Science topics: GeoscienceAustralia
Science topic
Australia - Science topic
The smallest continent and an independent country, comprising six states and two territories. Its capital is Canberra.
Questions related to Australia
I'm based in Australia, and I will be conducting online interviews with people in both Australia and America. I must apply to my university's ethics committee and get approval from them to start my interviews in Australia. However, I am unsure if I need to undergo a similar process of getting ethics approval from an Institutional Review Board (IRB) in America, and which IRB I should be applying to, if needed, if I am to conduct interviews for people in America.
I am conducting the interviews online with people of interest in Maine, and I have read that the University of Southern Maine has a publicly accessible IRB that I can apply to. I am just wondering if that whole process is required.
Thanks!
Its an interesting paper that i am half way writing into now. The Australian dollar recently plunged to its lowest level against the US dollar since October 2022. The rapid decline of AUD from 23.93 in Jan 2023 to 21.27 THB is an indication of how economic factors can cause havoc when the Central bank policy runs tangent to government action.the Reserve Bank of Australia’s (RBA) dovish bets might drag the Aussie lower. The RBA’s December meeting minutes emphasised that policymakers have become confident that inflationary pressures are easing in line with expectations. Traders have priced in nearly a 65% chance of a 25 basis points (bps) rate cut at the February 18 meeting, with full expectations for a cut by April.Australia’s economy to avoid recession, RBA to hold rates steady for an extended period, and can this be possible? My guess is that with China's support waning from Australia,( less of iron ore purchases) and lower number of chinese students are two primary reasons.
We have been trying to elicit a physically meaningful answer to the following basic question in Quantum Optics but to no avail.
To: The Editor-in-Chief of Physical Review A
We are trying to find out if your editorial policy of blocking rebuttals of the concept of quantum nonlocality is still in effect as indicated by the following quotation:
“Several important and high-impact physics journals enforce a policy that declares that papers challenging QNL (quantum nonlocality) will not be considered or sent for review. I have also personally received such communications from the American Physical Society. Papers challenging QNL receive immediate desk rejections. This type of ‘gatekeeping’ is seen not just in publishing but also in employment and the awarding of research grants. Local realists are systematically excluded. Advocacy of local realism can be a suicidal career move”. By Donald A. Graft, Rhetoric, logic, and experiment in the quantum nonlocality debate, Open Phys. 2017; 15:586–597.
Could you let us know whether your censorship is still in place?
From:
Andre Vatarescu
Canberra, Australia
email: andre_vatarescu@yahoo.com.au
To: Dr. Thomas Pattard , Chief Editor of Physical Review A
Thanks for your response which is reproduced below.*
We raised a fundamental question in our previous submission to your journal. This question which has never been addressed in the professional literature is:
"How can a single photon propagate in a straight-line inside a dielectric medium given the existence of the quantum Rayleigh scattering of single photons?"
The concept of quantum nonlocality involving two single and entangled photons requires the synchronization of their respective detections.
But this synchronization is physically impossible because of the quantum Rayleigh scattering of single photons.
Additionally, experimental results have been published in journals other than Physical Review A, results which clearly and unambiguously violate Bell-type inequalities with independent photons, thereby disproving the need for entangled photons.
We will appreciate any reference you may point out in your journal, dealing with the question mentioned above and the consequent physical aspects we have raised in this message.
From:
Andre Vatarescu, PhD
Canberra, Australia
*The only response we received contained perfunctory statements without any mention of our fundamental question.
Hello Everyone,
Does anyone know of publicly available observed riverine bathymetry datasets that are available for download?
Preferably, the datasets would not be cross-sections but raster or point-based observations of a continuous bathymetric profile.
Will the leadership style used in the U.S. be successful in Australia, or will the Australians respond better to another? Which leadership training methodology would be most successful with your Australian leaders?
and are each posted illegally (I am the senior editor of the book, in which these chapters appear).
I have written to the authors of these chapters today demanding they be removed.
Kind Regards
Colin Butler
Colin D. Butler PhD, MSc, BMed, DTM&H
Honorary Professor, National Centre for Epidemiology and Population Health and Institute for Climate, Energy and Disaster Solutions, Australian National University, Canberra, ACT, Australia
Interested in learning about media power and the role of the media system, have a look at my latest article:
#mediapower #discourse analysis
Dear All
I am searching a collaborator from Australia who is working with fish reproductive physiology.
I have heard many anecdotal reports of vast numbers of serious adverse reactions to the COVID vaccines in Australia. Can anyone confirm or deny this information which I have not yet published. I write for an australian news service and have documented some of the serious events but have no information as to how rare these are. thank you if you respond please indicate if I should use your name in any article. I will not identify anyone except citing any published reports of interest.
Hello all,
I wanted to know, can I use galaxy (USA, Europe or Australia) platform for analyzing the shotgun data, and can it be used for publication purpose as well?
Thanks :)
I am working on a literature review of studies that systematically compare at least one case of collaborative governance to one or more cases of conventional governance (or that compare multiple cases on a spectrum from conventional to collaborative). So far, I have found only 15 such studies, listed in the attached slides. Do you know of others? I'm happy to share my preliminary results, which I'm presenting at IASNR in Cairns, Australia, June 27, 2024. Please let me know of any relevant empirical research I'm missing.
Dear Professors,
If any one know about the technical conference in Australia between 14-21 September 2024, Please let me know. Thanking you in advance.
We are looking for researchers from Australia or other countries who wish to work collaboratively for a book chapter of the project: "Transforming Dental Health in Rural Communities: Digital Dentistry".
Dear Scholars:
As I am currently applying for a postdoc job in Australia, I understand that PIs are always very busy. As a result, they may not be able to go through each email. I'm just wondering what do need to do in order for a potential researcher to read through my email and attached files? Cheers and thanks a bunch.
I am Associate Professor in School of Botany, Minhaj University, Lahore, Pakistan. My specialization is in Agricultural Sciences (plant pathology). I have done my Ph,.D in 2016 from Faculty of Agricultural Sciences, Punjab University, Lahore. I want to do Post doc from any good University of Malaysia, Turkey, Australia, Switzerland or Italy. i have published 21 papers in national and international Journals. I am attaching my CV.
What are the best methods for Gold Nugget Prospecting?
Especially Victorian fields in Australia
And is there any map for abandoned mines and fields in this area?
#Gold #Nugget #Victoria #Bendigo #Ballarat #Australia #Clunes #Avoca #Castlemaine #Creswick #Maryborough
A Leaked audio from Brisbane’s watch house exposed the fact that police allowed sexist and racist attitudes to flourish inside the dept. This leak outraged Australia. Australia depends on importing cheap young labor with promise for a better life while brunt of the taxes fall on these migrants as well as young Australians towards benefitting the aged for their cavorting health care bills. While many young Australians seek to get into the police force, they are mostly ignored or do not pass the interview stages. Many feel its due to racism's. Now Australia's decided to import police officers (again denying their own young people), and where will these officers be recruited from? England, Ireland, Wales, Scotland, New Zealand.
I have been looking at family violence data in Australia and noticed a pattern of gender symmetry emerging in DFV murder victimisation. While men are still over represented in DFV perpetration data, it has made me question why there is such a strong focus on segmenting data by gender in DFV research, and why there is such a high level of polarisation around discussions of DFV data and public policy.

I would like to know the minimum and maximum percentage of steel as per international codes.
I did MS/ M.Phil in Health Psychology. My Academic research was on "Psychosocial aspects in patients with Multimorbidity Health Conditions". Now I want to do PhD in Psychology preferably in Health Psychology. I'm looking for supervisor who as assist me with fully funded scholarship in Australia Or Canada.
Please guide me how I can find supervisor?
Hi,
I am interested to learn more about how First Nations students (Indigenous, Aboriginal) particularly in Australia are assessed. I am not looking at how they are assessed in public schools but the Indigenous ways - decolonising how First Nations students are being assessed. Appreciate if recent research/articles can be recommended.
Thank you. R
Hi. My only interests are in public and private sector accounting and auditing. No interest in medicine. Please remove the latter from my record. Regards, Patrick Barrett.
ANU, A=Australia.
As an international student which country is the most suitable further studies in the world ?(For master and PhD in Environmental management )
Eg Canada ,Japan ,Australia ,Germany ,USA, Finland , Sweden
I would like to do Post doc in canada or australia or any europe countries. Which Country or Universities are easily to grab the opportunities. I have completed my Ph.Drecently with two SCI Publication.
Respected All,
I want to apply and join Postdoctoral fellowship in Australia or Canada. Kindly Guide me for the same. My specialization is food fermentation, health food and waste management.
If you have any vacancy related to this kindly let me know So I can apply for the same.
Thanking you all in advance....
Hi Scholars:
Hi Schiolars:
I obtained my phd degree from The University of Melbourne, Australia in late 2021. Then, I got a job in Taiwan which didn't work out for me. Now, after some considerations, I decided to apply jobs overseas. As I am constructing my own cover letter and e-mail template for postdoc job application. What I know is that I must do some researches of a lab that I'm interested and express my interest my cover letter. However, I am not so sure what else I need to say just to have a chance to have an interview with a potential employer. Therefore, could someone have a look at my attached documents and give me some suggestions?
Dear researchers,
Recently I and my colleagues had a discussion regarding the quality of PhD research works in UK and Australia. We had different opinions regarding the statements, and I would like to leave this discussion into researchgate, because it would help me to advice my undergraduate students regarding the best possible country for undertaking thier PhD in Civil and Environmental Engineering, among UK and Australia.
Your opinions are welcomed.
Journalists in developing countries wield significant agency and power in shaping public opinion, as evidenced by research. While there may be variations in the perception and practice of journalism across different parts of the world, journalists have been found to exercise their influence in manipulating public opinions. Regarding my ongoing research paper titled "Passivity and Exclusion: Media Power in the Construction of the Aged-Care Debate in Australia and Malaysia," I have been prompted to consider the agency and power of journalists specifically from developing countries. What are your thoughts?
#australia #media #construction #research #power #journalism #malaysia #DevelopmentJournalism #developingcountries #phdresearch #freedomofspeech #mediatraining
Besides Professor Arulrajah in Australia, is there anyone else working on this issu
This software has been used to calculate the degree of crystallinity in materials.
This is related to XRD
I need reviewer for Taylor edited book from Computer Science area from Canada or USA or UK and or Australia University. URGENT!
The Australia-China bilateral relationship was based on strong economic and trade complementarities and longstanding community and cultural links. Chinese investment into real estate in NSW, WA, Queensland, while Australia was a haven for Chinese students and the young generation to migrate to a beautiful country far away from the Communist mindset, compulsory Army training, and rigid control of fundamental rights. In 2018 annual two-way trade between China and Australia reached almost 215 Bil AUD. Iron ore, gas and coal make up the bulk of Australian exports to China (more than AUD 79 billion), but Australian service industries – was led by education and tourism. In 2021, bilateral trade between the two countries amounted to approximately US$231.2 billion, a rise of 35.1 percent year-on-year, however, relations have soured dramatically in the last 5 years and militarily Australian strategy had hardened against China forcing Australia to join AUKUS-The UK, US and Australia have announced a historic pact to counter China. Emerging cooperation between India and Australia is widely understood as a response to the China challenge that is facilitated by multilateral groupings like the Quad. But the recent signing of the Australia–India Economic Cooperation and Trade Agreement (ECTA) on 2 April suggests the bilateral relationship is much more substantial.
I need to know about research on date palm based on drought occurances and develop recommendations based on technologies, or research and development that can provide solutions to farmers in australia to ensure resillience during drought times. Growing and production in drought and desert climates, and report on how farmers here in australia can implement date trees on their farms to increase resillience during times of drought when other crops would otherwise fail.
needed o know about research on date palm based on drought occurances and develop recommendations based on technologies, or research and development that can provide solutions to farmers in australia to ensure resillience during drought times. Growing and production in drought and desert climates, and report on how farmers here in australia can implement date trees on their farms to increase resillience during times of drought when other crops would otherwise fail.
Hello Everyone, I am working on paleoclimate of northwest Australia. I have been searching for the sediment discharge/sediment load of ''Ord River'', ''Victoria River'' and ''Fitzroy River'' but cannot find it anywhere. Can anyone guide me where can i find the sediment discharge data of the mentioned rivers?
Thank you
Hello Researchers,
I am considering publishing a Case Study report on Cross-cultural and Comparative Analysis of Leadership Styles on Australia and Bangladesh in an international open-access journal for international business. I had received a high distinction for this report in my MCom program at an Australian university. I would like to ask you all about the possible format of the report for publication, I would like to ask for your recommendation on the matter.
I wrote the report focusing on Comparative and cross-cultural leadership styles between Bangladesh and Australia. The two cultural models I chose were Hoffsteid and Globe study.
Since the report was written in the Case Study format and most international journals use the traditional journal article format, do you think it would be better to reformat the report into a traditional journal article format (Intro, Lit. Review, Rationale, Research Methods, Main Body, Findings, Conclusion, and Recommendations)?
Or do you think there is scope for publishing it in a Case Study format? I know Case Study articles are popular in Medical journals, but not sure if there are any Case Study international journals in the fields of international business and management.
Please let me know your opinion at your earliest convenience.
Warmest Regards,
Neaz
Reading Bruce Chatwin's Songlines where he describes how the songlines work amongst the aborigines of Australia, creating a spiritual network of Australia based on individual totems and their narratives. not only do we, therefore, have religion, but also psychology, geography and its symbolism (I recently read a Muslim writer who claimed the latter for Islam) but a sense of knowledge connected to both individuals and tribes.
Does this reach back in time thereby representing a means of transmitting knowledge over a long distance but also preserving it?
This was collected at Townsville, Queensland, Australia. It does not match any of the native species known from Townsville or elsewhere in Queensland, so perhaps it is an introduced species?



I am currently working on the use of metacognitive abilities to improve teacher proficiency of teaching mathematics in Primary schools. I am looking for international collaborators from Japan, Germany, Singapore, Netherlands, USA, Canada and Australia.
Thank you
A colleague is interested in the problem of mega-fires. If there are scientific papers for the United States, Australia or France, there is little research for South America. In France, a mega fire can be identified from 1,000 ha, in the United States or Australia from 10,000 ha.
Are there any studies in South America (e.g. Chile)?
Are there objective criteria for defining a mega fire?
Many thanks!
Taking into consideration that Australia has an active but, nevertheless, relatively small academic community, are there any signs that 'clinical' cognitive science research in Australia has really broken the barriers between the three traditionally involved disciplines, computer science, psychology and brain-related medicine, especially with the latter of the three (i.e., beyond one-off instances, or minority collaborations)?
Some countries have age barrier to get scholarship for conducting PhD. For example, in Germany 35 years, Australia 40 years. But so far I know there is no research that revealed younger people perform better in doing PhD and vice versa.
I'm wondering if I can gather information to study a social phenomena (artificial intelligence and ethics) in one country (Australia for example) and validate the result in another country (Saudi Arabia for example)?
Anybody knows a company that can service/calibrate an ARISE EZ MATE 601S in Australia?
Our local Bio-Strategy does not provide support any more.
Thanks
I'm looking for a PhD position and opportunity in one of the English speaking university in European countries (or Australia).
I majored in artificial intelligence. I am in the field of medical image segmentation and My thesis in master was about retinal blood vessels extraction based on active contour. Skilled in Image processing, machine learning, MATLAB and C++.
So could anybody helps me to find a prof and PhD position related on my skills in one of the English speaking university?
I'm looking for Ph.D. programs (Scholarships) in Europe/USA/Canada/Australia/Great Britain.
Professors who are looking for Ph.D. candidate, I'm ready to work with any new subjects in Computer Science Field and especially in Deep Learning/Machine Learning.
I really appreciate your help!
Thanks to all who joined the discussion of useful COI primers for shark DNA amplification. I have narrowed down our efforts to the Ward et al. 2005 primers, but there are 2 sets, 2 forward and two reverse, we would like to narrow down the search to which set is likely to perform best, and specifically with Odontaspis noronhai, the primers listed are:
FishF1-5TCAACCAACCACAAAGACATTGGCAC3,
FishF2-5TCGACTAATCATAAAGATATCGGCAC3,
FishR1-5TAGACTTCTGGGTGGCCAAAGAATCA3,
FishR2-5ACTTCAGGGTGACCGAAGAATCAGAA3
(PDF) DNA Barcoding Australia's fish species. Available from: https://www.researchgate.net/publication/7550627_DNA_Barcoding_Australia's_fish_species [accessed Jul 01 2021].
Has anyone used these with Odontaspis, or even Odontaspidae? Thanks again.
For example I have last 50/100 years of rainfall data for a large country like Brazil or India or Australia. Can I project rainfall for the next 100 years from that data on yearly, monthly, daily and even hourly basis in terms of intensity? What are the methods and models can I use for that?
On a scale of 10 - In different countries -Effectiveness of online Primary education (Scores)
1 UK - 4.9
2 Canada - 5.6
3 USA -5.6
4 Australia - 6.6
5 France 4.6
6 Germany - 6.1
7 Japan - 3.1
8 China - 5.4
Source- Economist - taken from DB (26-6-2021)
Is there any research available or ongoing for COVID-19 impact and effectiveness of online teaching in higher education (Graduate, Master degree course, Professional Courses (Medical & Engineering)
The Duke and Duchess of Sussex announced their plans to keep their castle in England, and, in addition, to live in Canada and also to stay for part of the year in California. Further, they love Africa and they frequently make trips to Australia, New Zealand, and enjoy visiting the Orient.
Hi I am doing soil erosion modelling applying RUSLE equation. But I was searching for the most appropriate and latest method to determine K-factor for a large area like India or Brazil or Australia? Please suggest. Thank you in advance for your time and effort.
Hi All,
I have a very particular question, I used to use skim milk powder as a cryoprotectant for lactobacilli that would face freeze-drying, (skim milk would give the best viability). However, in Australia, if we want to register a product as organic it is necessary to provide a certificate of origin for all bulk agents. Unfortunately, Oxoid put out of the market the analytical-grade skim milk and I can't use any other milk that is not manufactured in Australia/New Zealand. Does anyone have an idea what other options are for lactobacilli cryoprotectants?
Thank you so much
Art
is there a coincidence that the global fires of siberia have covered the entire northern hemisphere with smoke .... global fires in australia - the southern hemisphere. - and it is in this year that a global outbreak of lung infections occurs?
I suggest the same way for other respiratory infections and COVID-19 too ...
one new brick in the wall
Wildfire Smoke May Raise COVID-19 Risk, Study Says
Kiser, D., Elhanan, G., Metcalf, W.J. et al. SARS-CoV-2 test positivity rate in Reno, Nevada: association with PM2.5 during the 2020 wildfire smoke events in the western United States. J Expo Sci Environ Epidemiol (2021). https://doi.org/10.1038/s41370-021-00366-w
"We found that a 10 µg/m3 increase in the 7-day average PM2.5 concentration was associated with a 6.3% relative increase in the SARS-CoV-2 test positivity rate, with a 95% confidence interval (CI) of 2.5 to 10.3%. This corresponded to an estimated 17.7% (CI: 14.4–20.1%) increase in the number of cases during the time period most affected by wildfire smoke, from 16 Aug to 10 Oct.Significance Wildfire smoke may have greatly increased the number of COVID-19 cases in Reno. Thus, our results substantiate the role of air pollution in exacerbating the pandemic and can help guide the development of public preparedness policies in areas affected by wildfire smoke, as wildfires are likely to coincide with the COVID-19 pandemic in 2021.
Introduction"
3 Meo SA, Abukhalaf AA, Alomar AA, Alessa OM. Wildfire and COVID-19 pandemic: effect of environmental pollution PM-2.5 and carbon monoxide on the dynamics of daily cases and deaths due to SARS-COV-2 infection in San-Francisco USA. Eur Rev Med Pharmacol Sci. 2020 Oct;24(19):10286-10292. doi: 10.26355/eurrev_202010_23253. PMID: 33090440.
I am trying to know if there are recent projects/ research on earth-based material for construction in Australia specifically, and what are the used methods (e.g. cob- adobe-rammed earth)
Looking for information on Clinical Neuropsychology Postdoctoral positions that focuses on Pre/ Intraoperative/ Post-Operative Brain Mapping and Cortical Stimulation in the United States / France/ Europe/ Australia.
Also looking for information on Centers/ Hospitals and names of Clinical Neuropsychologist who routinely perform these protocols (Brain Mapping and Cortical Stimulation) for Awake Brain Surgeries in US, France/ Europe and Australia.
Any information on any of the above would be greatly appreciated.
Can you recommend conferences in the field of BioChemistry and specifically applicational BioChem in Australia in the near future, and with a close deadline for submission (range of 3-6 months)?
It can be also a New Zealand located conference, or, alternatively, it can be another conference that can be accessed by Zoom or similar technologies.
Thank you in advance!
Dear All,
Hope you are staying safe and sound.
I`m conducting a quantitative research in my PhD to test and validate a conceptual framework that has been developed based on the data from 26 interviews. I`m struggling with finding participants to fill the survey for the quantitative phase of my PhD as the inclusion criteria are too specific and narrow. I`m looking for social entrepreneurs who are either Co/founder, CEO, or managing director of social enterprises in Australia and use online communities related to their enterprise. I know that generally, it is said that I need to find at least 100 and preferably 150 participants for the quantitative research, however, it is a very difficult and challenging task for me to reach these numbers considering my limited time and resources.
I would appreciate if you could let me know how I can justify a sample size with between 50-70 participants and whether it is justifiable or not in a mixed-method research, in which interviews are the main data collection tool.
Thank you in advance for your assistance.
Methods for assessing group work in mathematics and the case for individualized student's contributions were discussed. Countries considered were US, UK, Canada, and Australia.
Particularly interested in the Eyrean Barrier, but would also be of value to have a dataset of the well known barriers around Australia. (for example, figure 1 from this article)
New Covid virus came to Europe, Australia then will spread other part of the world, do you think that previous vaccine will effective for recent virus?
Our team in Australia is looking for international collaborators to do a joint research towards scientific publication on psoriasis treatment using our controlled-release formulation. If you are interested, please send us an email to: info@anni.com.au and we will give you details.
I have been waiting for a review from a journal in Australia for about a year. It will be one year on November 21, 2020. Is this normal? What do you think about the journals extending their review times that much?
Researching school principal development models in Australia
Hello
I am interested in mental health literacy research with a CaLD community in Australia. I am seeking collaborator or guide/supervisor for this project.
I would love to hear from experienced academic interested in this topic.
Thank you in advance.
Regards
Bharat
How can I get the publications correctly attributed?
Please email me on andrewj.carmichael@nhs.net
Thanks.
Andrew J Carmichael
Consultant Dermatologist
S Tees
Middlesbrough
TS9 7EG
UK
Good day friends.
I have a few questions regarding my project.
The project is mainly focused on IoT, network traffic classification, intrusion, machines learning/deep learning.
So, my questions, here, is:
1) Is it possible to test IoT datasets that were captured in Australia in other countries, since I want the study tp base in specific country context?
2) The study settings will be based on a smart city (smart toll tag) or a smart environment. But, the datasets I’m planning to use which are captured in Australia, are datasets of weather station, (which generate air pressure, temperature, etc), smart home ( motion activated light), smart fridge, remotely activated garages door, smart air conditioner (thermostat), etc.
What do you guys think? Is it possible?
Thanks!
Dear Colleagues,
It is my pleasure to announce 2020 Ural Workshop on Group Theory and Combinatorics that will be held Online, August 24th-30th, 2020. For details see http://conf.uran.ru/Default?cid=2020uwgtc .
The workshop will be organized by Institute of Natural Sciences and Mathematics of the Ural Federal University (Yekaterinburg, Russia), N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS (Yekaterinburg, Russia), and The Ural Mathematical Center (Yekaterinburg, Russia).
The workshop aims to cover modern aspects of group theory (including questions of actions of groups on combinatorial objects), graph theory, some combinatorial aspects of topology and optimization theory, and related topics.
The program of the workshop consists of 50-minute talks by keynote speakers and a number of 15-20-minute contributed talks.
Our Keynote Speakers (in alphabet ordering):
Rosemary Bailey (The University of St Andrews, St Andrews, UK)
Peter Cameron (The University of St Andrews, St Andrews, UK)
Ilya Gorshkov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Tatsuro Ito (Kanazawa University, Kanazawa, Japan and Anhui University, Hefei, China)
Alexander (Sasha) Ivanov (Imperial College London, London, UK)
Elena Konstantinova (Novosibirsk State University and Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Denis Krotov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Mikhail Khachay (N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS and Ural Federal University, Yekaterinburg, Russia)
Long Miao (Yangzhou University, Yangzhou, China)
Ilia Ponomarenko (Petersburg Department of V. A. Steklov Institute of Mathematics, Saint Petersburg, Russia)
Viktor Mazurov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Christopher Parker (University of Birmingham, Birmingham, UK)
Cheryl Praeger (The University of Western Australia, Perth, Australia)
Danila Revin (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia and N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS, Yekaterinburg, Russia)
Wujie Shi* (Chongqing University of Arts and Sciences, Chongqing, China)
Sergey Shpectorov (University of Birmingham, Birmingham, UK)
Arseny Shur* (Ural Federal University, Yekaterinburg, Russia)
Alexey Staroletov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Ying-Ying Tan* (Anhui Jianzhu University, Hefei, China)
Vladimir Trofimov* (N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS and Ural Federal University, Yekaterinburg, Russia)
Evgeny Vdovin (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)
Mikhail (Misha) Volkov (Ural Federal University, Yekaterinburg, Russia)
Yaokun Wu (Shanghai Jiao Tong University, Shanghai, China)
Alexandre Zalesskii* (University of East Anglia, Norwich, UK)
__
* to be confirmed
Registration
To attend the workshop please register for free until August 15, 2020 via the website http://conf.uran.ru/Default?cid=2020uwgtc .
In your registration form, you are welcome to give us some information on your mathematical interests. We kindly ask keynote speakers to register via this website to be available for mailings!
Contributed talks
If you want to contribute a talk, please prepare your one-page abstract with the template (see the website http://conf.uran.ru/Default?cid=2020uwgtc ), fill the corresponding form in "My Submissions" on the website, and upload your abstract until July 20, 2020.
We kindly ask you to name the file with your abstract as follows FirstName_LastName.tex.
Contacts
If you have any questions, don't hesitate to contact to me via e-mail butterson[at]mail[dot]ru.
Best regards,
Natalia Maslova
DSc
Leading Researcher, Krasovskii Institute of Mathematics and Mechanics
Associate Professor, Ural Federal University
620990, Yekaterinburg
butterson[at]mail[dot]ru
Is it true that naturally occurring radioactive material from a specific type of rock is the same?
For example the gold-bearing rock in Australia and that from Tanzania.
Due to poverty and wealt of other peoples, many Europeans have moved to America, Australia and Canada.
In the International Marketing course at Clarion University of Pennsylvania, I want my students to get an opportunity to talk to students in other parts of the world to understand their culture and work on developing a marketing plan. Please let me know, if anybody is interested in joining hands or passing some leads. I can then share more details and a plan to collaborate.
Thank you
Australia has been a relative success story but an outbreak in Melbourne is at a "critical stage", experts say.
Infections have surged in the past few weeks - there are now 482 active cases in the state of Victoria.
The numbers remain below Australia's March peak, but what's concerning now is that most cases are being spread locally rather than by people arriving from overseas.
In every other state, the virus has been dramatically slowed or eradicated. So what's gone wrong in Victoria?
July 03, BBC

Hi, I'm interested to know the threshold on tree and vegetation monitoring in Australia, South Africa, Europe or any other country. Thanks :)
In my research methodology I would like to apply Dynamic Global vegetation Model to project future vegetation growth/availability under future climate projections. I found LPJ-Guess used in the previous research but couldn't find how to use at catchment scale in Australia.
What are these countries doing differently from Europe and United States, that makes them so successful?