Science topics: GeoscienceAustralia
Science topic

Australia - Science topic

The smallest continent and an independent country, comprising six states and two territories. Its capital is Canberra.
Questions related to Australia
  • asked a question related to Australia
Question
5 answers
I need reviewer for Taylor edited book from Computer Science area from Canada or USA or UK and or Australia University. URGENT!
Relevant answer
Answer
Thank you but its outdated.
  • asked a question related to Australia
Question
4 answers
The Australia-China bilateral relationship was based on strong economic and trade complementarities and longstanding community and cultural links. Chinese investment into real estate in NSW, WA, Queensland, while Australia was a haven for Chinese students and the young generation to migrate to a beautiful country far away from the Communist mindset, compulsory Army training, and rigid control of fundamental rights. In 2018 annual two-way trade between China and Australia reached almost 215 Bil AUD. Iron ore, gas and coal make up the bulk of Australian exports to China (more than AUD 79 billion), but Australian service industries – was led by education and tourism. In 2021, bilateral trade between the two countries amounted to approximately US$231.2 billion, a rise of 35.1 percent year-on-year, however, relations have soured dramatically in the last 5 years and militarily Australian strategy had hardened against China forcing Australia to join AUKUS-The UK, US and Australia have announced a historic pact to counter China. Emerging cooperation between India and Australia is widely understood as a response to the China challenge that is facilitated by multilateral groupings like the Quad. But the recent signing of the Australia–India Economic Cooperation and Trade Agreement (ECTA) on 2 April suggests the bilateral relationship is much more substantial.
Relevant answer
Answer
Australia trade relation specially with China shows the movement from export to import or consumption driven growth. Australia terms of trade is also likely to fall due to export’s reduction, resulting downturn pressure on Australian dollar.So Australia should maintain trading partnership with China by developing two way investment proposal.
  • asked a question related to Australia
Question
5 answers
Hello Researchers,
I am considering publishing a Case Study report on Cross-cultural and Comparative Analysis of Leadership Styles on Australia and Bangladesh in an international open-access journal for international business. I had received a high distinction for this report in my MCom program at an Australian university. I would like to ask you all about the possible format of the report for publication, I would like to ask for your recommendation on the matter.
I wrote the report focusing on Comparative and cross-cultural leadership styles between Bangladesh and Australia. The two cultural models I chose were Hoffsteid and Globe study.
Since the report was written in the Case Study format and most international journals use the traditional journal article format, do you think it would be better to reformat the report into a traditional journal article format (Intro, Lit. Review, Rationale, Research Methods, Main Body, Findings, Conclusion, and Recommendations)?
Or do you think there is scope for publishing it in a Case Study format? I know Case Study articles are popular in Medical journals, but not sure if there are any Case Study international journals in the fields of international business and management.
Please let me know your opinion at your earliest convenience.
Warmest Regards,
Neaz
Relevant answer
Answer
From my personal experience in conducting research and publication, I can say that you can publish the case study in an appropriate journal. First, search on google or publishers like Springer, and Elsevier, for the relevant journals. If your targeted journal publishes a case study then it is possible to publish the report, however, it should be as per the format of the journals. If you want to publish a research paper on your case study, then it would be better if you restructure of your paper.
Almost all of the journals have a similar structure but are different in some contexts like word limit for abstract, reference style, and so on.
You are welcome to ask for any further clarification.
Thanking you
  • asked a question related to Australia
Question
1 answer
I need to know about research on date palm based on drought occurances and develop recommendations based on technologies, or research and development that can provide solutions to farmers in australia to ensure resillience during drought times. Growing and production in drought and desert climates, and report on how farmers here in australia can implement date trees on their farms to increase resillience during times of drought when other crops would otherwise fail.
Relevant answer
Answer
Date palm tolerates dry weather and low atmospheric humidity up to 5%, as is the case in desert areas, while an increase in relative humidity in palm-growing areas leads to physiological imbalances such as fruit blotching, blackening of the tail, and rotting of the fruits.
Growth and development of date palm (Phœnix dactylifera L.) seedlings under drought and salinity stresses African Journal of Biotechnology Vol. 4 (9), pp. 968-972, September 2005 Available online at http://www.academicjournals.org/AJB ISSN 1684–5315 © 2005 Academic Journals
Effects of Various Quantities of Three Irrigation Water Types on Yield and Fruit Quality of ‘Succary’ Date Palm
Prospects for the Study and Improvement of Abiotic Stress Tolerance in Date Palms in the Post-genomics Era
INTERACTION INDICATORS BETWEEN PLANT AND ENVIRONMENT DATE PALM (PHOENIX DACTYLIFERA) AS AN EXAMPLE European Journal of Agricultural and Rural Education (EJARE) Available Online at: https://www.scholarzest.com Vol. 3 No. 5, May 2022 ISSN: 2660-5643
This is some research on date palms that may be of interest to you
  • asked a question related to Australia
Question
2 answers
needed o know about research on date palm based on drought occurances and develop recommendations based on technologies, or research and development that can provide solutions to farmers in australia to ensure resillience during drought times. Growing and production in drought and desert climates, and report on how farmers here in australia can implement date trees on their farms to increase resillience during times of drought when other crops would otherwise fail.
Relevant answer
Answer
And that applies to your country of Pakistan, which joined the "Middle East Green Initiative" when your Prime Minister made a pledge to be part of the 24 countries that are going to plant 40 BILLION trees to offset Global Warming.
The good thing about planting trees, is you will also help cure droughts that way. That is what the people of the Indus Valley found 3,500 years ago, chop down all the trees to fire the millions of bricks to build your 1,000 cities, and the rain stops, and all of your five million people must abandon every one of those 1,000 cities forever.
  • asked a question related to Australia
Question
2 answers
Hello Everyone, I am working on paleoclimate of northwest Australia. I have been searching for the sediment discharge/sediment load of ''Ord River'', ''Victoria River'' and ''Fitzroy River'' but cannot find it anywhere. Can anyone guide me where can i find the sediment discharge data of the mentioned rivers?
Thank you
Relevant answer
Answer
It depends on what sort of data you want - often monitoring of rivers is poor, especially for sediment data. This kind of work might be useful to you:
  • asked a question related to Australia
Question
6 answers
Reading Bruce Chatwin's Songlines where he describes how the songlines work amongst the aborigines of Australia, creating a spiritual network of Australia based on individual totems and their narratives. not only do we, therefore, have religion, but also psychology, geography and its symbolism (I recently read a Muslim writer who claimed the latter for Islam) but a sense of knowledge connected to both individuals and tribes.
Does this reach back in time thereby representing a means of transmitting knowledge over a long distance but also preserving it?
Relevant answer
Answer
Indigenous Australians connected the song to the landscape and totem. Chadwick points out that the original Greek legends, although many came from the Middle East, are based on totems and could have begun in the same way. Early Greek poetry was connected to song, with the Greek bard a singer.
  • asked a question related to Australia
Question
6 answers
This was collected at Townsville, Queensland, Australia. It does not match any of the native species known from Townsville or elsewhere in Queensland, so perhaps it is an introduced species?
Relevant answer
Answer
Kindly check it as Vicia tetrasperma (L.) Schreb.
  • asked a question related to Australia
Question
6 answers
I am currently working on the use of metacognitive abilities to improve teacher proficiency of teaching mathematics in Primary schools. I am looking for international collaborators from Japan, Germany, Singapore, Netherlands, USA, Canada and Australia.
Thank you
Relevant answer
Answer
Those with creative thinking skills and intelligence
  • asked a question related to Australia
Question
15 answers
A colleague is interested in the problem of mega-fires. If there are scientific papers for the United States, Australia or France, there is little research for South America. In France, a mega fire can be identified from 1,000 ha, in the United States or Australia from 10,000 ha.
Are there any studies in South America (e.g. Chile)?
Are there objective criteria for defining a mega fire?
Many thanks!
Relevant answer
Answer
Nicolas Maestripieri The answer to your question is here:
"definition of megafire as fires > 10,000 ha arising from single or multiple related ignition events. We introduce two additional terms – gigafire (> 100,000 ha) and terafire (> 1,000,000 ha) – for fires of an even larger scale than megafires."
  • asked a question related to Australia
Question
11 answers
Burning offer
I think it would be wiser to unite all the flora of the world first. In today's world, where the mobility of species and globalization have increased, limited local or country flora is no longer sufficient. For this, we must combine the family identification keys and number the species like a license plate, so that each species has a code number. Even if the name changes, the code remains the same. Endemics should be lettered with their own country code and Continents with their own code. (endemic, Asia, Turkey, 1750) ASTUR11750, or (America, USA, 18420) AMUSA18420. This code can then be associated with local names.
Relevant answer
Answer
Yes, they are necessary. However, the current digital methods can reduce the consumed time and the efficiency of identification.
  • asked a question related to Australia
Question
4 answers
Taking into consideration that Australia has an active but, nevertheless, relatively small academic community, are there any signs that 'clinical' cognitive science research in Australia has really broken the barriers between the three traditionally involved disciplines, computer science, psychology and brain-related medicine, especially with the latter of the three (i.e., beyond one-off instances, or minority collaborations)?
Relevant answer
Answer
Sergii Boltivets Το γνωρίζω ήδη από τις πληροφορίες στη σελίδα σας. Μού κάνει εντύπωση που η Ελληνική είναι τόσο διαδεδομένη στην Ουκρανία. Στην Αυστραλία τη μιλούν μόνο οι Ελληνοαυστραλοί (ώς ένα βαθμό). Ευχαριστώ και πάλι.
  • asked a question related to Australia
Question
10 answers
Dear All
I am searching a collaborator from Australia who is working with fish reproductive physiology.
Relevant answer
Answer
Dear Dr Manuel
thanks, I am working with fish, reproductive physiology, endocrinology and toxicology. I am afraid that our field is different and I am unable to get your email id too.
But if you wish you can mail me for further conversation.
Regards
  • asked a question related to Australia
Question
6 answers
I'm wondering if I can gather information to study a social phenomena (artificial intelligence and ethics) in one country (Australia for example) and validate the result in another country (Saudi Arabia for example)?
Relevant answer
Answer
It's a complicated topic. Mostly it is not possible, unless all relevant features are considered (which is extremely difficult).
  • asked a question related to Australia
Question
1 answer
Anybody knows a company that can service/calibrate an ARISE EZ MATE 601S in Australia?
Our local Bio-Strategy does not provide support any more.
Thanks
Relevant answer
Answer
This manual might be helpful, have a look:
Kind Regards
Qamar Ul Islam
  • asked a question related to Australia
Question
6 answers
I'm looking for a PhD position and opportunity in one of the English speaking university in European countries (or Australia).
I majored in artificial intelligence. I am in the field of medical image segmentation and My thesis in master was about retinal blood vessels extraction based on active contour. Skilled in Image processing, machine learning, MATLAB and C++.
So could anybody helps me to find a prof and PhD position related on my skills in one of the English speaking university?
Relevant answer
Answer
You have any examination is cleared than you go for scholarship
Like in NET etc
  • asked a question related to Australia
Question
12 answers
I'm looking for Ph.D. programs (Scholarships) in Europe/USA/Canada/Australia/Great Britain.
Professors who are looking for Ph.D. candidate, I'm ready to work with any new subjects in Computer Science Field and especially in Deep Learning/Machine Learning.
I really appreciate your help!
Relevant answer
Answer
Dear Mokhaled,
I will suggest searching your interested domain/professors who are working on it and direct contact through email along with your synopsis.
  • asked a question related to Australia
Question
3 answers
Thanks to all who joined the discussion of useful COI primers for shark DNA amplification. I have narrowed down our efforts to the Ward et al. 2005 primers, but there are 2 sets, 2 forward and two reverse, we would like to narrow down the search to which set is likely to perform best, and specifically with Odontaspis noronhai, the primers listed are:
FishF1-5TCAACCAACCACAAAGACATTGGCAC3,
FishF2-5TCGACTAATCATAAAGATATCGGCAC3,
FishR1-5TAGACTTCTGGGTGGCCAAAGAATCA3,
FishR2-5ACTTCAGGGTGACCGAAGAATCAGAA3
(PDF) DNA Barcoding Australia's fish species. Available from: https://www.researchgate.net/publication/7550627_DNA_Barcoding_Australia's_fish_species [accessed Jul 01 2021].
Has anyone used these with Odontaspis, or even Odontaspidae? Thanks again.
Relevant answer
Answer
Brenden S Holland I have used all primers from Ward et al. 2005 and Ivanova et al 2007 in a few shark species. The primers from both papers bind to approximately the same COI region, so you get the same segment (the barcoding region). You can do a mix with all and try in your samples.
There is no reference mtDNA for O. noronhai and just a few partial sequences. You can try to align the primers to a related species - the mtDNA of Odontaspis ferox is available. You can align the primers and see if they are close enough, and have an idea if they are likely to amplify.
I had some deep-sea shark species that fail to amplify with all Ward and Ivanova primers, so be careful. You may have to design new primers. If that is necessary, look to related species with available mtDNAs.
  • asked a question related to Australia
Question
4 answers
For example I have last 50/100 years of rainfall data for a large country like Brazil or India or Australia. Can I project rainfall for the next 100 years from that data on yearly, monthly, daily and even hourly basis in terms of intensity? What are the methods and models can I use for that?
Relevant answer
Answer
Using CMIP5 GCM models and different RCP scenarios you can project futrue rainfall for next 100 years. But for this you need 30 years historical daily weather data like minimum temperature, maximum temperature, rainfall and solar radiation. For more details check out https://agmip.org/. But i dont have any idea of your second question of disintegrating monthly data into daily, or daily rainfall to hourly.
  • asked a question related to Australia
Question
7 answers
On a scale of 10 - In different countries -Effectiveness of online Primary education (Scores)
1 UK - 4.9
2 Canada - 5.6
3 USA -5.6
4 Australia - 6.6
5 France 4.6
6 Germany - 6.1
7 Japan - 3.1
8 China - 5.4
Source- Economist - taken from DB (26-6-2021)
Is there any research available or ongoing for COVID-19 impact and effectiveness of online teaching in higher education (Graduate, Master degree course, Professional Courses (Medical & Engineering)
Relevant answer
Answer
  • asked a question related to Australia
Question
25 answers
The Duke and Duchess of Sussex announced their plans to keep their castle in England, and, in addition, to live in Canada and also to stay for part of the year in California. Further, they love Africa and they frequently make trips to Australia, New Zealand, and enjoy visiting the Orient.
Relevant answer
Answer
I would have their problems ...
  • asked a question related to Australia
Question
10 answers
Hi I am doing soil erosion modelling applying RUSLE equation. But I was searching for the most appropriate and latest method to determine K-factor for a large area like India or Brazil or Australia? Please suggest. Thank you in advance for your time and effort.
Relevant answer
Answer
The K factor is determined by soil series or type. At the scales suggested, there are typically many soil series, and thus many or at least several K factors to consider. These could be mapped in GIS by soil type, and then weighted average determined for country by unit area of each soil series.
  • asked a question related to Australia
Question
5 answers
Hi All,
I have a very particular question, I used to use skim milk powder as a cryoprotectant for lactobacilli that would face freeze-drying, (skim milk would give the best viability). However, in Australia, if we want to register a product as organic it is necessary to provide a certificate of origin for all bulk agents. Unfortunately, Oxoid put out of the market the analytical-grade skim milk and I can't use any other milk that is not manufactured in Australia/New Zealand. Does anyone have an idea what other options are for lactobacilli cryoprotectants?
Thank you so much
Art
Relevant answer
  • asked a question related to Australia
Question
5 answers
is there a coincidence that the global fires of siberia have covered the entire northern hemisphere with smoke .... global fires in australia - the southern hemisphere. - and it is in this year that a global outbreak of lung infections occurs?
I suggest the same way for other respiratory infections and COVID-19 too ...
one new brick in the wall
Wildfire Smoke May Raise COVID-19 Risk, Study Says
Kiser, D., Elhanan, G., Metcalf, W.J. et al. SARS-CoV-2 test positivity rate in Reno, Nevada: association with PM2.5 during the 2020 wildfire smoke events in the western United States. J Expo Sci Environ Epidemiol (2021). https://doi.org/10.1038/s41370-021-00366-w
"We found that a 10 µg/m3 increase in the 7-day average PM2.5 concentration was associated with a 6.3% relative increase in the SARS-CoV-2 test positivity rate, with a 95% confidence interval (CI) of 2.5 to 10.3%. This corresponded to an estimated 17.7% (CI: 14.4–20.1%) increase in the number of cases during the time period most affected by wildfire smoke, from 16 Aug to 10 Oct.Significance Wildfire smoke may have greatly increased the number of COVID-19 cases in Reno. Thus, our results substantiate the role of air pollution in exacerbating the pandemic and can help guide the development of public preparedness policies in areas affected by wildfire smoke, as wildfires are likely to coincide with the COVID-19 pandemic in 2021.
Introduction"
3 Meo SA, Abukhalaf AA, Alomar AA, Alessa OM. Wildfire and COVID-19 pandemic: effect of environmental pollution PM-2.5 and carbon monoxide on the dynamics of daily cases and deaths due to SARS-COV-2 infection in San-Francisco USA. Eur Rev Med Pharmacol Sci. 2020 Oct;24(19):10286-10292. doi: 10.26355/eurrev_202010_23253. PMID: 33090440.
Relevant answer
Answer
No. Effects would be local to sub-regional. Besides, if you are looking for global effects you have to remind that 85% of the area burned in the world comes from tropical grasslands and woodlands. Fire crisis elsewhere like in Australia and Siberia won't change that.
  • asked a question related to Australia
Question
5 answers
I am trying to know if there are recent projects/ research on earth-based material for construction in Australia specifically, and what are the used methods (e.g. cob- adobe-rammed earth)
Relevant answer
Answer
Hi Steve,
How are you?!
I am not sure about research specifically, but there is definitely construction happening - this is an ecovillage that I have been researching over the last couple of years, on the Central Coast of NSW, near Gosford. https://nararaecovillage.com/2020/12/natural-building-at-narara-ecovillage/ There are many different forms of construction being experimented with. Drop me an email if you want to look at potential for collaboration.
Regards
Emma
  • asked a question related to Australia
Question
1 answer
Looking for information on Clinical Neuropsychology Postdoctoral positions that focuses on Pre/ Intraoperative/ Post-Operative Brain Mapping and Cortical Stimulation in the United States / France/ Europe/ Australia.
Also looking for information on Centers/ Hospitals and names of Clinical Neuropsychologist who routinely perform these protocols (Brain Mapping and Cortical Stimulation) for Awake Brain Surgeries in US, France/ Europe and Australia.
Any information on any of the above would be greatly appreciated.
Relevant answer
Answer
You may wish to contact David Loring PhD, ABPP, FAAN at Emory University Brain Health Center. He would likely be aware of such fellowships. http://neurology.emory.edu/faculty/neuropsychology/loring_david.html
  • asked a question related to Australia
Question
3 answers
Can you recommend conferences in the field of BioChemistry and specifically applicational BioChem in Australia in the near future, and with a close deadline for submission (range of 3-6 months)?
It can be also a New Zealand located conference, or, alternatively, it can be another conference that can be accessed by Zoom or similar technologies.
Thank you in advance!
Relevant answer
Answer
Thank you! Ajit Singh & Jeffrey McCormack! This is a very useful piece of information, indeed :-)
  • asked a question related to Australia
Question
12 answers
Dear All,
Hope you are staying safe and sound.
I`m conducting a quantitative research in my PhD to test and validate a conceptual framework that has been developed based on the data from 26 interviews. I`m struggling with finding participants to fill the survey for the quantitative phase of my PhD as the inclusion criteria are too specific and narrow. I`m looking for social entrepreneurs who are either Co/founder, CEO, or managing director of social enterprises in Australia and use online communities related to their enterprise. I know that generally, it is said that I need to find at least 100 and preferably 150 participants for the quantitative research, however, it is a very difficult and challenging task for me to reach these numbers considering my limited time and resources.
I would appreciate if you could let me know how I can justify a sample size with between 50-70 participants and whether it is justifiable or not in a mixed-method research, in which interviews are the main data collection tool.
Thank you in advance for your assistance.
Relevant answer
Answer
Hi Behnam Abedin, you may consider using G*Power, a free power analysis program, to calculate your minimum sample size. Following is the reference article, download link and learning video. Hope it would help.
1. Reference article
Faul, F., Erdfelder, E., Buchner, A., & Lang, A. G. (2009). Statistical power analyses using G* Power 3.1: Tests for correlation and regression analyses. Behavior research methods, 41(4), 1149-1160.
2. Software Download (Windows and Mac)
3. YouTube: Using G*Power to Determine Sample Size
  • asked a question related to Australia
Question
30 answers
Some countries have age barrier to get scholarship for conducting PhD. For example, in Germany 35 years, Australia 40 years. But so far I know there is no research that revealed younger people perform better in doing PhD and vice versa.
Relevant answer
Answer
Death is the age limit of earning a doctorate of PhD.
  • asked a question related to Australia
Question
3 answers
Particularly interested in the Eyrean Barrier, but would also be of value to have a dataset of the well known barriers around Australia. (for example, figure 1 from this article)
Relevant answer
Answer
Thanks Stuart - doesn't look like what I am after unless I am just missing it? I am after the actual shapefiles showing features such as the Eyrean barrier (which is a line on a map, not a region as such).
  • asked a question related to Australia
Question
3 answers
Methods for assessing group work in mathematics and the case for individualized student's contributions were discussed. Countries considered were US, UK, Canada, and Australia.
Relevant answer
There are multiple approaches, including: peer learning, small group learning, workshops, team work, and project learning.
  • asked a question related to Australia
Question
17 answers
New Covid virus came to Europe, Australia then will spread other part of the world, do you think that previous vaccine will effective for recent virus?
Relevant answer
Answer
The new variant of SARS-CoV-2, known as VUI–202012/01 or lineage B.1.1.7, was identified in United Kingdom. It is more able to transmit than other variants. According to experts COVID-19 vaccines will be effective against new variant of SARS-CoV-2.
  • asked a question related to Australia
Question
6 answers
Our team in Australia is looking for international collaborators to do a joint research towards scientific publication on psoriasis treatment using our controlled-release formulation. If you are interested, please send us an email to: info@anni.com.au and we will give you details.
Relevant answer
Answer
Thanks for your message. Can you send me your CV and contact details to:
  • asked a question related to Australia
Question
8 answers
I have been waiting for a review from a journal in Australia for about a year. It will be one year on November 21, 2020. Is this normal? What do you think about the journals extending their review times that much?
Relevant answer
Answer
Let me update my previous answer. The following scenario may happen:
  • The corresponding author submits the complete manuscripts according to the journal according to its requirement.
  • The journal editor finds the right reviewer(s) to review the manuscript.
  • One of the reviewers can't review the manuscript for some reasons such as he/she has no time to review or he/she may have been died. Or, he/she might reject the invitation of review. Then the journal editor should return back to the previous step.
All in all, the journal editor should return back with an answer to the corresponding author within a maximum of six months.
  • asked a question related to Australia
Question
1 answer
Researching school principal development models in Australia
Relevant answer
Answer
Try looking at the papers of the last year's Economics Nobel laureates, that is Michael Kremer, Esther Duflo and Abhijit Banerjee. They performed several on filed experiments on improving the educational outcomes in various countries.
  • asked a question related to Australia
Question
1 answer
Hello
I am interested in mental health literacy research with a CaLD community in Australia. I am seeking collaborator or guide/supervisor for this project.
I would love to hear from experienced academic interested in this topic.
Thank you in advance.
Regards
Bharat
Relevant answer
Answer
willing to collaborate. I am currently the director of a hospital providing psychiatry, deaddiction, rehabilitation and center of LD
  • asked a question related to Australia
Question
5 answers
How can I get the publications correctly attributed?
Please email me on andrewj.carmichael@nhs.net
Thanks.
Andrew J Carmichael
Consultant Dermatologist
S Tees
Middlesbrough
TS9 7EG
UK
Relevant answer
Answer
I used Claim Authorship function several times for at least one month but my publications are still connected with other profile.
  • asked a question related to Australia
Question
3 answers
Good day friends.
I have a few questions regarding my project.
The project is mainly focused on IoT, network traffic classification, intrusion, machines learning/deep learning.
So, my questions, here, is:
1) Is it possible to test IoT datasets that were captured in Australia in other countries, since I want the study tp base in specific country context?
2) The study settings will be based on a smart city (smart toll tag) or a smart environment. But, the datasets I’m planning to use which are captured in Australia, are datasets of weather station, (which generate air pressure, temperature, etc), smart home ( motion activated light), smart fridge, remotely activated garages door, smart air conditioner (thermostat), etc.
What do you guys think? Is it possible?
Thanks!
Relevant answer
Answer
Hello, I have doubt around it, maybe becaus I do not know in detail your idea. However, on the one hand, when we are talking about IoT, the idea is associated with a real-time data processing. On the other hand, when we talk about datasets (even very large), we are referring to a batch data processing model. If you want to recreate a new environment using data from monitoring stations...how do you ensure the consistency of both processing environments? Mainly thinking about the kind of available resources and algorithms to use.
  • asked a question related to Australia
Question
1 answer
Dear Colleagues,
It is my pleasure to announce 2020 Ural Workshop on Group Theory and Combinatorics that will be held Online, August 24th-30th, 2020. For details see http://conf.uran.ru/Default?cid=2020uwgtc .
The workshop will be organized by Institute of Natural Sciences and Mathematics of the Ural Federal University (Yekaterinburg, Russia), N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS (Yekaterinburg, Russia), and The Ural Mathematical Center (Yekaterinburg, Russia).
The workshop aims to cover modern aspects of group theory (including questions of actions of groups on combinatorial objects), graph theory, some combinatorial aspects of topology and optimization theory, and related topics.
The program of the workshop consists of 50-minute talks by keynote speakers and a number of 15-20-minute contributed talks.
Our Keynote Speakers (in alphabet ordering):
Rosemary Bailey (The University of St Andrews, St Andrews, UK)
Peter Cameron (The University of St Andrews, St Andrews, UK)
Ilya Gorshkov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Tatsuro Ito (Kanazawa University, Kanazawa, Japan and Anhui University, Hefei, China)
Alexander (Sasha) Ivanov (Imperial College London, London, UK)
Elena Konstantinova (Novosibirsk State University and Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Denis Krotov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Mikhail Khachay (N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS and Ural Federal University, Yekaterinburg, Russia)
Long Miao (Yangzhou University, Yangzhou, China)
Ilia Ponomarenko (Petersburg Department of V. A. Steklov Institute of Mathematics, Saint Petersburg, Russia)
Viktor Mazurov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Christopher Parker (University of Birmingham, Birmingham, UK)
Cheryl Praeger (The University of Western Australia, Perth, Australia)
Danila Revin (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia and N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS, Yekaterinburg, Russia)
Wujie Shi* (Chongqing University of Arts and Sciences, Chongqing, China)
Sergey Shpectorov (University of Birmingham, Birmingham, UK)
Arseny Shur* (Ural Federal University, Yekaterinburg, Russia)
Alexey Staroletov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Ying-Ying Tan* (Anhui Jianzhu University, Hefei, China)
Vladimir Trofimov* (N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS and Ural Federal University, Yekaterinburg, Russia)
Evgeny Vdovin (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Mikhail (Misha) Volkov (Ural Federal University, Yekaterinburg, Russia)
Yaokun Wu (Shanghai Jiao Tong University, Shanghai, China)
Alexandre Zalesskii* (University of East Anglia, Norwich, UK)
__
* to be confirmed
Registration
To attend the workshop please register for free until August 15, 2020 via the website http://conf.uran.ru/Default?cid=2020uwgtc .
In your registration form, you are welcome to give us some information on your mathematical interests. We kindly ask keynote speakers to register via this website to be available for mailings!
Contributed talks
If you want to contribute a talk, please prepare your one-page abstract with the template (see the website http://conf.uran.ru/Default?cid=2020uwgtc ), fill the corresponding form in "My Submissions" on the website, and upload your abstract until July 20, 2020.
We kindly ask you to name the file with your abstract as follows FirstName_LastName.tex.
Contacts
If you have any questions, don't hesitate to contact to me via e-mail butterson[at]mail[dot]ru.
Best regards, Natalia Maslova
DSc Leading Researcher, Krasovskii Institute of Mathematics and Mechanics Associate Professor, Ural Federal University 620990, Yekaterinburg
butterson[at]mail[dot]ru
Relevant answer
Answer
It's my pleasure!
  • asked a question related to Australia
Question
3 answers
Is it true that naturally occurring radioactive material from a specific type of rock is the same?
For example the gold-bearing rock in Australia and that from Tanzania.
Relevant answer
Answer
Thank you Samwel and Joseph for your answers.
  • asked a question related to Australia
Question
20 answers
Due to poverty and wealt of other peoples, many Europeans have moved to America, Australia and Canada.
Relevant answer
Answer
Dear All. I stop answering in all my Questions. Wish you all good luck.
  • asked a question related to Australia
Question
2 answers
I am looking for a book
"Radiocarbon dating practices at ANU" by Gupta and Polach, published in 1985.
Can anyone please provide the link or source from where I can get this book?
Thank you
Relevant answer
Answer
Hello Praveen,
it seems that the book is available at Abebooks.com
Hope you find it!
Roberta
  • asked a question related to Australia
Question
21 answers
In the International Marketing course at Clarion University of Pennsylvania, I want my students to get an opportunity to talk to students in other parts of the world to understand their culture and work on developing a marketing plan. Please let me know, if anybody is interested in joining hands or passing some leads. I can then share more details and a plan to collaborate.
Thank you
Relevant answer
Answer
It is very interesting, however the language barrier can prevent the experience from being more comprehensive.
  • asked a question related to Australia
Question
6 answers
Australia has been a relative success story but an outbreak in Melbourne is at a "critical stage", experts say.
Infections have surged in the past few weeks - there are now 482 active cases in the state of Victoria.
The numbers remain below Australia's March peak, but what's concerning now is that most cases are being spread locally rather than by people arriving from overseas.
In every other state, the virus has been dramatically slowed or eradicated. So what's gone wrong in Victoria?
July 03, BBC
Relevant answer
Answer
I think voluntary social distancing is more appropriate term and it does not against human right too. Unluckily, for the people of third world countries voluntary social distancing is not possible where practice of healthy behavior is not satisfactory and you can see the reality even in USA too. Yes, lockdown will be failed if we don't change our individual behavior. Again I do agree with you, we the public health specialists are totally failed to come to a conclusion and the role of WHO is still confusing. WHO is changing its decisions and recommendations again and again. They should be more bold and clear. Thanks again dear Daniel Goldman .
  • asked a question related to Australia
Question
2 answers
Hi, I'm interested to know the threshold on tree and vegetation monitoring in Australia, South Africa, Europe or any other country. Thanks :)
Relevant answer
Answer
Hi, can you explain a little more?
  • asked a question related to Australia
Question
7 answers
In my research methodology I would like to apply Dynamic Global vegetation Model to project future vegetation growth/availability under future climate projections. I found LPJ-Guess used in the previous research but couldn't find how to use at catchment scale in Australia.
Relevant answer
Answer
Hi J.C.Tarafdar,
Thank you so much for sending me the information. Just wondering do we need Linux operating system for installing CESM? Thanks
Regards
Newton
  • asked a question related to Australia
Question
5 answers
What are these countries doing differently from Europe and United States, that makes them so successful?
Relevant answer
Answer
Control of COVID-19 in Australia and New Zealand
From very early in the COVID-19 since January these countries adopted the policy of border closures, cruise-ship docking restriction, retesting people returning from other countries, putting them in quarantine, testing and tracing the contacts of SARS-CoV-2 positive cases, and sel-isolation of patients at home. They also adopted strict lockdowns, closure of schools and offices and introduced Apps to track down COVID-19 case.
This is how these countries have succeeded in limiting the disease and reducing the deaths due to COVID-19. (See attached links)
  • asked a question related to Australia
Question
3 answers
I currently finished my PhD studies in Australia and applying for different lecturer/post-doc positions in the same country. If you are working in the Australian market you should know we have to prepare a document which is named answer to key selection criteria. Despite, I have written this document several times myself but looking for samples to compare mine with them and improve. I spent a while in Google but could not find that much information. If you have this sample I would appreciate sharing it.
Relevant answer
Answer
I have inspired from the methods of the link below, hope this can help:
  • asked a question related to Australia
Question
4 answers
I would like to get vegetation type details in the MDB and the Murrumbidgee River catchment area to refer it for satellite image analysis. Please also refer any relevant articles. Thank you all in advance.
Relevant answer
Answer
The data source for vegetation mapping depends on size (land mass) of the study arearea, as well as the scale of the map. Some of the data sources for processing vegetation maps are listed below
MODIS NDVI images
LANDSAT TM, ETM+ and OLI images
SENTINEL-2 images
SPOT VEGETATION
ASTER L1T
  • asked a question related to Australia
Question
2 answers
Can anyone point me in the direction of a source for national seclusion and restraint data for the UK? I am looking to compare it to the national rates in Australia.
Many thanks
Lesley Barr
Relevant answer
Answer
Hi Lesley, you would have to report discreet rates for England, Scotland, Wales and NI as the mental health legislation and definitions vary. The NHS benchmarking network has though done some v recent work in this area which surveys all countries and would be worth looking at that if you can get access or find someone who can.
  • asked a question related to Australia
Question
1 answer
I am looking for a PhD position in Australia. I have 4 years of clinical experience in the field of Positive Parenting and also have a related publication.
Relevant answer
Answer
  • asked a question related to Australia
Question
7 answers
is it due to climate issues ?
or due to other factors?
give me suggestions, please?
Relevant answer
Answer
It is wrong to say that sand flies are not found in Australia. Please see the link below.
  • asked a question related to Australia
Question
17 answers
I am organising a database of ACAs around the world who have the power to conduct public hearings as part of their corruption investigation. I am aware most Australian ACAs have such powers but is Australia an isolated case or same can be found elsewhere?
Relevant answer
Answer
  • asked a question related to Australia
Question
5 answers
I am looking to speak with people, or be put in touch with people, who have research or practise in differentiation of teaching methods in private dance studios. Below is an outline of what I am proposing to research. I can be emailed at julie.barns@gmail.com Many thanks in advance!
An education in dance relies on a teacher's pedagogical knowledge and artistic experience. It is important for studio dance teachers to acquire pedagogical knowledge alongside their wealth of technical and artistic knowledge allowing them to dissect, question and change their practice to be inclusive of all dancers in their studio classes.
Private dance studios are available to anyone who wishes to learn dance, regardless of age, gender or motivation (recreational or otherwise). The dance community need to ensure best practice in teaching to ensure these studios encompass all who walk through their doors.
Historically, for studio teachers in Australia, pedagogical knowledge has been gained through osmosis, and while a studio teacher may have excellent technical knowledge the process through which this information is imparted has created a divide in the dance studio between gifted dancers and children who wish to dance recreationally, but are ostracised from the studio learning and teaching process due to a range of learning needs that are not being catered to. What could have been a powerful ongoing experience in a child's life is lost due to a teacher's inability to differentiate their teaching practices in the dance studio.
Whilst very few children who learn dance in studios go on to become professional company dancers, children do go on to become consumers of The Arts and dance in particular. These children may go on to become dance teachers, physiotherapists, set designers, or volunteers in theatres. They go on to recognise and value dance as a powerful tool for self expression, for physical wellbeing, for good mental health and self worth, for community building and for creating a culture of inclusiveness.
The research proposed will greatly benefit recreational and elite studio teachers across Australia, with the flow on effect making a difference in the cognitive, emotional and physical lives of our children.
Relevant answer
Answer
Julie Barns - Thank you for your question. I think you need to develop a curriculum with specific learning outcomes. You need to see how many years or blocks are required in order to graduate students? And if these years are allocated into phases, what are the educational objectives of each period? . The attached website covers several differentiation approaches that you may use. You might need to learn more about the construction of a curriculum.
  • asked a question related to Australia
Question
8 answers
Hello everyone, I'm trying to find the most practical and effective way to preserve and transport seafood tissue samples from a remote area for methyl-mercury analysis back in Australia. All the literature states that samples for this type of analysis were frozen upon collection at -18 to -20 degrees C but at the moment there isn't a freezer available at the sample site until we're back on the main island. I have considered the possibility of liquid nitrogen and a dry shipper but I have not used one before and wondering if it would stay cold enough if brought from Australia for the two-week trip. We then have the task of bringing them to Australia - in the past for genetics this was easier as I just used ethanol, but from what I've read this will be problematic due to the digestion acids used in the mercury analysis. Let me know your thoughts - thanks in advance.
Relevant answer
Answer
Darren is there any refrigeration available. A 25L N dewar that is kept in "cool conditions might work
I would be afraid that if its stored in "warm conditions the N will vent off
  • asked a question related to Australia
Question
4 answers
Hi everyone,
As a convener, I would like to invite you to submit an abstract to the session: 08a: Metal Mobility in the Critical Zone and its Implications to Geochemical Exploration in Weathered Terrains in the Goldschmidt 2020.
The description of the session is below:
Shallow mineral deposit discoveries are becoming less common and those world-class deposits are either mined out or decreasing in production. One of the fundamental challenges for mineral exploration industry in this century is targeting deeper concealed mineral deposits under the critical zone. The increase in demand for mineral resources worldwide is driving investment in developing new geochemical exploration methods for vectoring concealed mineral deposits in deeply weathered and covered terrains. Extensive older terrains of Australia, India, West Africa, Brazil and China are deeply weathered and others such as Canada and Fennoscandia are overlain by recent glacial sediments. Thus, geochemical signatures of the mineralisation and the host rock can be obscured by deep weathering and transported cover providing challenges for exploring these terrains. The purpose of this session is to bring together a number of contributions showing interdisciplinary integrated approaches for understanding physical and biogeochemical mechanisms for metal mobility from the mineralised source through the critical zone to surface. The session also invites topics discussing recent advances in developing or improving geochemical and analytical (isotopic and dating) techniques, numerical modelling and experimental methods applied for mineral exploration through the critical zone. Geochemistry of supergene ore deposits, indicator mineral chemistry, and hydrogeochemical studies are also part of this session.
Please visit the following link for more detail: https://goldschmidt.info/2020/program/programViewThemes
Finally, I appreciate your quick response to my message and if you are not able to attend, could you please circulate this invitation to other colleagues working in the same field.
Best regards
Dr Walid Salama
Senior Research Scientist
CSIRO Mineral Resources
Australian Resources Research Centre
26 Dick Perry Avenue,
Kensington, WA 6151, Australia
T +61 8 6436 8745
Relevant answer
Answer
one week from the deadline of abstract submission.
  • asked a question related to Australia
Question
7 answers
I am and accredited EMDR therapy practitioner working in a psychiatric hospital in Australia. Many of my patients take benzodiazepines on a PRN basis. I was taught that they reduce the effectiveness of EMDR therapy to the point where they should not be taken on the same day as therapy.
Can anyone direct me to research which might explain this effect, and also how long a patient needs to be benzo-free for it not to be a problem?
Thanks,
Pauline Allingham
Relevant answer
Answer
Literature says "BZDs can inhibit trauma-focused psychotherapy by promoting avoidance of exposure, numbing trauma-related emotions, and inhibiting of cognitive processing (all of which is necessary for recovery)."
  • asked a question related to Australia
Question
5 answers
Do you know of an EFL/ESL coursebook series for high school students, that has a strong focus on English-speaking cultures (such as Australia, India, South Africa)? I am mostly interested in Australia for my thesis, but any ideas are welcome.
Relevant answer
Answer
I think Australian teachers of English will know more.
  • asked a question related to Australia
Question
5 answers
I’m looking for experts in active transportation (walking/cycling), smart cities to have an interview with them for my PhD research project. I live in Australia but they can be from all around the world
Relevant answer
Answer
Hi, Negar Nili.
If you would like to work on Smart Sustainable Cities. I know that it's different of your requesting, although, I think that it is interesting, also.
I think you should consider to contact the Professor Simon Elias Bibri (link:
Simon Elias Bibri
), the Professor John Krogstie (link: John Krogstie ),
The Prof. Bibri is one of the most relevant researches on Smart Sustainable Cities. He has written a recent published book (link of the book, you can find it also in the genesis library: https://www.springer.com/gp/book/9783319739809)
Furthermore, Bibri and Krogstie have the most relevant paper on Smart Sustainable Cities extensive literature review (link of the paper, you can find it also in the sci-hub: ( )
Concerning only Smart Cities, the last reference (the paper of Bibri and Krogstie) has an interesting topic on smart cities, and they distinguish it from smarter cities (other concept, smarter cities are characterized by the omnipresence and ubiquitous ICT on city life activities).
Well, I spoke too much, I love this theme. Sorry. I hope you enjoy it.
  • asked a question related to Australia
Question
3 answers
Hi all
I am about to start a research / Dissertation in the area of fiscal policy in Australia. More specifically I Would like to start off with a Dissertation at Masters level leading to a Doctorate in the are of assessing the effectiveness of Fiscal policy. I Would like to know if there is anyone out there already in this field that I Could reach out to.
Thank you
Darren
Relevant answer
Answer
My apologies I'm not that familiar enough to produce Fiscal policy information. I'm sure your obtain resources from someone familiar. Best of luck.
Dee
  • asked a question related to Australia
Question
2 answers
I wish to develop resources for our Nursing Staff & develop a Bariatric Rehabilitation Programme.
Relevant answer
Answer
I am not from Australia but from Brasil.
I am developing a research for management of postoperative pain in bariatric patients (ERAS).
  • asked a question related to Australia
Question
3 answers
I have used following method for acid digestion :
2 g of the powdered dry sample was added with 30 ml conc. HNO3 (nitric acid, 65%, Merck, Darmstadt, Germany) steadily in a flask and the sample was left for a night. 4 ml 30 % H2O2 (hydrogen peroxide, Chempur, Poland) was added to the flask and left for five hours (Li et al. 2013). After 5 hrs, samples were heated in a hot plate at 250°C till near dryness. Then 10 ml of conc. HNO3 was added to the residue till further near dryness. The process was repeated till the completion of the digestion of organic matters from the sample. After cooling the residue was transferred to the flask and diluted with deionised water. The sample was then filtered through filter paper (Whatman #42) and transferred to the chemical resistant bottles till further analysis for As, Cd, Cr, Cu, Hg, Pb and Zn in Atomic Absorption Spectrophotometer (AAS, AVANTA, GBC, Australia).
Relevant answer
Answer
Hello, for better sample prep and avoiding evaporation of acids you need to use closed systems like teflon tubes and microwave digestion system.
  • asked a question related to Australia
Question
3 answers
Hi!
I desperately need the recent consumption trends of cement and sand (million tonnes, preferably) in:
1. Australia (national)
2. New South Wales
3. Sydney region
I've been digging online for the past few days but to no avail.
Please cite references.
If you, perhaps, have data closely related to them, you may send them as well.
Relevant answer
  • asked a question related to Australia
Question
5 answers
Pls tell me a source to download the land use map and terrain for Australia for free?
Relevant answer
Answer
Sujatha Mayadunnage Your question reads LULC Maps for Australia.
You can use the ESA CCI landcover data. It is a compositely processed data from different satellite sources such as as MERIS, PROBA-V and ENVISAT ASAR. It is an annual data series from 1992 to 2015 yielding 23 year consecutive data for various analysis. The spatial resolution is 300 m which is equivalent to three football stadiums as a pixel size. That is the limitation. However, it is a global data and Australia is fully captured.
You will need to register to be able to download the data.
  • asked a question related to Australia
Question
4 answers
Dear Tuan Zea Tan,
My research is focused on association of miRNAs to the molecular subtypes of breast cancer and their clinical significance. I'd really appreciate if you could share the research strategies and any data regarding breast cancer, and obliged thereby.
Kind Regards,
KM Taufiqul Arif
PhD Candidate | Genomics Research Center | Institute of Health and Biomedical Innovation (IHBI) |  Queensland University of Technology | 60 Musk Ave, Kelvin Grove, QLD, 4059, Australia. |m:  +61 432 106 196  | e: kmtaufiqul.arif@hdr.qut.edu.au
Relevant answer
Answer
Didn't notice your question hence the late reply. My project focuses on coding genes expression at the moment.
You can have a look at TCGA Breast Cancer collection it has well curated clinical data and miRNA-seq data through Broad GDAC (http://firebrowse.org/?cohort=BRCA ). You could also search in public repository for breast cancer dataset with miRNA data, such as the data accompanying
and thanks
Serafina Qin
for the list of relevant papers.
Regards,
  • asked a question related to Australia
Question
5 answers
Dear Professor Javidan,
Happy to be involved in the project in Australia any capacity should the opportunity arise.
Thank you
Relevant answer
Answer
Dear Professor Javidan,
Thank you for your reply and email address.
It wold be a privilege and honour for me to be involved and associated with the second phase of GLOBE research. If I can be of any assistance please do let me know. My email address is kaikee.madan@gmail.com
I look forward to hearing from you soon.
Kaikee Madan
  • asked a question related to Australia
Question
5 answers
Is there appreciable alternative to representative democracy? Representative democracy in Australia look pretty fair but with some shortcomings. Can we suggest alternative model for representative democracy?
Relevant answer
Answer
A representative democracy with REAL participation of citizens.
  • asked a question related to Australia
Question
18 answers
Dear colleagues,
At this time, I am looking for a supervisor who has a vacant PhD position in the field of power electronics and its application in power system.
I will be thankful if any of you introduces me one position in Canada, Australia, or Europe (except England).
For more information, my CV is attached to this question.
Thank you in advance.
Regards,
Amir.
Relevant answer
Answer
goto findaphd.com it may be helpfull.
  • asked a question related to Australia
Question
18 answers
I am currently in a PhD programme in Queensland University of Technology, Australia. My research project has to do with the development of a curricula framework for aged care education in an African setting. I am such of possible frameworks that I can utilise in my work.
Relevant answer
Answer
Good luck with your research. If I were you I would start litearture review on three dimensions
1) Curriculum (theory, design, implementation etc)
2) Aged Care Education
3) Africa (as context and African Education settings etc)
After having analysed those three, start combining them to form your research questions and the assertion (the hypothesis you want to prove).
Certainly you and your supervisor know better. That is just a thought!
  • asked a question related to Australia
Question
4 answers
Dear friends and researchers,
I just started my PhD journey as a new phd student, so I am preparing my proposal doc, My phd thesis in communication studies, specifically in health communication. I will investigate the role of mediated communication such as Twitter or Facebook in public health issues. I will focus on immunizations. Anti-vaccination groups make some campaigns and post many messages and posts about the risk of vaccines through social media, while the health authorities attempt to fight these movements and educate people about the importance of vaccination. I will examine the impact of public health messages of childhood vaccination on parental attitudes toward vaccinating their child. The mediated communications which address a common health concern among parents will be the focus, and I will apply my study to two different countries: Saudi Arabia and Australia.
My Question that I need your help with is: Do you think its better to do that through using Quantitative or Qualitative method by choosing a case study such as "Measles Vaccine issue" as a case study in both KSA & AUS, and use two 2 tools to collect our data (questionnaire+interview) Or (content analysis+text analysis) or (questionnaire+content analysis) that' may help to manage the research later, rather than using mixed method that needs to build questionnaires and survey for both country, which needs harder effort?
Best Regards,
Relevant answer
Answer
Trying to do a questionnaire would require recruiting over 100 responses in each of the two countries, so that is a major consideration. As an alternative, I would suggest using a coding system to make systematic comparisons between the two countries, and then following that up with either qualitative interviews, or in-depth examination of the original texts.
In mixed methods research, using follow-up qualitative interviews to understand the results of a quantitative content analysis is known a "sequential explanatory" design. Alternatively, you could follow-up the quantitative content analysis by returning to the original texts to generate a qualitative account of how any who the results came out the way they did. Here is a link to an article of mine that describes the second option:
  • asked a question related to Australia
Question
8 answers
I am currently in early stages of qualitative research design in the areas of perceptions and exploration of older adults . I am looking at investigating older adults with personality disorders and their experiences with Schema therapies to learn how as therapists we may then correlate it to younger patients in the life span and in addition enhance older patients quality of life
I am look to incorporate Delphi technique, qualitative questionnaire , focus groups and discussion
your thoughts in an area that is not well developed are valuable to a proof of concept or initial paper on the area of enhancing therapy for older patients and of course applying it to younger patients .
regards
Gary Darbyshire
MMgmt , MstratMktng, GradDip-CouPsych
Relevant answer
2018 free paper:
Adolesc Health Med Ther. 2018; 9: 199–210.
Borderline personality disorder in adolescents: prevalence, diagnosis, and treatment strategies
Jean Marc Guilé,1,2,3 Laure Boissel,1,2 Stéphanie Alaux-Cantin,1,2 and Sébastien Garny de La Rivière1
  • asked a question related to Australia
Question
3 answers
Currently completing a project as part of studies in Mental health of older patients at the Australian College of Applied Psychology in Sydney Australia
I am currently designing a research proposal and require to quickly secure my document for approval
Urgently looking for a minimum of 6 to 8 qualified therapists who have dealt with older patients diagnosed with borderline personality disorder for a qualitative interview and questionaiire
I need to move quickly so if you have had experience in as a therapist I would very interested in talking to you you I have a deadline to secure participants so if you are able to assist please reply as soon as possible
Your assistance in this research will benefit future therapy in the area of treating older patients who have this disorder.
And referrals welcome
My details
Ph 61 434028920
Kind Regards
Gary Darbyshire
Relevant answer
Answer
My Proposal date of submission 17th March so I need to confirm opportunity to access and discuss in interview mode before that date.
This will form my major research project for a required component.
Again Thank you.
Gary Darbyshire MMgmt MStratMktng Grad Dip Cou.
  • asked a question related to Australia
Question
4 answers
the articles are:
Safety and feasibility of home-based chemotherapy by Larsen FO, Christiansen AB, e.a. Danish medical journal 2018, May; 65(5) pii: A5482
A randomised crossover trial of chemotherapy in the home: patient preferences and cost analysis by King MT; Hall JP, Harnett PR.
Medical journal of Australia, 2001; Mar 19; 174(6) 312; author reply 312-3.
Relevant answer
Answer
Thanks!
  • asked a question related to Australia
Question
6 answers
I've been involved in providing training in STEM topics (electronics, robotics and programming mainly) to school students and teachers in Australia for quite some time now. There can be multiple options, in terms of technology tool, that can support teaching of STEM topics. I want to understand how do you zero-in on a particular (off-the-self) STEM kit? What criterion you get ticked before placing the order?
PS: I'm focusing more at technology kits in the area of electronics, programming and robotics education in schools.
Relevant answer
Answer
I have chosen a kit because it had plenty of resources, an online community to share the work done, and it was cost-effective.
  • asked a question related to Australia
Question
5 answers
Hi everyone,
I have an amphipod that is evading identification. I think it belongs to the family Oedicerotidae, particularly in the genera Synchelidium or Pontocrates.
I have come to this conclusion as it has a subchelate gnathopod (G)1, a chelate G2 and a distinct rostrum. Photographs of the specimen are attached.
However, the crux is that neither genus is recorded in Australian waters. I have Lincoln's British Marine Amphipoda: Gammaridea and it does appear to match the description of these genera but it exhibits a mix of the feature that separates between them, i.e. the palm of G1 is half toothed and half smooth.
I have attached scans of the genera descriptions for your interest(extracted from Lincoln's book).
Anyone have any ideas? Could we have a new amphipod in Australia?