Australia - Science topic

I need reviewer for Taylor edited book from Computer Science area from Canada or USA or UK and or Australia University. URGENT!

The Australia-China bilateral relationship was based on strong economic and trade complementarities and longstanding community and cultural links. Chinese investment into real estate in NSW, WA, Queensland, while Australia was a haven for Chinese students and the young generation to migrate to a beautiful country far away from the Communist mindset, compulsory Army training, and rigid control of fundamental rights. In 2018 annual two-way trade between China and Australia reached almost 215 Bil AUD. Iron ore, gas and coal make up the bulk of Australian exports to China (more than AUD 79 billion), but Australian service industries – was led by education and tourism. In 2021, bilateral trade between the two countries amounted to approximately US$231.2 billion, a rise of 35.1 percent year-on-year, however, relations have soured dramatically in the last 5 years and militarily Australian strategy had hardened against China forcing Australia to join AUKUS-The UK, US and Australia have announced a historic pact to counter China. Emerging cooperation between India and Australia is widely understood as a response to the China challenge that is facilitated by multilateral groupings like the Quad. But the recent signing of the Australia–India Economic Cooperation and Trade Agreement (ECTA) on 2 April suggests the bilateral relationship is much more substantial.

Hello Researchers,

I am considering publishing a Case Study report on Cross-cultural and Comparative Analysis of Leadership Styles on Australia and Bangladesh in an international open-access journal for international business. I had received a high distinction for this report in my MCom program at an Australian university. I would like to ask you all about the possible format of the report for publication, I would like to ask for your recommendation on the matter.

I wrote the report focusing on Comparative and cross-cultural leadership styles between Bangladesh and Australia. The two cultural models I chose were Hoffsteid and Globe study.

Since the report was written in the Case Study format and most international journals use the traditional journal article format, do you think it would be better to reformat the report into a traditional journal article format (Intro, Lit. Review, Rationale, Research Methods, Main Body, Findings, Conclusion, and Recommendations)?

Or do you think there is scope for publishing it in a Case Study format? I know Case Study articles are popular in Medical journals, but not sure if there are any Case Study international journals in the fields of international business and management.

Please let me know your opinion at your earliest convenience.

Warmest Regards,

Neaz

I need to know about research on date palm based on drought occurances and develop recommendations based on technologies, or research and development that can provide solutions to farmers in australia to ensure resillience during drought times. Growing and production in drought and desert climates, and report on how farmers here in australia can implement date trees on their farms to increase resillience during times of drought when other crops would otherwise fail.

needed o know about research on date palm based on drought occurances and develop recommendations based on technologies, or research and development that can provide solutions to farmers in australia to ensure resillience during drought times. Growing and production in drought and desert climates, and report on how farmers here in australia can implement date trees on their farms to increase resillience during times of drought when other crops would otherwise fail.

Hello Everyone, I am working on paleoclimate of northwest Australia. I have been searching for the sediment discharge/sediment load of ''Ord River'', ''Victoria River'' and ''Fitzroy River'' but cannot find it anywhere. Can anyone guide me where can i find the sediment discharge data of the mentioned rivers?

Thank you

Reading Bruce Chatwin's Songlines where he describes how the songlines work amongst the aborigines of Australia, creating a spiritual network of Australia based on individual totems and their narratives. not only do we, therefore, have religion, but also psychology, geography and its symbolism (I recently read a Muslim writer who claimed the latter for Islam) but a sense of knowledge connected to both individuals and tribes.

Does this reach back in time thereby representing a means of transmitting knowledge over a long distance but also preserving it?

This was collected at Townsville, Queensland, Australia. It does not match any of the native species known from Townsville or elsewhere in Queensland, so perhaps it is an introduced species?

I am currently working on the use of metacognitive abilities to improve teacher proficiency of teaching mathematics in Primary schools. I am looking for international collaborators from Japan, Germany, Singapore, Netherlands, USA, Canada and Australia.

Thank you

A colleague is interested in the problem of mega-fires. If there are scientific papers for the United States, Australia or France, there is little research for South America. In France, a mega fire can be identified from 1,000 ha, in the United States or Australia from 10,000 ha.

Are there any studies in South America (e.g. Chile)?

Are there objective criteria for defining a mega fire?

Many thanks!

Burning offer

I think it would be wiser to unite all the flora of the world first. In today's world, where the mobility of species and globalization have increased, limited local or country flora is no longer sufficient. For this, we must combine the family identification keys and number the species like a license plate, so that each species has a code number. Even if the name changes, the code remains the same. Endemics should be lettered with their own country code and Continents with their own code. (endemic, Asia, Turkey, 1750) ASTUR11750, or (America, USA, 18420) AMUSA18420. This code can then be associated with local names.

Taking into consideration that Australia has an active but, nevertheless, relatively small academic community, are there any signs that 'clinical' cognitive science research in Australia has really broken the barriers between the three traditionally involved disciplines, computer science, psychology and brain-related medicine, especially with the latter of the three (i.e., beyond one-off instances, or minority collaborations)?

Dear All

I am searching a collaborator from Australia who is working with fish reproductive physiology.

I'm wondering if I can gather information to study a social phenomena (artificial intelligence and ethics) in one country (Australia for example) and validate the result in another country (Saudi Arabia for example)?

Anybody knows a company that can service/calibrate an ARISE EZ MATE 601S in Australia?

Our local Bio-Strategy does not provide support any more.

Thanks

I'm looking for a PhD position and opportunity in one of the English speaking university in European countries (or Australia).

I majored in artificial intelligence. I am in the field of medical image segmentation and My thesis in master was about retinal blood vessels extraction based on active contour. Skilled in Image processing, machine learning, MATLAB and C++.

So could anybody helps me to find a prof and PhD position related on my skills in one of the English speaking university?

I'm looking for Ph.D. programs (Scholarships) in Europe/USA/Canada/Australia/Great Britain.

Professors who are looking for Ph.D. candidate, I'm ready to work with any new subjects in Computer Science Field and especially in Deep Learning/Machine Learning.

I really appreciate your help!

Thanks to all who joined the discussion of useful COI primers for shark DNA amplification. I have narrowed down our efforts to the Ward et al. 2005 primers, but there are 2 sets, 2 forward and two reverse, we would like to narrow down the search to which set is likely to perform best, and specifically with Odontaspis noronhai, the primers listed are:

FishF1-5TCAACCAACCACAAAGACATTGGCAC3,

FishF2-5TCGACTAATCATAAAGATATCGGCAC3,

FishR1-5TAGACTTCTGGGTGGCCAAAGAATCA3,

FishR2-5ACTTCAGGGTGACCGAAGAATCAGAA3

(PDF) DNA Barcoding Australia's fish species. Available from: https://www.researchgate.net/publication/7550627_DNA_Barcoding_Australia's_fish_species [accessed Jul 01 2021].

Has anyone used these with Odontaspis, or even Odontaspidae? Thanks again.

For example I have last 50/100 years of rainfall data for a large country like Brazil or India or Australia. Can I project rainfall for the next 100 years from that data on yearly, monthly, daily and even hourly basis in terms of intensity? What are the methods and models can I use for that?

On a scale of 10 - In different countries -Effectiveness of online Primary education (Scores)

1 UK - 4.9

2 Canada - 5.6

3 USA -5.6

4 Australia - 6.6

5 France 4.6

6 Germany - 6.1

7 Japan - 3.1

8 China - 5.4

Source- Economist - taken from DB (26-6-2021)

The Duke and Duchess of Sussex announced their plans to keep their castle in England, and, in addition, to live in Canada and also to stay for part of the year in California. Further, they love Africa and they frequently make trips to Australia, New Zealand, and enjoy visiting the Orient.

Hi I am doing soil erosion modelling applying RUSLE equation. But I was searching for the most appropriate and latest method to determine K-factor for a large area like India or Brazil or Australia? Please suggest. Thank you in advance for your time and effort.

Hi All,

I have a very particular question, I used to use skim milk powder as a cryoprotectant for lactobacilli that would face freeze-drying, (skim milk would give the best viability). However, in Australia, if we want to register a product as organic it is necessary to provide a certificate of origin for all bulk agents. Unfortunately, Oxoid put out of the market the analytical-grade skim milk and I can't use any other milk that is not manufactured in Australia/New Zealand. Does anyone have an idea what other options are for lactobacilli cryoprotectants?

Thank you so much

Art

is there a coincidence that the global fires of siberia have covered the entire northern hemisphere with smoke .... global fires in australia - the southern hemisphere. - and it is in this year that a global outbreak of lung infections occurs?

I suggest the same way for other respiratory infections and COVID-19 too ...

one new brick in the wall

Wildfire Smoke May Raise COVID-19 Risk, Study Says

Kiser, D., Elhanan, G., Metcalf, W.J. et al. SARS-CoV-2 test positivity rate in Reno, Nevada: association with PM2.5 during the 2020 wildfire smoke events in the western United States. J Expo Sci Environ Epidemiol (2021). https://doi.org/10.1038/s41370-021-00366-w

"We found that a 10 µg/m3 increase in the 7-day average PM2.5 concentration was associated with a 6.3% relative increase in the SARS-CoV-2 test positivity rate, with a 95% confidence interval (CI) of 2.5 to 10.3%. This corresponded to an estimated 17.7% (CI: 14.4–20.1%) increase in the number of cases during the time period most affected by wildfire smoke, from 16 Aug to 10 Oct.Significance Wildfire smoke may have greatly increased the number of COVID-19 cases in Reno. Thus, our results substantiate the role of air pollution in exacerbating the pandemic and can help guide the development of public preparedness policies in areas affected by wildfire smoke, as wildfires are likely to coincide with the COVID-19 pandemic in 2021.

Introduction"

2

3 Meo SA, Abukhalaf AA, Alomar AA, Alessa OM. Wildfire and COVID-19 pandemic: effect of environmental pollution PM-2.5 and carbon monoxide on the dynamics of daily cases and deaths due to SARS-COV-2 infection in San-Francisco USA. Eur Rev Med Pharmacol Sci. 2020 Oct;24(19):10286-10292. doi: 10.26355/eurrev_202010_23253. PMID: 33090440.

I am trying to know if there are recent projects/ research on earth-based material for construction in Australia specifically, and what are the used methods (e.g. cob- adobe-rammed earth)

Looking for information on Clinical Neuropsychology Postdoctoral positions that focuses on Pre/ Intraoperative/ Post-Operative Brain Mapping and Cortical Stimulation in the United States / France/ Europe/ Australia.

Also looking for information on Centers/ Hospitals and names of Clinical Neuropsychologist who routinely perform these protocols (Brain Mapping and Cortical Stimulation) for Awake Brain Surgeries in US, France/ Europe and Australia.

Any information on any of the above would be greatly appreciated.

Can you recommend conferences in the field of BioChemistry and specifically applicational BioChem in Australia in the near future, and with a close deadline for submission (range of 3-6 months)?

It can be also a New Zealand located conference, or, alternatively, it can be another conference that can be accessed by Zoom or similar technologies.

Thank you in advance!

Dear All,

Hope you are staying safe and sound.

I`m conducting a quantitative research in my PhD to test and validate a conceptual framework that has been developed based on the data from 26 interviews. I`m struggling with finding participants to fill the survey for the quantitative phase of my PhD as the inclusion criteria are too specific and narrow. I`m looking for social entrepreneurs who are either Co/founder, CEO, or managing director of social enterprises in Australia and use online communities related to their enterprise. I know that generally, it is said that I need to find at least 100 and preferably 150 participants for the quantitative research, however, it is a very difficult and challenging task for me to reach these numbers considering my limited time and resources.

I would appreciate if you could let me know how I can justify a sample size with between 50-70 participants and whether it is justifiable or not in a mixed-method research, in which interviews are the main data collection tool.

Thank you in advance for your assistance.

Some countries have age barrier to get scholarship for conducting PhD. For example, in Germany 35 years, Australia 40 years. But so far I know there is no research that revealed younger people perform better in doing PhD and vice versa.

Particularly interested in the Eyrean Barrier, but would also be of value to have a dataset of the well known barriers around Australia. (for example, figure 1 from this article)

Methods for assessing group work in mathematics and the case for individualized student's contributions were discussed. Countries considered were US, UK, Canada, and Australia.

New Covid virus came to Europe, Australia then will spread other part of the world, do you think that previous vaccine will effective for recent virus?

Our team in Australia is looking for international collaborators to do a joint research towards scientific publication on psoriasis treatment using our controlled-release formulation. If you are interested, please send us an email to: info@anni.com.au and we will give you details.

I have been waiting for a review from a journal in Australia for about a year. It will be one year on November 21, 2020. Is this normal? What do you think about the journals extending their review times that much?

Researching school principal development models in Australia

Hello

I am interested in mental health literacy research with a CaLD community in Australia. I am seeking collaborator or guide/supervisor for this project.

I would love to hear from experienced academic interested in this topic.

Thank you in advance.

Regards

Bharat

How can I get the publications correctly attributed?

Please email me on andrewj.carmichael@nhs.net

Thanks.

Andrew J Carmichael

Consultant Dermatologist

S Tees

Middlesbrough

TS9 7EG

UK

Good day friends.

I have a few questions regarding my project.

The project is mainly focused on IoT, network traffic classification, intrusion, machines learning/deep learning.

So, my questions, here, is:

1) Is it possible to test IoT datasets that were captured in Australia in other countries, since I want the study tp base in specific country context?

2) The study settings will be based on a smart city (smart toll tag) or a smart environment. But, the datasets I’m planning to use which are captured in Australia, are datasets of weather station, (which generate air pressure, temperature, etc), smart home ( motion activated light), smart fridge, remotely activated garages door, smart air conditioner (thermostat), etc.

What do you guys think? Is it possible?

Thanks!

Dear Colleagues,

It is my pleasure to announce 2020 Ural Workshop on Group Theory and Combinatorics that will be held Online, August 24th-30th, 2020. For details see http://conf.uran.ru/Default?cid=2020uwgtc .

The workshop will be organized by Institute of Natural Sciences and Mathematics of the Ural Federal University (Yekaterinburg, Russia), N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS (Yekaterinburg, Russia), and The Ural Mathematical Center (Yekaterinburg, Russia).

The workshop aims to cover modern aspects of group theory (including questions of actions of groups on combinatorial objects), graph theory, some combinatorial aspects of topology and optimization theory, and related topics.

The program of the workshop consists of 50-minute talks by keynote speakers and a number of 15-20-minute contributed talks.

Rosemary Bailey (The University of St Andrews, St Andrews, UK)

Peter Cameron (The University of St Andrews, St Andrews, UK)

Ilya Gorshkov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)

Tatsuro Ito (Kanazawa University, Kanazawa, Japan and Anhui University, Hefei, China)

Alexander (Sasha) Ivanov (Imperial College London, London, UK)

Elena Konstantinova (Novosibirsk State University and Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)

Denis Krotov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)

Mikhail Khachay (N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS and Ural Federal University, Yekaterinburg, Russia)

Long Miao (Yangzhou University, Yangzhou, China)

Ilia Ponomarenko (Petersburg Department of V. A. Steklov Institute of Mathematics, Saint Petersburg, Russia)

Viktor Mazurov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)

Christopher Parker (University of Birmingham, Birmingham, UK)

Cheryl Praeger (The University of Western Australia, Perth, Australia)

Danila Revin (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia and N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS, Yekaterinburg, Russia)

Wujie Shi* (Chongqing University of Arts and Sciences, Chongqing, China)

Sergey Shpectorov (University of Birmingham, Birmingham, UK)

Arseny Shur* (Ural Federal University, Yekaterinburg, Russia)

Alexey Staroletov (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)

Ying-Ying Tan* (Anhui Jianzhu University, Hefei, China)

Vladimir Trofimov* (N.N. Krasovskii Institute of Mathematics and Mechanics UB RAS and Ural Federal University, Yekaterinburg, Russia)

Evgeny Vdovin (Sobolev Institute of Mathematics SB RAS, Novosibirsk, Russia)

Mikhail (Misha) Volkov (Ural Federal University, Yekaterinburg, Russia)

Yaokun Wu (Shanghai Jiao Tong University, Shanghai, China)

Alexandre Zalesskii* (University of East Anglia, Norwich, UK)

__

* to be confirmed

To attend the workshop please register for free until August 15, 2020 via the website http://conf.uran.ru/Default?cid=2020uwgtc .

In your registration form, you are welcome to give us some information on your mathematical interests. We kindly ask keynote speakers to register via this website to be available for mailings!

If you want to contribute a talk, please prepare your one-page abstract with the template (see the website http://conf.uran.ru/Default?cid=2020uwgtc ), fill the corresponding form in "My Submissions" on the website, and upload your abstract until July 20, 2020.

We kindly ask you to name the file with your abstract as follows FirstName_LastName.tex.

If you have any questions, don't hesitate to contact to me via e-mail butterson[at]mail[dot]ru.

Best regards, Natalia Maslova

DSc Leading Researcher, Krasovskii Institute of Mathematics and Mechanics Associate Professor, Ural Federal University 620990, Yekaterinburg

butterson[at]mail[dot]ru

Is it true that naturally occurring radioactive material from a specific type of rock is the same?

For example the gold-bearing rock in Australia and that from Tanzania.

Due to poverty and wealt of other peoples, many Europeans have moved to America, Australia and Canada.

I am looking for a book

"Radiocarbon dating practices at ANU" by Gupta and Polach, published in 1985.

Can anyone please provide the link or source from where I can get this book?

Thank you

In the International Marketing course at Clarion University of Pennsylvania, I want my students to get an opportunity to talk to students in other parts of the world to understand their culture and work on developing a marketing plan. Please let me know, if anybody is interested in joining hands or passing some leads. I can then share more details and a plan to collaborate.

Thank you

Australia has been a relative success story but an outbreak in Melbourne is at a "critical stage", experts say.

Infections have surged in the past few weeks - there are now 482 active cases in the state of Victoria.

The numbers remain below Australia's March peak, but what's concerning now is that most cases are being spread locally rather than by people arriving from overseas.

In every other state, the virus has been dramatically slowed or eradicated. So what's gone wrong in Victoria?

July 03, BBC

Hi, I'm interested to know the threshold on tree and vegetation monitoring in Australia, South Africa, Europe or any other country. Thanks :)

In my research methodology I would like to apply Dynamic Global vegetation Model to project future vegetation growth/availability under future climate projections. I found LPJ-Guess used in the previous research but couldn't find how to use at catchment scale in Australia.

What are these countries doing differently from Europe and United States, that makes them so successful?

I currently finished my PhD studies in Australia and applying for different lecturer/post-doc positions in the same country. If you are working in the Australian market you should know we have to prepare a document which is named answer to key selection criteria. Despite, I have written this document several times myself but looking for samples to compare mine with them and improve. I spent a while in Google but could not find that much information. If you have this sample I would appreciate sharing it.

I would like to get vegetation type details in the MDB and the Murrumbidgee River catchment area to refer it for satellite image analysis. Please also refer any relevant articles. Thank you all in advance.

Can anyone point me in the direction of a source for national seclusion and restraint data for the UK? I am looking to compare it to the national rates in Australia.

Many thanks

Lesley Barr

I am looking for a PhD position in Australia. I have 4 years of clinical experience in the field of Positive Parenting and also have a related publication.

is it due to climate issues ?

or due to other factors?

give me suggestions, please?

I am organising a database of ACAs around the world who have the power to conduct public hearings as part of their corruption investigation. I am aware most Australian ACAs have such powers but is Australia an isolated case or same can be found elsewhere?

I am looking to speak with people, or be put in touch with people, who have research or practise in differentiation of teaching methods in private dance studios. Below is an outline of what I am proposing to research. I can be emailed at julie.barns@gmail.com Many thanks in advance!

An education in dance relies on a teacher's pedagogical knowledge and artistic experience. It is important for studio dance teachers to acquire pedagogical knowledge alongside their wealth of technical and artistic knowledge allowing them to dissect, question and change their practice to be inclusive of all dancers in their studio classes.

Private dance studios are available to anyone who wishes to learn dance, regardless of age, gender or motivation (recreational or otherwise). The dance community need to ensure best practice in teaching to ensure these studios encompass all who walk through their doors.

Historically, for studio teachers in Australia, pedagogical knowledge has been gained through osmosis, and while a studio teacher may have excellent technical knowledge the process through which this information is imparted has created a divide in the dance studio between gifted dancers and children who wish to dance recreationally, but are ostracised from the studio learning and teaching process due to a range of learning needs that are not being catered to. What could have been a powerful ongoing experience in a child's life is lost due to a teacher's inability to differentiate their teaching practices in the dance studio.

Whilst very few children who learn dance in studios go on to become professional company dancers, children do go on to become consumers of The Arts and dance in particular. These children may go on to become dance teachers, physiotherapists, set designers, or volunteers in theatres. They go on to recognise and value dance as a powerful tool for self expression, for physical wellbeing, for good mental health and self worth, for community building and for creating a culture of inclusiveness.

The research proposed will greatly benefit recreational and elite studio teachers across Australia, with the flow on effect making a difference in the cognitive, emotional and physical lives of our children.

Hello everyone, I'm trying to find the most practical and effective way to preserve and transport seafood tissue samples from a remote area for methyl-mercury analysis back in Australia. All the literature states that samples for this type of analysis were frozen upon collection at -18 to -20 degrees C but at the moment there isn't a freezer available at the sample site until we're back on the main island. I have considered the possibility of liquid nitrogen and a dry shipper but I have not used one before and wondering if it would stay cold enough if brought from Australia for the two-week trip. We then have the task of bringing them to Australia - in the past for genetics this was easier as I just used ethanol, but from what I've read this will be problematic due to the digestion acids used in the mercury analysis. Let me know your thoughts - thanks in advance.

Hi everyone,

As a convener, I would like to invite you to submit an abstract to the session: 08a: Metal Mobility in the Critical Zone and its Implications to Geochemical Exploration in Weathered Terrains in the Goldschmidt 2020.

The description of the session is below:

Shallow mineral deposit discoveries are becoming less common and those world-class deposits are either mined out or decreasing in production. One of the fundamental challenges for mineral exploration industry in this century is targeting deeper concealed mineral deposits under the critical zone. The increase in demand for mineral resources worldwide is driving investment in developing new geochemical exploration methods for vectoring concealed mineral deposits in deeply weathered and covered terrains. Extensive older terrains of Australia, India, West Africa, Brazil and China are deeply weathered and others such as Canada and Fennoscandia are overlain by recent glacial sediments. Thus, geochemical signatures of the mineralisation and the host rock can be obscured by deep weathering and transported cover providing challenges for exploring these terrains. The purpose of this session is to bring together a number of contributions showing interdisciplinary integrated approaches for understanding physical and biogeochemical mechanisms for metal mobility from the mineralised source through the critical zone to surface. The session also invites topics discussing recent advances in developing or improving geochemical and analytical (isotopic and dating) techniques, numerical modelling and experimental methods applied for mineral exploration through the critical zone. Geochemistry of supergene ore deposits, indicator mineral chemistry, and hydrogeochemical studies are also part of this session.

Please visit the following link for more detail: https://goldschmidt.info/2020/program/programViewThemes

Finally, I appreciate your quick response to my message and if you are not able to attend, could you please circulate this invitation to other colleagues working in the same field.

Best regards

Dr Walid Salama

Senior Research Scientist

CSIRO Mineral Resources

Australian Resources Research Centre

26 Dick Perry Avenue,

Kensington, WA 6151, Australia

E walid.salama@csiro.au

T +61 8 6436 8745

I am and accredited EMDR therapy practitioner working in a psychiatric hospital in Australia. Many of my patients take benzodiazepines on a PRN basis. I was taught that they reduce the effectiveness of EMDR therapy to the point where they should not be taken on the same day as therapy.

Can anyone direct me to research which might explain this effect, and also how long a patient needs to be benzo-free for it not to be a problem?

Thanks,

Pauline Allingham

Do you know of an EFL/ESL coursebook series for high school students, that has a strong focus on English-speaking cultures (such as Australia, India, South Africa)? I am mostly interested in Australia for my thesis, but any ideas are welcome.

I’m looking for experts in active transportation (walking/cycling), smart cities to have an interview with them for my PhD research project. I live in Australia but they can be from all around the world

Hi all

I am about to start a research / Dissertation in the area of fiscal policy in Australia. More specifically I Would like to start off with a Dissertation at Masters level leading to a Doctorate in the are of assessing the effectiveness of Fiscal policy. I Would like to know if there is anyone out there already in this field that I Could reach out to.

Thank you

Darren

I wish to develop resources for our Nursing Staff & develop a Bariatric Rehabilitation Programme.

I have used following method for acid digestion :

2 g of the powdered dry sample was added with 30 ml conc. HNO3 (nitric acid, 65%, Merck, Darmstadt, Germany) steadily in a flask and the sample was left for a night. 4 ml 30 % H2O2 (hydrogen peroxide, Chempur, Poland) was added to the flask and left for five hours (Li et al. 2013). After 5 hrs, samples were heated in a hot plate at 250°C till near dryness. Then 10 ml of conc. HNO3 was added to the residue till further near dryness. The process was repeated till the completion of the digestion of organic matters from the sample. After cooling the residue was transferred to the flask and diluted with deionised water. The sample was then filtered through filter paper (Whatman #42) and transferred to the chemical resistant bottles till further analysis for As, Cd, Cr, Cu, Hg, Pb and Zn in Atomic Absorption Spectrophotometer (AAS, AVANTA, GBC, Australia).

Hi!

I desperately need the recent consumption trends of cement and sand (million tonnes, preferably) in:

1. Australia (national)

2. New South Wales

3. Sydney region

I've been digging online for the past few days but to no avail.

Please cite references.

If you, perhaps, have data closely related to them, you may send them as well.

Pls tell me a source to download the land use map and terrain for Australia for free?

Dear Tuan Zea Tan,

My research is focused on association of miRNAs to the molecular subtypes of breast cancer and their clinical significance. I'd really appreciate if you could share the research strategies and any data regarding breast cancer, and obliged thereby.

Kind Regards,

KM Taufiqul Arif

PhD Candidate | Genomics Research Center | Institute of Health and Biomedical Innovation (IHBI) |  Queensland University of Technology | 60 Musk Ave, Kelvin Grove, QLD, 4059, Australia. |m:  +61 432 106 196  | e: kmtaufiqul.arif@hdr.qut.edu.au

Dear Professor Javidan,

Happy to be involved in the project in Australia any capacity should the opportunity arise.

Thank you

Is there appreciable alternative to representative democracy? Representative democracy in Australia look pretty fair but with some shortcomings. Can we suggest alternative model for representative democracy?

Dear colleagues,

At this time, I am looking for a supervisor who has a vacant PhD position in the field of power electronics and its application in power system.

I will be thankful if any of you introduces me one position in Canada, Australia, or Europe (except England).

For more information, my CV is attached to this question.

Thank you in advance.

Regards,

Amir.

I am currently in a PhD programme in Queensland University of Technology, Australia. My research project has to do with the development of a curricula framework for aged care education in an African setting. I am such of possible frameworks that I can utilise in my work.

Dear friends and researchers,

I just started my PhD journey as a new phd student, so I am preparing my proposal doc, My phd thesis in communication studies, specifically in health communication. I will investigate the role of mediated communication such as Twitter or Facebook in public health issues. I will focus on immunizations. Anti-vaccination groups make some campaigns and post many messages and posts about the risk of vaccines through social media, while the health authorities attempt to fight these movements and educate people about the importance of vaccination. I will examine the impact of public health messages of childhood vaccination on parental attitudes toward vaccinating their child. The mediated communications which address a common health concern among parents will be the focus, and I will apply my study to two different countries: Saudi Arabia and Australia.

My Question that I need your help with is: Do you think its better to do that through using Quantitative or Qualitative method by choosing a case study such as "Measles Vaccine issue" as a case study in both KSA & AUS, and use two 2 tools to collect our data (questionnaire+interview) Or (content analysis+text analysis) or (questionnaire+content analysis) that' may help to manage the research later, rather than using mixed method that needs to build questionnaires and survey for both country, which needs harder effort?

Best Regards,

I am currently in early stages of qualitative research design in the areas of perceptions and exploration of older adults . I am looking at investigating older adults with personality disorders and their experiences with Schema therapies to learn how as therapists we may then correlate it to younger patients in the life span and in addition enhance older patients quality of life

I am look to incorporate Delphi technique, qualitative questionnaire , focus groups and discussion

your thoughts in an area that is not well developed are valuable to a proof of concept or initial paper on the area of enhancing therapy for older patients and of course applying it to younger patients .

regards

Gary Darbyshire

MMgmt , MstratMktng, GradDip-CouPsych

Currently completing a project as part of studies in Mental health of older patients at the Australian College of Applied Psychology in Sydney Australia

I am currently designing a research proposal and require to quickly secure my document for approval

Urgently looking for a minimum of 6 to 8 qualified therapists who have dealt with older patients diagnosed with borderline personality disorder for a qualitative interview and questionaiire

I need to move quickly so if you have had experience in as a therapist I would very interested in talking to you you I have a deadline to secure participants so if you are able to assist please reply as soon as possible

Your assistance in this research will benefit future therapy in the area of treating older patients who have this disorder.

And referrals welcome

My details

Ph 61 434028920

Kind Regards

Gary Darbyshire

the articles are:

Safety and feasibility of home-based chemotherapy by Larsen FO, Christiansen AB, e.a. Danish medical journal 2018, May; 65(5) pii: A5482

A randomised crossover trial of chemotherapy in the home: patient preferences and cost analysis by King MT; Hall JP, Harnett PR.

Medical journal of Australia, 2001; Mar 19; 174(6) 312; author reply 312-3.

I've been involved in providing training in STEM topics (electronics, robotics and programming mainly) to school students and teachers in Australia for quite some time now. There can be multiple options, in terms of technology tool, that can support teaching of STEM topics. I want to understand how do you zero-in on a particular (off-the-self) STEM kit? What criterion you get ticked before placing the order?

PS: I'm focusing more at technology kits in the area of electronics, programming and robotics education in schools.

Hi everyone,

I have an amphipod that is evading identification. I think it belongs to the family Oedicerotidae, particularly in the genera Synchelidium or Pontocrates.

I have come to this conclusion as it has a subchelate gnathopod (G)1, a chelate G2 and a distinct rostrum. Photographs of the specimen are attached.

However, the crux is that neither genus is recorded in Australian waters. I have Lincoln's British Marine Amphipoda: Gammaridea and it does appear to match the description of these genera but it exhibits a mix of the feature that separates between them, i.e. the palm of G1 is half toothed and half smooth.

I have attached scans of the genera descriptions for your interest(extracted from Lincoln's book).

Anyone have any ideas? Could we have a new amphipod in Australia?