soon as possible (usually after 8-10 min). Good training in placing the device allow to reduce drastically the waste of time and is mandatory. Than we have 2 more free hands.In our experience the device is really helpful and much better then manual when we decide to MOVE while doing the rcp to avoid loosing time to reach the cath lab or the ecmo team. It is not possible to deliver good manual compression in a moving ambulance and even more in a helicopter. So, we believe, this is where it makes a difference.
  • asked a question related to CPR
Question
3 answers
In march a 9-year-old boy came to our outpatient clinic because of a wound in the occipital part of his head. In autumn of 2016 the boy was in a car crash, underwent CPR and was in an ICU. In ICU a pressure ulcer developed on the boy’s head. The boy’s wound was treated for more than 5 months without success, and the parents decided to come to our hospital.
We applied a polymeric membrane dressing (Polymem). The wound eventually closed after 5 months but very soon it opened again (it measures approximately just 25 % less than in march). After 2 months there is almost no progress. The wound itself is clean, with very little exudate, and the wound bed covered with granulation tissue.
Does anyone have any idea what we could do to promote the healing of the boys wound or what might be the cause that the wound does not heal?
Thank you for your answers!
Hubert Terseglav
Relevant answer
Answer
allergic reaction occur, so check the antibodies
study the patient's history if any other injury have same problem
  • asked a question related to CPR
Question
8 answers
We usually do ABGA during CPR. But, I think that the ABGA during CPR is unnecessary because ABGA during CPR doesn't reflect the acid bas status of the patient. And, it may interfere the resuscitation performance.
Relevant answer
Answer
Epinephrine is less effective in the setting of metabolic acidosis.  The blood value may not reflect intracellular values due to poor perfusion, but it is the only guide available. pH less than 7.00 correlates with poor outcome and may be used to guide further efforts. Central venous blood may be easier to obtain during CPR but provides a less-accurate assessment. 
  • asked a question related to CPR
Question
13 answers
We had a 23 years old who had a gunshot injury in the right 3rd space 2 hours ago. A right chest tube was inserted and it drained 250 cc blood with complete lung expansion. ECG and cardiac enzymes were normal. Echo was performed which showed a mild hemopericardium with no tamponade. CT Chest showed a right sided lung contusion with mild pericardial collection and the bullet in the subcaribal region. He was monitored in ICU on IV fluids, Tramal 50 mg TID and perfalgan 1gm QID. Patient was fully conscious initially and remained same for 8 hours then started to be agitated. He was ventilated electively due to CO2 retension 9 hours after trauma because of respiratory acidosis. F UP ECHO showed mild rim of pericardial effusion with no tamponade. F UP CT showed the same CT findings presented earlier. Patient was kept ventilated for 3 days on no inotropes. Suddenly he became severely agiatated again on ventilator with good blood gases. He arrested for 40 minutes despite good CPR. An urgent subxiphoid drainage window was performed and drained only 50cc. ECG regained again for 2-3 minutes then arrested again and he was declared dead. Where was the problem? What we missed in the management? What are the possible causes of death?
Relevant answer
Answer
Sorry do you mean subcarinal? 
Could this patient have had embolism and the culprit being cerebral rather than cardiopulmonary? The fact of good blood gases and no tamponade suggests this.
it would be interesting what the autopsy would reveal.
  • asked a question related to CPR
Question
4 answers
We need some questionnaire to assess knowledge, attitudes and skills of CPR students health sciences.
Relevant answer
Answer
Thank you very much Vedran Markotić
  • asked a question related to CPR
Question
1 answer
I need to perform a western for Artemisia annua genes CYP and CPR. Does anybody has antibody? If anybody has antibody for even one of these genes, could you pl. provide a small aliquot?
Relevant answer
Answer
No, I´m not. sorry.
  • asked a question related to CPR
Question
33 answers
I'm doing some work on improving outcomes in patients who suffer traumatic cardiac arrest.
Case history: a 30 year old male motorcyclist is brought to the emergency department having crashed his motorbike into a tree. He has multiple injuries, but was conscious with a palpable pulse at scene. He deteriorates en route. On arrival in your resuscitation room he is not breathing and has no palpable pulse.
Quick poll - who would initiate chest compressions in this case?
Relevant answer
Answer
I would not do external massage, but open chest / clamp descending thoracic aorta/ open pericardium while ET intubation is being done. Others would argue REBOA is warranted because of dismal prognosis.
  • asked a question related to CPR
Question
3 answers
hello, I built a Bicistronic P450 and CPR plasmid in pcw vector. It could not work well while the gene be constructed in pcw can express well respectively. I notice that the second gene can express in this bicistron. Does it mean that the first gene has expressed, but without activity?(I didnot do an SDS-PAGE)
Another question: Does the length of link sequences between two genes will affect the first gene‘s expression? 
PS: my internal sequence TAATAGGTACCTAAGAAGGAGATATAATATG
bolds are stop codon and start codon; italics are RBS.
Relevant answer
Answer
Thanks for Kevin and Jolanta. I will run a SDS-PAGE.
  • asked a question related to CPR
Question
3 answers
Hope you guys have already red the assessment tool of the newly revised AHA BLS for adults (see attachment in JPEG). The answer is "sometimes yes", if the victim/patient is less than 5 minutes from an unwitnessed or witnessed sudden death. However, should the proper use of body mechanic be emphasised on the assessment tool of the AHA BLS for adults especially the proper use of hands, arms and body to pump the chest?
Relevant answer
Answer
Exact Body Mechanics is necessary. My instructor told me that even some doctors don't know how to perform CPR correctly.
Please visit the link
  • asked a question related to CPR
Question
5 answers
In our population the carbondioxid values are increasing in the first period of time (~15 minutes), if CPR is performed with LUCAS. After 30 minutes of cpr or more in some cases the carbondioxid values are than decreasing lightly.
Relevant answer
Answer
Frank,
I hope this email finds you well.
As to your query, the use of ETCO2 level has been used to quantify the quality of resuscitation efforts in cardiac arrest patients in a couple of Emergency Medical Services that I consult for. It has been suggested in several studies that a decline in ETCO2 is an indicative of the need to swap the personnel providing compressions during CPR. Likewise, the Return of Spontaneous Circulation, or ROSC as it is known in the United States, results in a rapid rise in ETCO2, in the same patients. This is irrespective of the use of a Lucas. This characteristic rise has replaced pulse controls for identifying ROSC in resuscitation algorithms.
As to the specifics of your question, the medical history of your "some" cases would need to be known in order to provide a thorough answer to it. Some of the details should include the time between loss of spontaneous pulse to initiation of CPR, time to intubation, previous cardiac or pulmonary issues or any metabolic history that would influence a patients ability to exchange gases at the cellular level.
  • asked a question related to CPR
Question
11 answers
Feedback devices seem to improve compliance to Guidelines in CPR. Are there any outcome studies proving improved outcomes (i.e. ROSC, admission to hospital) in humans?
Relevant answer
Answer
Dear Paul, I Think that Answer is YES! Look This Attachment:
"Depth, Rate of Chest Compressions During CPR Impact Survival in Cardiac Arrest" -  Febbraio 6, 2015
DALLAS, Tex -- February 6, 2015 -- The depth of chest compressions and the rate at which they were applied make a significant impact on survival and recovery of patients, according to 2 studies published in Circulation and Critical Care Medicine.
Contrary to popular belief, the studies showed that cardiopulmonary resuscitation (CPR) compressions deeper than 5.5 cm resulted in decreased survival, possibly because of collateral damage to other internal organs.
Previously, investigations and guidelines indicated that deeper compressions were better. The American Heart Association's (AHA) 2010 CPR guidelines recommend compressing the chest at least 5 cm without providing any upper limit.
“Most people do not recognise that it takes quite a bit of thrust to compress the chest 2 inches,” said Ahamed Idris, MD, by UT Southwestern Medical Center, Dallas, Texas. “About 60 pounds [27 kg] of pressure are required to reach this depth, but in some cases a burly fireman or well-intended volunteer can go way past that amount, which can harm the patient.”
The researchers also found that the rate at which chest compression was applied was most important. Compression rates of 100 to 120 per minute were optimal for survival when other factors were considered.
“Survival depends on the quality of the CPR,” said Dr. Idris. “Both the depth of chest compressions and the rate at which they are applied can have important results for patients in the first moments of cardiac arrest.”
About half of responders are giving chest compressions too fast, with about a third above 120 compressions per minute, and 20% above 140 per minute, said Dr. Idris.
The researchers will continue to oversee innovative clinical trials to test the early delivery of interventions for serious trauma and cardiac arrest as part of a federally funded consortium aimed at advancing prehospital emergency care.
The Resuscitation Outcomes Consortium (ROC) has enrolled tens of thousands of patients to test prehospital interventions to improve outcomes in severely ill or injured patients before they are transported to a hospital.
SOURCE: University of Texas Southwestern Medical Center
  • asked a question related to CPR
Question
14 answers
Published or unpublished data about cardiac arrests (affecting children or adults) occurring on school grounds.
Relevant answer
Answer
Thank you. One last question: how many were there it total for adults? 
  • asked a question related to CPR
Question
79 answers
I think it's not feasible, but someone else doesn't agree.
Relevant answer
Answer
If they need analgesia, they don't need CPR; if they need CPR, they don't need analgesia.
  • asked a question related to CPR
Question
6 answers
Method of CPR:
1. D.R.A.B.C
2. D.R.C.A.B
Checking the pulse of the patient/victim: method 1 is done but, method 2 not...why?
Relevant answer
Answer
Hi Roger, I very much agree with Alexander. Before I even got involved in CPR research, in my own CPR teaching I would actually train my students (back in the day of 9-hour courses) to really take the carotid pulse. I would do this by verifying their pulse count on another student against my own (simultaneously). This was very time consuming, and I was convinced of two things, it was very difficult, and despite the concerns about loss of peripheral pulse (e.g., radial) due to shock, the carotid was still a bad choice due to high rate of false negative, and I figured in case of pulselessness, most likely false positive due to feeling one's own pulse. As an EMT, I did find radial pulse much easier in conscious patients. So, I was not at all surprised as a researcher when studies by Dick and colleagues in Germany showed that carotid pulse was unreliable to point of uselessness. They never tested an alternative pulse, as far as I recall. So, at least in lay CPR, the pulse check is omitted once apnea has been confirmed. In traditional CPR, rescue breaths are attempted, which serves as another check, that you have a relatively lifeless victim. Of course, in continuous compression CPR, increasingly advocated for laypersons, sometimes for the wrong reasons, you do go right for compressions after determining apnea, which is a bit more extreme, but a largely useless check of the carotid pulse isn't going to help so much. I have watched videotaped performances of hundreds of laypersons doing skill tests immediately after CPR training, and the opening sequence, even if done well (as done relatively more often after our video) takes a lot of time from unresponsiveness check to first compression and really long when done badly. What I might do personally is probably a little different from AHA or ILCOR standards, but I would not take a carotid pulse on anyone including myself--it's stupid, but I did not say I wouldn't check a pulse. You can find a bunch of CPR papers and letters to the editor back a few pages on my profile. Also, if you look at the editorial "Pump and Blow Isn't Hit or Miss" on the first page of my profile, I reference an important editorial by Douglas Chamberlain and Mary Fran Hazinski about CPR training, not about the pulse check, but about CPR education, that you might find interesting. Bob
  • asked a question related to CPR
Question
6 answers
I am a PhD student at Swansea University looking at the psychological and health impact of failed dispatcher-assisted CPR on an emotionally close relative following out of hospital cardiac arrest.
Relevant answer
Answer
There was a recent NEJM article that found found more positive outcomes was associated with family members being present in the room......http://www.nejm.org/doi/full/10.1056/NEJMoa1203366
  • asked a question related to CPR
Question
3 answers
Acid-base Status, Carbon Dioxide Tensions, Oxygenation Status, Pupil Responses, Presenting Rhythm, Duration of CPR, Brain Stem Reflexes, Level of Consciousness, Electrophysiological Findings, Prediction-of-Awakening Scores
The most useful predictors are the presenting rhythm, duration of resuscitation, bystander CPR, early defibrillation, and the level of consciousness after resuscitation. However, an accurate prediction of good or poor outcome cannot be made with certainty in every case
Relevant answer
Answer
Sorry could you be more specific in your question? You mean as a predictor of neurological recovery or what factor is important in converting a FV?
  • asked a question related to CPR
Question
3 answers
One of the most critical points of CPR is to check for efficacy of chest compression on blood circulation. In some cases, we tested CPR value by using echocardiography after the 3rd cycle of cardiac massage. This could be helpful into decision of stopping CPR, as the LV (or RV) are more or less thrombized. Any ideas?
Relevant answer
Answer
Whilst I would agree with some of the above points I would caution the feeling that the probe can be stuck on the chest to answer some key questions. To answer those key questions, the sonographer must be skilled so that they are quick (images in less that 10secs, or during compresions, knwledgeable so that they do not misinterpet a dilated RV asa PE and miss the inferior akinesis, suggesting that the dilated RV with poor function is an RV infarct.